import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertNotNull;
import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.List;
+import java.util.Map;
+import java.util.TreeMap;
+
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.Annotation;
import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.GeneLociI;
import jalview.datamodel.Mapping;
-import jalview.datamodel.SearchResults;
-import jalview.datamodel.SearchResults.Match;
+import jalview.datamodel.SearchResultMatchI;
+import jalview.datamodel.SearchResultsI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
+import jalview.gui.JvOptionPane;
import jalview.io.AppletFormatAdapter;
+import jalview.io.DataSourceType;
+import jalview.io.FileFormat;
+import jalview.io.FileFormatI;
import jalview.io.FormatAdapter;
+import jalview.io.gff.SequenceOntologyI;
import jalview.util.MapList;
import jalview.util.MappingUtils;
-import java.io.IOException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.HashSet;
-import java.util.Iterator;
-import java.util.List;
-import java.util.Map;
-import java.util.Set;
-
-import org.testng.annotations.Test;
-
public class AlignmentUtilsTests
{
- // @formatter:off
- private static final String TEST_DATA =
- "# STOCKHOLM 1.0\n" +
- "#=GS D.melanogaster.1 AC AY119185.1/838-902\n" +
- "#=GS D.melanogaster.2 AC AC092237.1/57223-57161\n" +
- "#=GS D.melanogaster.3 AC AY060611.1/560-627\n" +
- "D.melanogaster.1 G.AGCC.CU...AUGAUCGA\n" +
- "#=GR D.melanogaster.1 SS ................((((\n" +
- "D.melanogaster.2 C.AUUCAACU.UAUGAGGAU\n" +
- "#=GR D.melanogaster.2 SS ................((((\n" +
- "D.melanogaster.3 G.UGGCGCU..UAUGACGCA\n" +
- "#=GR D.melanogaster.3 SS (.(((...(....(((((((\n" +
- "//";
-
- private static final String AA_SEQS_1 =
- ">Seq1Name\n" +
- "K-QY--L\n" +
- ">Seq2Name\n" +
- "-R-FP-W-\n";
-
- private static final String CDNA_SEQS_1 =
- ">Seq1Name\n" +
- "AC-GG--CUC-CAA-CT\n" +
- ">Seq2Name\n" +
- "-CG-TTA--ACG---AAGT\n";
-
- private static final String CDNA_SEQS_2 =
- ">Seq1Name\n" +
- "GCTCGUCGTACT\n" +
- ">Seq2Name\n" +
- "GGGTCAGGCAGT\n";
- // @formatter:on
-
- // public static Sequence ts=new
- // Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
- public static Sequence ts = new Sequence("short",
+ private static Sequence ts = new Sequence("short",
"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
@Test(groups = { "Functional" })
public void testExpandContext()
{
SequenceI s1 = ts.deriveSequence().getSubSequence(i, i + 7);
al.addSequence(s1);
}
- System.out.println(new AppletFormatAdapter().formatSequences("Clustal",
+ System.out.println(new AppletFormatAdapter().formatSequences(
+ FileFormat.Clustal,
al, true));
for (int flnk = -1; flnk < 25; flnk++)
{
AlignmentI exp = AlignmentUtils.expandContext(al, flnk);
System.out.println("\nFlank size: " + flnk);
System.out.println(new AppletFormatAdapter().formatSequences(
- "Clustal", exp, true));
+ FileFormat.Clustal, exp, true));
if (flnk == -1)
{
/*
{
final String data = ">Seq1Name\nKQYL\n" + ">Seq2Name\nRFPW\n"
+ ">Seq1Name\nABCD\n";
- AlignmentI al = loadAlignment(data, "FASTA");
+ AlignmentI al = loadAlignment(data, FileFormat.Fasta);
Map<String, List<SequenceI>> map = AlignmentUtils
.getSequencesByName(al);
assertEquals(2, map.keySet().size());
* @return
* @throws IOException
*/
- protected AlignmentI loadAlignment(final String data, String format)
+ protected AlignmentI loadAlignment(final String data, FileFormatI format)
throws IOException
{
AlignmentI a = new FormatAdapter().readFile(data,
- AppletFormatAdapter.PASTE, format);
+ DataSourceType.PASTE, format);
a.setDataset(null);
return a;
}
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_noXrefs() throws IOException
{
- List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ List<SequenceI> protseqs = new ArrayList<>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
- List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ List<SequenceI> dnaseqs = new ArrayList<>();
dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAA")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
SequenceI alignFrom = new Sequence("Seq2", alignModel);
alignFrom.createDatasetSequence();
AlignedCodonFrame acf = new AlignedCodonFrame();
- acf.addMap(alignMe.getDatasetSequence(), alignFrom.getDatasetSequence(), map);
+ acf.addMap(alignMe.getDatasetSequence(),
+ alignFrom.getDatasetSequence(), map);
AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "---", '-',
preserveMappedGaps, preserveUnmappedGaps);
}
/**
- * Test for the method that generates an aligned translated sequence from one
- * mapping.
- */
- @Test(groups = { "Functional" })
- public void testGetAlignedTranslation_dnaLikeProtein()
- {
- // dna alignment will be replaced
- SequenceI dna = new Sequence("Seq1", "T-G-CC-A--T-TAC-CAG-");
- dna.createDatasetSequence();
- // protein alignment will be 'applied' to dna
- SequenceI protein = new Sequence("Seq1", "-CH-Y--Q-");
- protein.createDatasetSequence();
- MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
- AlignedCodonFrame acf = new AlignedCodonFrame();
- acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
-
- final SequenceI aligned = AlignmentUtils.getAlignedTranslation(protein,
- '-', acf);
- assertEquals("---TGCCAT---TAC------CAG---",
- aligned.getSequenceAsString());
- assertSame(aligned.getDatasetSequence(), dna.getDatasetSequence());
- }
-
- /**
* Test the method that realigns protein to match mapped codon alignment.
*/
@Test(groups = { "Functional" })
acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
- ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<>();
acfs.add(acf);
protein.setCodonFrames(acfs);
@Test(groups = { "Functional" })
public void testTranslatesAs()
{
+ // null arguments check
+ assertFalse(AlignmentUtils.translatesAs(null, 0, null));
+ assertFalse(AlignmentUtils.translatesAs(new char[] { 't' }, 0, null));
+ assertFalse(AlignmentUtils.translatesAs(null, 0, new char[] { 'a' }));
+
+ // straight translation
assertTrue(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(), 0,
"FPKG".toCharArray()));
- // with start codon (not in protein)
+ // with extra start codon (not in protein)
assertTrue(AlignmentUtils.translatesAs("atgtttcccaaaggg".toCharArray(),
3, "FPKG".toCharArray()));
// with stop codon1 (not in protein)
assertTrue(AlignmentUtils.translatesAs(
"atgtttcccaaagggtga".toCharArray(), 3, "FPKG".toCharArray()));
- // with embedded stop codon
+ // with embedded stop codons
assertTrue(AlignmentUtils.translatesAs(
"atgtttTAGcccaaaTAAgggtga".toCharArray(), 3,
"F*PK*G".toCharArray()));
// wrong protein
assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
0, "FPMG".toCharArray()));
+
+ // truncated dna
+ assertFalse(AlignmentUtils.translatesAs("tttcccaaagg".toCharArray(), 0,
+ "FPKG".toCharArray()));
+
+ // truncated protein
+ assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
+ 0, "FPK".toCharArray()));
+
+ // overlong dna (doesn't end in stop codon)
+ assertFalse(AlignmentUtils.translatesAs(
+ "tttcccaaagggttt".toCharArray(), 0, "FPKG".toCharArray()));
+
+ // dna + stop codon + more
+ assertFalse(AlignmentUtils.translatesAs(
+ "tttcccaaagggttaga".toCharArray(), 0, "FPKG".toCharArray()));
+
+ // overlong protein
+ assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
+ 0, "FPKGQ".toCharArray()));
}
/**
public void testMapProteinAlignmentToCdna_withStartAndStopCodons()
throws IOException
{
- List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ List<SequenceI> protseqs = new ArrayList<>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
- List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ List<SequenceI> dnaseqs = new ArrayList<>();
// start + SAR:
dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC"));
// = EIQ + stop
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_withXrefs() throws IOException
{
- List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ List<SequenceI> protseqs = new ArrayList<>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
- List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ List<SequenceI> dnaseqs = new ArrayList<>();
dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ
dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
public void testMapProteinAlignmentToCdna_prioritiseXrefs()
throws IOException
{
- List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ List<SequenceI> protseqs = new ArrayList<>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
AlignmentI protein = new Alignment(
protseqs.toArray(new SequenceI[protseqs.size()]));
protein.setDataset(null);
- List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ List<SequenceI> dnaseqs = new ArrayList<>();
dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs
al.addAnnotation(ann4); // Temp for seq1
al.addAnnotation(ann5); // Temp for seq2
al.addAnnotation(ann6); // Temp for no sequence
- List<String> types = new ArrayList<String>();
- List<SequenceI> scope = new ArrayList<SequenceI>();
+ List<String> types = new ArrayList<>();
+ List<SequenceI> scope = new ArrayList<>();
/*
* Set all sequence related Structure to hidden (ann1, ann2)
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
// now the other way round
- seq1.setDBRefs(null);
+ seq1.setDBRefs(null);
seq2.addDBRef(new DBRefEntry("EMBL", "1", "A12345"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
@Test(groups = { "Functional" })
public void testMakeCdsAlignment()
{
+ /*
+ * scenario:
+ * dna1 --> [4, 6] [10,12] --> pep1
+ * dna2 --> [1, 3] [7, 9] [13,15] --> pep2
+ */
SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC");
SequenceI pep1 = new Sequence("pep1", "GF");
SequenceI pep2 = new Sequence("pep2", "GFP");
+ pep1.addDBRef(new DBRefEntry("UNIPROT", "0", "pep1"));
+ pep2.addDBRef(new DBRefEntry("UNIPROT", "0", "pep2"));
dna1.createDatasetSequence();
dna2.createDatasetSequence();
pep1.createDatasetSequence();
pep2.createDatasetSequence();
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds5", 13, 15, 0f,
- null));
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 });
dna.setDataset(null);
- List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
- MapList map = new MapList(new int[] { 4, 6, 10, 12 },
- new int[] { 1, 2 }, 3, 1);
+ /*
+ * put a variant feature on dna2 base 8
+ * - should transfer to cds2 base 5
+ */
+ dna2.addSequenceFeature(new SequenceFeature("variant", "hgmd", 8, 8,
+ 0f, null));
+
+ /*
+ * need a sourceDbRef if we are to construct dbrefs to the CDS
+ * sequence from the dna contig sequences
+ */
+ DBRefEntry dbref = new DBRefEntry("ENSEMBL", "0", "dna1");
+ dna1.getDatasetSequence().addDBRef(dbref);
+ org.testng.Assert.assertEquals(dbref, dna1.getPrimaryDBRefs().get(0));
+ dbref = new DBRefEntry("ENSEMBL", "0", "dna2");
+ dna2.getDatasetSequence().addDBRef(dbref);
+ org.testng.Assert.assertEquals(dbref, dna2.getPrimaryDBRefs().get(0));
+
+ /*
+ * CDS sequences are 'discovered' from dna-to-protein mappings on the alignment
+ * dataset (e.g. added from dbrefs by CrossRef.findXrefSequences)
+ */
+ MapList mapfordna1 = new MapList(new int[] { 4, 6, 10, 12 }, new int[] {
+ 1, 2 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
- acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
- mappings.add(acf);
- map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 },
- 3, 1);
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(),
+ mapfordna1);
+ dna.addCodonFrame(acf);
+ MapList mapfordna2 = new MapList(new int[] { 1, 3, 7, 9, 13, 15 },
+ new int[] { 1, 3 }, 3, 1);
acf = new AlignedCodonFrame();
- acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
- mappings.add(acf);
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(),
+ mapfordna2);
+ dna.addCodonFrame(acf);
+ /*
+ * In this case, mappings originally came from matching Uniprot accessions
+ * - so need an xref on dna involving those regions.
+ * These are normally constructed from CDS annotation
+ */
+ DBRefEntry dna1xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep1",
+ new Mapping(mapfordna1));
+ dna1.addDBRef(dna1xref);
+ assertEquals(2, dna1.getDBRefs().size()); // to self and to pep1
+ DBRefEntry dna2xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep2",
+ new Mapping(mapfordna2));
+ dna2.addDBRef(dna2xref);
+ assertEquals(2, dna2.getDBRefs().size()); // to self and to pep2
+
+ /*
+ * execute method under test:
+ */
AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
- dna1, dna2 }, mappings, dna);
+ dna1, dna2 }, dna.getDataset(), null);
+
+ /*
+ * verify cds sequences
+ */
assertEquals(2, cds.getSequences().size());
- assertEquals("---GGG---TTT---", cds.getSequenceAt(0)
- .getSequenceAsString());
- assertEquals("GGG---TTT---CCC", cds.getSequenceAt(1)
- .getSequenceAsString());
+ assertEquals("GGGTTT", cds.getSequenceAt(0).getSequenceAsString());
+ assertEquals("GGGTTTCCC", cds.getSequenceAt(1).getSequenceAsString());
/*
* verify shared, extended alignment dataset
*/
assertSame(dna.getDataset(), cds.getDataset());
- assertTrue(dna.getDataset().getSequences()
- .contains(cds.getSequenceAt(0).getDatasetSequence()));
- assertTrue(dna.getDataset().getSequences()
- .contains(cds.getSequenceAt(1).getDatasetSequence()));
+ SequenceI cds1Dss = cds.getSequenceAt(0).getDatasetSequence();
+ SequenceI cds2Dss = cds.getSequenceAt(1).getDatasetSequence();
+ assertTrue(dna.getDataset().getSequences().contains(cds1Dss));
+ assertTrue(dna.getDataset().getSequences().contains(cds2Dss));
+
+ /*
+ * verify CDS has a dbref with mapping to peptide
+ */
+ assertNotNull(cds1Dss.getDBRefs());
+ assertEquals(2, cds1Dss.getDBRefs().size());
+ dbref = cds1Dss.getDBRefs().get(0);
+ assertEquals(dna1xref.getSource(), dbref.getSource());
+ // version is via ensembl's primary ref
+ assertEquals(dna1xref.getVersion(), dbref.getVersion());
+ assertEquals(dna1xref.getAccessionId(), dbref.getAccessionId());
+ assertNotNull(dbref.getMap());
+ assertSame(pep1.getDatasetSequence(), dbref.getMap().getTo());
+ MapList cdsMapping = new MapList(new int[] { 1, 6 },
+ new int[] { 1, 2 }, 3, 1);
+ assertEquals(cdsMapping, dbref.getMap().getMap());
+
+ /*
+ * verify peptide has added a dbref with reverse mapping to CDS
+ */
+ assertNotNull(pep1.getDBRefs());
+ // FIXME pep1.getDBRefs() is 1 - is that the correct behaviour ?
+ assertEquals(2, pep1.getDBRefs().size());
+ dbref = pep1.getDBRefs().get(1);
+ assertEquals("ENSEMBL", dbref.getSource());
+ assertEquals("0", dbref.getVersion());
+ assertEquals("CDS|dna1", dbref.getAccessionId());
+ assertNotNull(dbref.getMap());
+ assertSame(cds1Dss, dbref.getMap().getTo());
+ assertEquals(cdsMapping.getInverse(), dbref.getMap().getMap());
/*
- * Verify updated mappings
+ * verify cDNA has added a dbref with mapping to CDS
*/
- assertEquals(2, mappings.size());
+ assertEquals(3, dna1.getDBRefs().size());
+ DBRefEntry dbRefEntry = dna1.getDBRefs().get(2);
+ assertSame(cds1Dss, dbRefEntry.getMap().getTo());
+ MapList dnaToCdsMapping = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+ assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap());
+ assertEquals(3, dna2.getDBRefs().size());
+ dbRefEntry = dna2.getDBRefs().get(2);
+ assertSame(cds2Dss, dbRefEntry.getMap().getTo());
+ dnaToCdsMapping = new MapList(new int[] { 1, 3, 7, 9, 13, 15 },
+ new int[] { 1, 9 }, 1, 1);
+ assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap());
/*
+ * verify CDS has added a dbref with mapping to cDNA
+ */
+ assertEquals(2, cds1Dss.getDBRefs().size());
+ dbRefEntry = cds1Dss.getDBRefs().get(1);
+ assertSame(dna1.getDatasetSequence(), dbRefEntry.getMap().getTo());
+ MapList cdsToDnaMapping = new MapList(new int[] { 1, 6 }, new int[] {
+ 4, 6, 10, 12 }, 1, 1);
+ assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap());
+ assertEquals(2, cds2Dss.getDBRefs().size());
+ dbRefEntry = cds2Dss.getDBRefs().get(1);
+ assertSame(dna2.getDatasetSequence(), dbRefEntry.getMap().getTo());
+ cdsToDnaMapping = new MapList(new int[] { 1, 9 }, new int[] { 1, 3, 7,
+ 9, 13, 15 }, 1, 1);
+ assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap());
+
+ /*
+ * Verify mappings from CDS to peptide, cDNA to CDS, and cDNA to peptide
+ * the mappings are on the shared alignment dataset
+ * 6 mappings, 2*(DNA->CDS), 2*(DNA->Pep), 2*(CDS->Pep)
+ */
+ List<AlignedCodonFrame> cdsMappings = cds.getDataset().getCodonFrames();
+ assertEquals(6, cdsMappings.size());
+
+ /*
+ * verify that mapping sets for dna and cds alignments are different
+ * [not current behaviour - all mappings are on the alignment dataset]
+ */
+ // select -> subselect type to test.
+ // Assert.assertNotSame(dna.getCodonFrames(), cds.getCodonFrames());
+ // assertEquals(4, dna.getCodonFrames().size());
+ // assertEquals(4, cds.getCodonFrames().size());
+
+ /*
+ * Two mappings involve pep1 (dna to pep1, cds to pep1)
* Mapping from pep1 to GGGTTT in first new exon sequence
*/
- List<AlignedCodonFrame> pep1Mapping = MappingUtils
- .findMappingsForSequence(pep1, mappings);
- assertEquals(1, pep1Mapping.size());
+ List<AlignedCodonFrame> pep1Mappings = MappingUtils
+ .findMappingsForSequence(pep1, cdsMappings);
+ assertEquals(2, pep1Mappings.size());
+ List<AlignedCodonFrame> mappings = MappingUtils
+ .findMappingsForSequence(cds.getSequenceAt(0), pep1Mappings);
+ assertEquals(1, mappings.size());
+
// map G to GGG
- SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ SearchResultsI sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
assertEquals(1, sr.getResults().size());
- Match m = sr.getResults().get(0);
- assertSame(cds.getSequenceAt(0).getDatasetSequence(),
- m.getSequence());
+ SearchResultMatchI m = sr.getResults().get(0);
+ assertSame(cds1Dss, m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
// map F to TTT
sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
m = sr.getResults().get(0);
- assertSame(cds.getSequenceAt(0).getDatasetSequence(),
- m.getSequence());
+ assertSame(cds1Dss, m.getSequence());
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
/*
- * Mapping from pep2 to GGGTTTCCC in second new exon sequence
+ * Two mappings involve pep2 (dna to pep2, cds to pep2)
+ * Verify mapping from pep2 to GGGTTTCCC in second new exon sequence
*/
- List<AlignedCodonFrame> pep2Mapping = MappingUtils
- .findMappingsForSequence(pep2, mappings);
- assertEquals(1, pep2Mapping.size());
+ List<AlignedCodonFrame> pep2Mappings = MappingUtils
+ .findMappingsForSequence(pep2, cdsMappings);
+ assertEquals(2, pep2Mappings.size());
+ mappings = MappingUtils.findMappingsForSequence(cds.getSequenceAt(1),
+ pep2Mappings);
+ assertEquals(1, mappings.size());
// map G to GGG
sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
assertEquals(1, sr.getResults().size());
m = sr.getResults().get(0);
- assertSame(cds.getSequenceAt(1).getDatasetSequence(),
- m.getSequence());
+ assertSame(cds2Dss, m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
// map F to TTT
sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
m = sr.getResults().get(0);
- assertSame(cds.getSequenceAt(1).getDatasetSequence(),
- m.getSequence());
+ assertSame(cds2Dss, m.getSequence());
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
// map P to CCC
sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
m = sr.getResults().get(0);
- assertSame(cds.getSequenceAt(1).getDatasetSequence(),
- m.getSequence());
+ assertSame(cds2Dss, m.getSequence());
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
- }
-
- /**
- * Test the method that makes a cds-only sequence from a DNA sequence and its
- * product mapping. Test includes the expected case that the DNA sequence
- * already has a protein product (Uniprot translation) which in turn has an
- * x-ref to the EMBLCDS record.
- */
- @Test(groups = { "Functional" })
- public void testMakeCdsSequences()
- {
- SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
- SequenceI pep1 = new Sequence("pep1", "GF");
- dna1.createDatasetSequence();
- pep1.createDatasetSequence();
- pep1.getDatasetSequence().addDBRef(
- new DBRefEntry("EMBLCDS", "2", "A12345"));
/*
- * Make the mapping from dna to protein. The protein sequence has a DBRef to
- * EMBLCDS|A12345.
+ * check cds2 acquired a variant feature in position 5
*/
- Set<AlignedCodonFrame> mappings = new HashSet<AlignedCodonFrame>();
- MapList map = new MapList(new int[] { 4, 6, 10, 12 },
- new int[] { 1, 2 }, 3, 1);
- AlignedCodonFrame acf = new AlignedCodonFrame();
- acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
- mappings.add(acf);
-
- AlignedCodonFrame newMapping = new AlignedCodonFrame();
- List<int[]> ungappedColumns = new ArrayList<int[]>();
- ungappedColumns.add(new int[] { 4, 6 });
- ungappedColumns.add(new int[] { 10, 12 });
- List<SequenceI> cdsSeqs = AlignmentUtils.makeCdsSequences(dna1, acf,
- ungappedColumns,
- newMapping, '-');
- assertEquals(1, cdsSeqs.size());
- SequenceI cdsSeq = cdsSeqs.get(0);
-
- assertEquals("GGGTTT", cdsSeq.getSequenceAsString());
- assertEquals("dna1|A12345", cdsSeq.getName());
- assertEquals(1, cdsSeq.getDBRefs().length);
- DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
- assertEquals("EMBLCDS", cdsRef.getSource());
- assertEquals("2", cdsRef.getVersion());
- assertEquals("A12345", cdsRef.getAccessionId());
+ List<SequenceFeature> sfs = cds2Dss.getSequenceFeatures();
+ assertNotNull(sfs);
+ assertEquals(1, sfs.size());
+ assertEquals("variant", sfs.get(0).type);
+ assertEquals(5, sfs.get(0).begin);
+ assertEquals(5, sfs.get(0).end);
}
/**
pep1.createDatasetSequence();
pep2.createDatasetSequence();
pep3.createDatasetSequence();
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds5", 1, 3, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds6", 10, 12, 0f,
- null));
pep1.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "2", "A12345"));
pep2.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "4", "A12347"));
/*
+ * Create the CDS alignment
+ */
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1 });
+ dna.setDataset(null);
+
+ /*
* Make the mappings from dna to protein
*/
- List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
// map ...GGG...TTT to GF
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 2 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
- mappings.add(acf);
+ dna.addCodonFrame(acf);
// map aaa...ccc to KP
map = new MapList(new int[] { 1, 3, 7, 9 }, new int[] { 1, 2 }, 3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep2.getDatasetSequence(), map);
- mappings.add(acf);
+ dna.addCodonFrame(acf);
// map aaa......TTT to KF
map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 2 }, 3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map);
- mappings.add(acf);
+ dna.addCodonFrame(acf);
/*
- * Create the Exon alignment; also replaces the dna-to-protein mappings with
- * exon-to-protein and exon-to-dna mappings
+ * execute method under test
*/
- AlignmentI dna = new Alignment(new SequenceI[] { dna1 });
- dna.setDataset(null);
- AlignmentI exal = AlignmentUtils.makeCdsAlignment(
- new SequenceI[] { dna1 }, mappings, dna);
+ AlignmentI cdsal = AlignmentUtils.makeCdsAlignment(
+ new SequenceI[] { dna1 }, dna.getDataset(), null);
/*
* Verify we have 3 cds sequences, mapped to pep1/2/3 respectively
*/
- List<SequenceI> cds = exal.getSequences();
+ List<SequenceI> cds = cdsal.getSequences();
assertEquals(3, cds.size());
/*
* verify shared, extended alignment dataset
*/
- assertSame(exal.getDataset(), dna.getDataset());
+ assertSame(cdsal.getDataset(), dna.getDataset());
assertTrue(dna.getDataset().getSequences()
.contains(cds.get(0).getDatasetSequence()));
assertTrue(dna.getDataset().getSequences()
* verify aligned cds sequences and their xrefs
*/
SequenceI cdsSeq = cds.get(0);
- assertEquals("---GGG---TTT", cdsSeq.getSequenceAsString());
- assertEquals("dna1|A12345", cdsSeq.getName());
- assertEquals(1, cdsSeq.getDBRefs().length);
- DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
- assertEquals("EMBLCDS", cdsRef.getSource());
- assertEquals("2", cdsRef.getVersion());
- assertEquals("A12345", cdsRef.getAccessionId());
+ assertEquals("GGGTTT", cdsSeq.getSequenceAsString());
+ // assertEquals("dna1|A12345", cdsSeq.getName());
+ assertEquals("CDS|dna1", cdsSeq.getName());
+ // assertEquals(1, cdsSeq.getDBRefs().length);
+ // DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
+ // assertEquals("EMBLCDS", cdsRef.getSource());
+ // assertEquals("2", cdsRef.getVersion());
+ // assertEquals("A12345", cdsRef.getAccessionId());
cdsSeq = cds.get(1);
- assertEquals("aaa---ccc---", cdsSeq.getSequenceAsString());
- assertEquals("dna1|A12346", cdsSeq.getName());
- assertEquals(1, cdsSeq.getDBRefs().length);
- cdsRef = cdsSeq.getDBRefs()[0];
- assertEquals("EMBLCDS", cdsRef.getSource());
- assertEquals("3", cdsRef.getVersion());
- assertEquals("A12346", cdsRef.getAccessionId());
+ assertEquals("aaaccc", cdsSeq.getSequenceAsString());
+ // assertEquals("dna1|A12346", cdsSeq.getName());
+ assertEquals("CDS|dna1", cdsSeq.getName());
+ // assertEquals(1, cdsSeq.getDBRefs().length);
+ // cdsRef = cdsSeq.getDBRefs()[0];
+ // assertEquals("EMBLCDS", cdsRef.getSource());
+ // assertEquals("3", cdsRef.getVersion());
+ // assertEquals("A12346", cdsRef.getAccessionId());
cdsSeq = cds.get(2);
- assertEquals("aaa------TTT", cdsSeq.getSequenceAsString());
- assertEquals("dna1|A12347", cdsSeq.getName());
- assertEquals(1, cdsSeq.getDBRefs().length);
- cdsRef = cdsSeq.getDBRefs()[0];
- assertEquals("EMBLCDS", cdsRef.getSource());
- assertEquals("4", cdsRef.getVersion());
- assertEquals("A12347", cdsRef.getAccessionId());
+ assertEquals("aaaTTT", cdsSeq.getSequenceAsString());
+ // assertEquals("dna1|A12347", cdsSeq.getName());
+ assertEquals("CDS|dna1", cdsSeq.getName());
+ // assertEquals(1, cdsSeq.getDBRefs().length);
+ // cdsRef = cdsSeq.getDBRefs()[0];
+ // assertEquals("EMBLCDS", cdsRef.getSource());
+ // assertEquals("4", cdsRef.getVersion());
+ // assertEquals("A12347", cdsRef.getAccessionId());
/*
* Verify there are mappings from each cds sequence to its protein product
* and also to its dna source
*/
- Iterator<AlignedCodonFrame> newMappingsIterator = mappings.iterator();
-
- // mappings for dna1 - exon1 - pep1
- AlignedCodonFrame cdsMapping = newMappingsIterator.next();
- List<Mapping> dnaMappings = cdsMapping.getMappingsForSequence(dna1);
- assertEquals(1, dnaMappings.size());
- assertSame(cds.get(0).getDatasetSequence(), dnaMappings.get(0)
- .getTo());
- assertEquals("G(1) in CDS should map to G(4) in DNA", 4, dnaMappings
- .get(0).getMap().getToPosition(1));
- List<Mapping> peptideMappings = cdsMapping
- .getMappingsForSequence(pep1);
- assertEquals(1, peptideMappings.size());
- assertSame(pep1.getDatasetSequence(), peptideMappings.get(0).getTo());
-
- // mappings for dna1 - cds2 - pep2
- cdsMapping = newMappingsIterator.next();
- dnaMappings = cdsMapping.getMappingsForSequence(dna1);
- assertEquals(1, dnaMappings.size());
- assertSame(cds.get(1).getDatasetSequence(), dnaMappings.get(0)
- .getTo());
- assertEquals("c(4) in CDS should map to c(7) in DNA", 7, dnaMappings
- .get(0).getMap().getToPosition(4));
- peptideMappings = cdsMapping.getMappingsForSequence(pep2);
- assertEquals(1, peptideMappings.size());
- assertSame(pep2.getDatasetSequence(), peptideMappings.get(0).getTo());
-
- // mappings for dna1 - cds3 - pep3
- cdsMapping = newMappingsIterator.next();
- dnaMappings = cdsMapping.getMappingsForSequence(dna1);
- assertEquals(1, dnaMappings.size());
- assertSame(cds.get(2).getDatasetSequence(), dnaMappings.get(0)
- .getTo());
- assertEquals("T(4) in CDS should map to T(10) in DNA", 10, dnaMappings
- .get(0).getMap().getToPosition(4));
- peptideMappings = cdsMapping.getMappingsForSequence(pep3);
- assertEquals(1, peptideMappings.size());
- assertSame(pep3.getDatasetSequence(), peptideMappings.get(0).getTo());
+ List<AlignedCodonFrame> newMappings = cdsal.getCodonFrames();
+
+ /*
+ * 6 mappings involve dna1 (to pep1/2/3, cds1/2/3)
+ */
+ List<AlignedCodonFrame> dnaMappings = MappingUtils
+ .findMappingsForSequence(dna1, newMappings);
+ assertEquals(6, dnaMappings.size());
+
+ /*
+ * dna1 to pep1
+ */
+ List<AlignedCodonFrame> mappings = MappingUtils
+ .findMappingsForSequence(pep1, dnaMappings);
+ assertEquals(1, mappings.size());
+ assertEquals(1, mappings.get(0).getMappings().size());
+ assertSame(pep1.getDatasetSequence(), mappings.get(0).getMappings()
+ .get(0).getMapping().getTo());
+
+ /*
+ * dna1 to cds1
+ */
+ List<AlignedCodonFrame> dnaToCds1Mappings = MappingUtils
+ .findMappingsForSequence(cds.get(0), dnaMappings);
+ Mapping mapping = dnaToCds1Mappings.get(0).getMappings().get(0)
+ .getMapping();
+ assertSame(cds.get(0).getDatasetSequence(), mapping.getTo());
+ assertEquals("G(1) in CDS should map to G(4) in DNA", 4, mapping
+ .getMap().getToPosition(1));
+
+ /*
+ * dna1 to pep2
+ */
+ mappings = MappingUtils.findMappingsForSequence(pep2, dnaMappings);
+ assertEquals(1, mappings.size());
+ assertEquals(1, mappings.get(0).getMappings().size());
+ assertSame(pep2.getDatasetSequence(), mappings.get(0).getMappings()
+ .get(0).getMapping().getTo());
+
+ /*
+ * dna1 to cds2
+ */
+ List<AlignedCodonFrame> dnaToCds2Mappings = MappingUtils
+ .findMappingsForSequence(cds.get(1), dnaMappings);
+ mapping = dnaToCds2Mappings.get(0).getMappings().get(0).getMapping();
+ assertSame(cds.get(1).getDatasetSequence(), mapping.getTo());
+ assertEquals("c(4) in CDS should map to c(7) in DNA", 7, mapping
+ .getMap().getToPosition(4));
+
+ /*
+ * dna1 to pep3
+ */
+ mappings = MappingUtils.findMappingsForSequence(pep3, dnaMappings);
+ assertEquals(1, mappings.size());
+ assertEquals(1, mappings.get(0).getMappings().size());
+ assertSame(pep3.getDatasetSequence(), mappings.get(0).getMappings()
+ .get(0).getMapping().getTo());
+
+ /*
+ * dna1 to cds3
+ */
+ List<AlignedCodonFrame> dnaToCds3Mappings = MappingUtils
+ .findMappingsForSequence(cds.get(2), dnaMappings);
+ mapping = dnaToCds3Mappings.get(0).getMappings().get(0).getMapping();
+ assertSame(cds.get(2).getDatasetSequence(), mapping.getTo());
+ assertEquals("T(4) in CDS should map to T(10) in DNA", 10, mapping
+ .getMap().getToPosition(4));
}
@Test(groups = { "Functional" })
* @throws IOException
*/
@Test(groups = { "Functional" })
- public void testMapProteinSequenceToCdna_forSubsequence()
- throws IOException
+ public void testMapCdnaToProtein_forSubsequence() throws IOException
{
SequenceI prot = new Sequence("UNIPROT|V12345", "E-I--Q", 10, 12);
prot.createDatasetSequence();
SequenceI dna = new Sequence("EMBL|A33333", "GAA--AT-C-CAG", 40, 48);
dna.createDatasetSequence();
- MapList map = AlignmentUtils.mapProteinSequenceToCdna(prot, dna);
+ MapList map = AlignmentUtils.mapCdnaToProtein(prot, dna);
assertEquals(10, map.getToLowest());
assertEquals(12, map.getToHighest());
assertEquals(40, map.getFromLowest());
@Test(groups = { "Functional" })
public void testAlignSequenceAs_mappedProteinProtein()
{
-
+
SequenceI alignMe = new Sequence("Match", "MGAASEV");
alignMe.createDatasetSequence();
SequenceI alignFrom = new Sequence("Query", "LQTGYMGAASEVMFSPTRR");
MapList map = new MapList(new int[] { 6, 12 }, new int[] { 1, 7 }, 1, 1);
acf.addMap(alignFrom.getDatasetSequence(),
alignMe.getDatasetSequence(), map);
-
+
AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "-", '-', true,
true);
assertEquals("-----MGAASEV-------", alignMe.getSequenceAsString());
{
// map first 3 codons to KPF; G is a trailing unmapped residue
MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
-
+
checkAlignSequenceAs("AAACCCTTT", "K-PFG", true, true, map,
"AAA---CCCTTT---");
}
* that partially overlap 5' or 3' (start or end) of target sequence
*/
AlignmentUtils.transferFeatures(dna, cds, map, null);
- SequenceFeature[] sfs = cds.getSequenceFeatures();
- assertEquals(6, sfs.length);
+ List<SequenceFeature> sfs = cds.getSequenceFeatures();
+ assertEquals(6, sfs.size());
- SequenceFeature sf = sfs[0];
+ SequenceFeature sf = sfs.get(0);
assertEquals("type2", sf.getType());
assertEquals("desc2", sf.getDescription());
assertEquals(2f, sf.getScore());
assertEquals(1, sf.getBegin());
assertEquals(1, sf.getEnd());
- sf = sfs[1];
+ sf = sfs.get(1);
assertEquals("type3", sf.getType());
assertEquals("desc3", sf.getDescription());
assertEquals(3f, sf.getScore());
assertEquals(1, sf.getBegin());
assertEquals(3, sf.getEnd());
- sf = sfs[2];
+ sf = sfs.get(2);
assertEquals("type4", sf.getType());
assertEquals(2, sf.getBegin());
assertEquals(5, sf.getEnd());
- sf = sfs[3];
+ sf = sfs.get(3);
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
- sf = sfs[4];
+ sf = sfs.get(4);
assertEquals("type8", sf.getType());
assertEquals(6, sf.getBegin());
assertEquals(6, sf.getEnd());
- sf = sfs[5];
+ sf = sfs.get(5);
assertEquals("type9", sf.getType());
assertEquals(6, sf.getBegin());
assertEquals(6, sf.getEnd());
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 6 }, 1, 1);
-
+
// [5, 11] maps to [2, 5]
dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
null));
// [12, 12] maps to [6, 6]
dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
8f, null));
-
+
// desc4 and desc8 are the 'omit these' varargs
AlignmentUtils.transferFeatures(dna, cds, map, null, "type4", "type8");
- SequenceFeature[] sfs = cds.getSequenceFeatures();
- assertEquals(1, sfs.length);
-
- SequenceFeature sf = sfs[0];
+ List<SequenceFeature> sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.size());
+
+ SequenceFeature sf = sfs.get(0);
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
{
SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
-
+
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 6 }, 1, 1);
-
+
// [5, 11] maps to [2, 5]
dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
null));
// [12, 12] maps to [6, 6]
dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
8f, null));
-
+
// "type5" is the 'select this type' argument
AlignmentUtils.transferFeatures(dna, cds, map, "type5");
- SequenceFeature[] sfs = cds.getSequenceFeatures();
- assertEquals(1, sfs.length);
-
- SequenceFeature sf = sfs[0];
+ List<SequenceFeature> sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.size());
+
+ SequenceFeature sf = sfs.get(0);
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
dna3.createDatasetSequence();
pep1.createDatasetSequence();
pep2.createDatasetSequence();
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 8, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 9, 12, 0f,
- null));
- dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 16, 18, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 4, 8, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
- null));
- dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 16, 18, 0f,
- null));
-
- List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
+ dna.setDataset(null);
+
MapList map = new MapList(new int[] { 4, 12, 16, 18 },
new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
- mappings.add(acf);
+ dna.addCodonFrame(acf);
map = new MapList(new int[] { 4, 8, 12, 12, 16, 18 },
- new int[] { 1, 3 },
- 3, 1);
+ new int[] { 1, 3 }, 3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
- mappings.add(acf);
-
- AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
- dna.setDataset(null);
+ dna.addCodonFrame(acf);
+
AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
- dna1, dna2, dna3 }, mappings, dna);
+ dna1, dna2, dna3 }, dna.getDataset(), null);
List<SequenceI> cdsSeqs = cds.getSequences();
assertEquals(2, cdsSeqs.size());
assertEquals("GGGCCCTTTGGG", cdsSeqs.get(0).getSequenceAsString());
- assertEquals("GGGCC---TGGG", cdsSeqs.get(1).getSequenceAsString());
-
+ assertEquals("GGGCCTGGG", cdsSeqs.get(1).getSequenceAsString());
+
/*
* verify shared, extended alignment dataset
*/
.contains(cdsSeqs.get(1).getDatasetSequence()));
/*
- * Verify updated mappings
+ * Verify 6 mappings: dna1 to cds1, cds1 to pep1, dna1 to pep1
+ * and the same for dna2/cds2/pep2
*/
- assertEquals(2, mappings.size());
-
+ List<AlignedCodonFrame> mappings = cds.getCodonFrames();
+ assertEquals(6, mappings.size());
+
/*
- * Mapping from pep1 to GGGTTT in first new CDS sequence
+ * 2 mappings involve pep1
*/
- List<AlignedCodonFrame> pep1Mapping = MappingUtils
+ List<AlignedCodonFrame> pep1Mappings = MappingUtils
.findMappingsForSequence(pep1, mappings);
- assertEquals(1, pep1Mapping.size());
+ assertEquals(2, pep1Mappings.size());
+
/*
+ * Get mapping of pep1 to cds1 and verify it
* maps GPFG to 1-3,4-6,7-9,10-12
*/
- SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ List<AlignedCodonFrame> pep1CdsMappings = MappingUtils
+ .findMappingsForSequence(cds.getSequenceAt(0), pep1Mappings);
+ assertEquals(1, pep1CdsMappings.size());
+ SearchResultsI sr = MappingUtils.buildSearchResults(pep1, 1,
+ pep1CdsMappings);
assertEquals(1, sr.getResults().size());
- Match m = sr.getResults().get(0);
- assertEquals(cds.getSequenceAt(0).getDatasetSequence(),
- m.getSequence());
+ SearchResultMatchI m = sr.getResults().get(0);
+ assertEquals(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
- sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
+ sr = MappingUtils.buildSearchResults(pep1, 2, pep1CdsMappings);
m = sr.getResults().get(0);
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
- sr = MappingUtils.buildSearchResults(pep1, 3, mappings);
+ sr = MappingUtils.buildSearchResults(pep1, 3, pep1CdsMappings);
m = sr.getResults().get(0);
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
- sr = MappingUtils.buildSearchResults(pep1, 4, mappings);
+ sr = MappingUtils.buildSearchResults(pep1, 4, pep1CdsMappings);
m = sr.getResults().get(0);
assertEquals(10, m.getStart());
assertEquals(12, m.getEnd());
-
+
/*
- * GPG in pep2 map to 1-3,4-6,7-9 in second CDS sequence
+ * Get mapping of pep2 to cds2 and verify it
+ * maps GPG in pep2 to 1-3,4-6,7-9 in second CDS sequence
*/
- List<AlignedCodonFrame> pep2Mapping = MappingUtils
+ List<AlignedCodonFrame> pep2Mappings = MappingUtils
.findMappingsForSequence(pep2, mappings);
- assertEquals(1, pep2Mapping.size());
- sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
+ assertEquals(2, pep2Mappings.size());
+ List<AlignedCodonFrame> pep2CdsMappings = MappingUtils
+ .findMappingsForSequence(cds.getSequenceAt(1), pep2Mappings);
+ assertEquals(1, pep2CdsMappings.size());
+ sr = MappingUtils.buildSearchResults(pep2, 1, pep2CdsMappings);
assertEquals(1, sr.getResults().size());
m = sr.getResults().get(0);
- assertEquals(cds.getSequenceAt(1).getDatasetSequence(),
- m.getSequence());
+ assertEquals(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
- sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
+ sr = MappingUtils.buildSearchResults(pep2, 2, pep2CdsMappings);
m = sr.getResults().get(0);
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
- sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
+ sr = MappingUtils.buildSearchResults(pep2, 3, pep2CdsMappings);
m = sr.getResults().get(0);
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
}
/**
- * Tests for gapped column in sequences
- */
- @Test(groups = { "Functional" })
- public void testIsGappedColumn()
- {
- SequenceI seq1 = new Sequence("Seq1", "a--c.tc-a-g");
- SequenceI seq2 = new Sequence("Seq2", "aa---t--a-g");
- SequenceI seq3 = new Sequence("Seq3", "ag-c t-g-");
- List<SequenceI> seqs = Arrays
- .asList(new SequenceI[] { seq1, seq2, seq3 });
- // the column number is base 1
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 1));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 2));
- assertTrue(AlignmentUtils.isGappedColumn(seqs, 3));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 4));
- assertTrue(AlignmentUtils.isGappedColumn(seqs, 5));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 6));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 7));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 8));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 9));
- assertTrue(AlignmentUtils.isGappedColumn(seqs, 10));
- assertFalse(AlignmentUtils.isGappedColumn(seqs, 11));
- // out of bounds:
- assertTrue(AlignmentUtils.isGappedColumn(seqs, 0));
- assertTrue(AlignmentUtils.isGappedColumn(seqs, 100));
- assertTrue(AlignmentUtils.isGappedColumn(seqs, -100));
- assertTrue(AlignmentUtils.isGappedColumn(null, 0));
- }
-
- @Test(groups = { "Functional" })
- public void testFindCdsColumns()
- {
- // TODO target method belongs in a general-purpose alignment
- // analysis method to find columns for feature
-
- /*
- * NB this method assumes CDS ranges are contiguous (no introns)
- */
- SequenceI gene = new Sequence("gene", "aaacccgggtttaaacccgggttt");
- SequenceI seq1 = new Sequence("Seq1", "--ac-cgGG-GGaaACC--GGtt-");
- SequenceI seq2 = new Sequence("Seq2", "AA--CCGG--g-AAA--cG-GTTt");
- seq1.createDatasetSequence();
- seq2.createDatasetSequence();
- seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 5, 6, 0f,
- null));
- seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 7, 8, 0f,
- null));
- seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 11, 13, 0f,
- null));
- seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 14, 15, 0f,
- null));
- seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 1, 2, 0f,
- null));
- seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 3, 6, 0f,
- null));
- seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 8, 10, 0f,
- null));
- seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
- null));
- seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 13, 15, 0f,
- null));
-
- List<int[]> cdsColumns = AlignmentUtils.findCdsColumns(new SequenceI[] {
- seq1, seq2 });
- assertEquals(4, cdsColumns.size());
- assertEquals("[1, 2]", Arrays.toString(cdsColumns.get(0)));
- assertEquals("[5, 9]", Arrays.toString(cdsColumns.get(1)));
- assertEquals("[11, 17]", Arrays.toString(cdsColumns.get(2)));
- assertEquals("[19, 23]", Arrays.toString(cdsColumns.get(3)));
- }
-
- /**
* Test the method that realigns protein to match mapped codon alignment.
*/
@Test(groups = { "Functional" })
SequenceI dna3 = new Sequence("Seq3", "ccaaa-ttt-GGG-");
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
dna.setDataset(null);
-
+
// prot1 has 'X' for incomplete start codon (not mapped)
SequenceI prot1 = new Sequence("Seq1", "XKFG"); // X for incomplete start
SequenceI prot2 = new Sequence("Seq2", "NG");
AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
prot3 });
protein.setDataset(null);
-
+
// map dna1 [3, 11] to prot1 [2, 4] KFG
MapList map = new MapList(new int[] { 3, 11 }, new int[] { 2, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1);
acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
- ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<>();
acfs.add(acf);
protein.setCodonFrames(acfs);
assertEquals("--N-G", prot2.getSequenceAsString());
assertEquals("---XG", prot3.getSequenceAsString());
}
+
+ /**
+ * Tests for the method that maps the subset of a dna sequence that has CDS
+ * (or subtype) feature - case where the start codon is incomplete.
+ */
+ @Test(groups = "Functional")
+ public void testFindCdsPositions_fivePrimeIncomplete()
+ {
+ SequenceI dnaSeq = new Sequence("dna", "aaagGGCCCaaaTTTttt");
+ dnaSeq.createDatasetSequence();
+ SequenceI ds = dnaSeq.getDatasetSequence();
+
+ // CDS for dna 5-6 (incomplete codon), 7-9
+ SequenceFeature sf = new SequenceFeature("CDS", "", 5, 9, 0f, null);
+ sf.setPhase("2"); // skip 2 bases to start of next codon
+ ds.addSequenceFeature(sf);
+ // CDS for dna 13-15
+ sf = new SequenceFeature("CDS_predicted", "", 13, 15, 0f, null);
+ ds.addSequenceFeature(sf);
+
+ List<int[]> ranges = AlignmentUtils.findCdsPositions(dnaSeq);
+
+ /*
+ * check the mapping starts with the first complete codon
+ */
+ assertEquals(6, MappingUtils.getLength(ranges));
+ assertEquals(2, ranges.size());
+ assertEquals(7, ranges.get(0)[0]);
+ assertEquals(9, ranges.get(0)[1]);
+ assertEquals(13, ranges.get(1)[0]);
+ assertEquals(15, ranges.get(1)[1]);
+ }
+
+ /**
+ * Tests for the method that maps the subset of a dna sequence that has CDS
+ * (or subtype) feature.
+ */
+ @Test(groups = "Functional")
+ public void testFindCdsPositions()
+ {
+ SequenceI dnaSeq = new Sequence("dna", "aaaGGGcccAAATTTttt");
+ dnaSeq.createDatasetSequence();
+ SequenceI ds = dnaSeq.getDatasetSequence();
+
+ // CDS for dna 10-12
+ SequenceFeature sf = new SequenceFeature("CDS_predicted", "", 10, 12,
+ 0f, null);
+ sf.setStrand("+");
+ ds.addSequenceFeature(sf);
+ // CDS for dna 4-6
+ sf = new SequenceFeature("CDS", "", 4, 6, 0f, null);
+ sf.setStrand("+");
+ ds.addSequenceFeature(sf);
+ // exon feature should be ignored here
+ sf = new SequenceFeature("exon", "", 7, 9, 0f, null);
+ ds.addSequenceFeature(sf);
+
+ List<int[]> ranges = AlignmentUtils.findCdsPositions(dnaSeq);
+ /*
+ * verify ranges { [4-6], [12-10] }
+ * note CDS ranges are ordered ascending even if the CDS
+ * features are not
+ */
+ assertEquals(6, MappingUtils.getLength(ranges));
+ assertEquals(2, ranges.size());
+ assertEquals(4, ranges.get(0)[0]);
+ assertEquals(6, ranges.get(0)[1]);
+ assertEquals(10, ranges.get(1)[0]);
+ assertEquals(12, ranges.get(1)[1]);
+ }
+
+ /**
+ * Tests for the method that maps the subset of a dna sequence that has CDS
+ * (or subtype) feature, with CDS strand = '-' (reverse)
+ */
+ // test turned off as currently findCdsPositions is not strand-dependent
+ // left in case it comes around again...
+ @Test(groups = "Functional", enabled = false)
+ public void testFindCdsPositions_reverseStrand()
+ {
+ SequenceI dnaSeq = new Sequence("dna", "aaaGGGcccAAATTTttt");
+ dnaSeq.createDatasetSequence();
+ SequenceI ds = dnaSeq.getDatasetSequence();
+
+ // CDS for dna 4-6
+ SequenceFeature sf = new SequenceFeature("CDS", "", 4, 6, 0f, null);
+ sf.setStrand("-");
+ ds.addSequenceFeature(sf);
+ // exon feature should be ignored here
+ sf = new SequenceFeature("exon", "", 7, 9, 0f, null);
+ ds.addSequenceFeature(sf);
+ // CDS for dna 10-12
+ sf = new SequenceFeature("CDS_predicted", "", 10, 12, 0f, null);
+ sf.setStrand("-");
+ ds.addSequenceFeature(sf);
+
+ List<int[]> ranges = AlignmentUtils.findCdsPositions(dnaSeq);
+ /*
+ * verify ranges { [12-10], [6-4] }
+ */
+ assertEquals(6, MappingUtils.getLength(ranges));
+ assertEquals(2, ranges.size());
+ assertEquals(12, ranges.get(0)[0]);
+ assertEquals(10, ranges.get(0)[1]);
+ assertEquals(6, ranges.get(1)[0]);
+ assertEquals(4, ranges.get(1)[1]);
+ }
+
+ /**
+ * Tests for the method that maps the subset of a dna sequence that has CDS
+ * (or subtype) feature - reverse strand case where the start codon is
+ * incomplete.
+ */
+ @Test(groups = "Functional", enabled = false)
+ // test turned off as currently findCdsPositions is not strand-dependent
+ // left in case it comes around again...
+ public void testFindCdsPositions_reverseStrandThreePrimeIncomplete()
+ {
+ SequenceI dnaSeq = new Sequence("dna", "aaagGGCCCaaaTTTttt");
+ dnaSeq.createDatasetSequence();
+ SequenceI ds = dnaSeq.getDatasetSequence();
+
+ // CDS for dna 5-9
+ SequenceFeature sf = new SequenceFeature("CDS", "", 5, 9, 0f, null);
+ sf.setStrand("-");
+ ds.addSequenceFeature(sf);
+ // CDS for dna 13-15
+ sf = new SequenceFeature("CDS_predicted", "", 13, 15, 0f, null);
+ sf.setStrand("-");
+ sf.setPhase("2"); // skip 2 bases to start of next codon
+ ds.addSequenceFeature(sf);
+
+ List<int[]> ranges = AlignmentUtils.findCdsPositions(dnaSeq);
+
+ /*
+ * check the mapping starts with the first complete codon
+ * expect ranges [13, 13], [9, 5]
+ */
+ assertEquals(6, MappingUtils.getLength(ranges));
+ assertEquals(2, ranges.size());
+ assertEquals(13, ranges.get(0)[0]);
+ assertEquals(13, ranges.get(0)[1]);
+ assertEquals(9, ranges.get(1)[0]);
+ assertEquals(5, ranges.get(1)[1]);
+ }
+
+ @Test(groups = "Functional")
+ public void testAlignAs_alternateTranscriptsUngapped()
+ {
+ SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA");
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 });
+ ((Alignment) dna).createDatasetAlignment();
+ SequenceI cds1 = new Sequence("cds1", "GGGTTT");
+ SequenceI cds2 = new Sequence("cds2", "CCCAAA");
+ AlignmentI cds = new Alignment(new SequenceI[] { cds1, cds2 });
+ ((Alignment) cds).createDatasetAlignment();
+
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ MapList map = new MapList(new int[] { 4, 9 }, new int[] { 1, 6 }, 1, 1);
+ acf.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(), map);
+ map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 6 }, 1, 1);
+ acf.addMap(dna2.getDatasetSequence(), cds2.getDatasetSequence(), map);
+
+ /*
+ * verify CDS alignment is as:
+ * cccGGGTTTaaa (cdna)
+ * CCCgggtttAAA (cdna)
+ *
+ * ---GGGTTT--- (cds)
+ * CCC------AAA (cds)
+ */
+ dna.addCodonFrame(acf);
+ AlignmentUtils.alignAs(cds, dna);
+ assertEquals("---GGGTTT", cds.getSequenceAt(0).getSequenceAsString());
+ assertEquals("CCC------AAA", cds.getSequenceAt(1).getSequenceAsString());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testAddMappedPositions()
+ {
+ SequenceI from = new Sequence("dna", "ggAA-ATcc-TT-g");
+ SequenceI seq1 = new Sequence("cds", "AAATTT");
+ from.createDatasetSequence();
+ seq1.createDatasetSequence();
+ Mapping mapping = new Mapping(seq1, new MapList(
+ new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1));
+ Map<Integer, Map<SequenceI, Character>> map = new TreeMap<>();
+ AlignmentUtils.addMappedPositions(seq1, from, mapping, map);
+
+ /*
+ * verify map has seq1 residues in columns 3,4,6,7,11,12
+ */
+ assertEquals(6, map.size());
+ assertEquals('A', map.get(3).get(seq1).charValue());
+ assertEquals('A', map.get(4).get(seq1).charValue());
+ assertEquals('A', map.get(6).get(seq1).charValue());
+ assertEquals('T', map.get(7).get(seq1).charValue());
+ assertEquals('T', map.get(11).get(seq1).charValue());
+ assertEquals('T', map.get(12).get(seq1).charValue());
+
+ /*
+ *
+ */
+ }
+
+ /**
+ * Test case where the mapping 'from' range includes a stop codon which is
+ * absent in the 'to' range
+ */
+ @Test(groups = { "Functional" })
+ public void testAddMappedPositions_withStopCodon()
+ {
+ SequenceI from = new Sequence("dna", "ggAA-ATcc-TT-g");
+ SequenceI seq1 = new Sequence("cds", "AAATTT");
+ from.createDatasetSequence();
+ seq1.createDatasetSequence();
+ Mapping mapping = new Mapping(seq1, new MapList(
+ new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1));
+ Map<Integer, Map<SequenceI, Character>> map = new TreeMap<>();
+ AlignmentUtils.addMappedPositions(seq1, from, mapping, map);
+
+ /*
+ * verify map has seq1 residues in columns 3,4,6,7,11,12
+ */
+ assertEquals(6, map.size());
+ assertEquals('A', map.get(3).get(seq1).charValue());
+ assertEquals('A', map.get(4).get(seq1).charValue());
+ assertEquals('A', map.get(6).get(seq1).charValue());
+ assertEquals('T', map.get(7).get(seq1).charValue());
+ assertEquals('T', map.get(11).get(seq1).charValue());
+ assertEquals('T', map.get(12).get(seq1).charValue());
+ }
+
+ /**
+ * Test for the case where the products for which we want CDS are specified.
+ * This is to represent the case where EMBL has CDS mappings to both Uniprot
+ * and EMBLCDSPROTEIN. makeCdsAlignment() should only return the mappings for
+ * the protein sequences specified.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment_filterProducts()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC");
+ SequenceI pep1 = new Sequence("Uniprot|pep1", "GF");
+ SequenceI pep2 = new Sequence("Uniprot|pep2", "GFP");
+ SequenceI pep3 = new Sequence("EMBL|pep3", "GF");
+ SequenceI pep4 = new Sequence("EMBL|pep4", "GFP");
+ dna1.createDatasetSequence();
+ dna2.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+ pep4.createDatasetSequence();
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 });
+ dna.setDataset(null);
+ AlignmentI emblPeptides = new Alignment(new SequenceI[] { pep3, pep4 });
+ emblPeptides.setDataset(null);
+
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map);
+ dna.addCodonFrame(acf);
+
+ acf = new AlignedCodonFrame();
+ map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 },
+ 3, 1);
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ acf.addMap(dna2.getDatasetSequence(), pep4.getDatasetSequence(), map);
+ dna.addCodonFrame(acf);
+
+ /*
+ * execute method under test to find CDS for EMBL peptides only
+ */
+ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
+ dna1, dna2 }, dna.getDataset(), emblPeptides.getSequencesArray());
+
+ assertEquals(2, cds.getSequences().size());
+ assertEquals("GGGTTT", cds.getSequenceAt(0).getSequenceAsString());
+ assertEquals("GGGTTTCCC", cds.getSequenceAt(1).getSequenceAsString());
+
+ /*
+ * verify shared, extended alignment dataset
+ */
+ assertSame(dna.getDataset(), cds.getDataset());
+ assertTrue(dna.getDataset().getSequences()
+ .contains(cds.getSequenceAt(0).getDatasetSequence()));
+ assertTrue(dna.getDataset().getSequences()
+ .contains(cds.getSequenceAt(1).getDatasetSequence()));
+
+ /*
+ * Verify mappings from CDS to peptide, cDNA to CDS, and cDNA to peptide
+ * the mappings are on the shared alignment dataset
+ */
+ List<AlignedCodonFrame> cdsMappings = cds.getDataset().getCodonFrames();
+ /*
+ * 6 mappings, 2*(DNA->CDS), 2*(DNA->Pep), 2*(CDS->Pep)
+ */
+ assertEquals(6, cdsMappings.size());
+
+ /*
+ * verify that mapping sets for dna and cds alignments are different
+ * [not current behaviour - all mappings are on the alignment dataset]
+ */
+ // select -> subselect type to test.
+ // Assert.assertNotSame(dna.getCodonFrames(), cds.getCodonFrames());
+ // assertEquals(4, dna.getCodonFrames().size());
+ // assertEquals(4, cds.getCodonFrames().size());
+
+ /*
+ * Two mappings involve pep3 (dna to pep3, cds to pep3)
+ * Mapping from pep3 to GGGTTT in first new exon sequence
+ */
+ List<AlignedCodonFrame> pep3Mappings = MappingUtils
+ .findMappingsForSequence(pep3, cdsMappings);
+ assertEquals(2, pep3Mappings.size());
+ List<AlignedCodonFrame> mappings = MappingUtils
+ .findMappingsForSequence(cds.getSequenceAt(0), pep3Mappings);
+ assertEquals(1, mappings.size());
+
+ // map G to GGG
+ SearchResultsI sr = MappingUtils.buildSearchResults(pep3, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ SearchResultMatchI m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep3, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+
+ /*
+ * Two mappings involve pep4 (dna to pep4, cds to pep4)
+ * Verify mapping from pep4 to GGGTTTCCC in second new exon sequence
+ */
+ List<AlignedCodonFrame> pep4Mappings = MappingUtils
+ .findMappingsForSequence(pep4, cdsMappings);
+ assertEquals(2, pep4Mappings.size());
+ mappings = MappingUtils.findMappingsForSequence(cds.getSequenceAt(1),
+ pep4Mappings);
+ assertEquals(1, mappings.size());
+ // map G to GGG
+ sr = MappingUtils.buildSearchResults(pep4, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep4, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ // map P to CCC
+ sr = MappingUtils.buildSearchResults(pep4, 3, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence());
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ }
+
+ /**
+ * Test the method that just copies aligned sequences, provided all sequences
+ * to be aligned share the aligned sequence's dataset
+ */
+ @Test(groups = "Functional")
+ public void testAlignAsSameSequences()
+ {
+ SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA");
+ AlignmentI al1 = new Alignment(new SequenceI[] { dna1, dna2 });
+ ((Alignment) al1).createDatasetAlignment();
+
+ SequenceI dna3 = new Sequence(dna1);
+ SequenceI dna4 = new Sequence(dna2);
+ assertSame(dna3.getDatasetSequence(), dna1.getDatasetSequence());
+ assertSame(dna4.getDatasetSequence(), dna2.getDatasetSequence());
+ String seq1 = "-cc-GG-GT-TT--aaa";
+ dna3.setSequence(seq1);
+ String seq2 = "C--C-Cgg--gtt-tAA-A-";
+ dna4.setSequence(seq2);
+ AlignmentI al2 = new Alignment(new SequenceI[] { dna3, dna4 });
+ ((Alignment) al2).createDatasetAlignment();
+
+ /*
+ * alignment removes gapped columns (two internal, two trailing)
+ */
+ assertTrue(AlignmentUtils.alignAsSameSequences(al1, al2));
+ String aligned1 = "-cc-GG-GTTT-aaa";
+ assertEquals(aligned1,
+ al1.getSequenceAt(0).getSequenceAsString());
+ String aligned2 = "C--C-Cgg-gtttAAA";
+ assertEquals(aligned2,
+ al1.getSequenceAt(1).getSequenceAsString());
+
+ /*
+ * add another sequence to 'aligned' - should still succeed, since
+ * unaligned sequences still share a dataset with aligned sequences
+ */
+ SequenceI dna5 = new Sequence("dna5", "CCCgggtttAAA");
+ dna5.createDatasetSequence();
+ al2.addSequence(dna5);
+ assertTrue(AlignmentUtils.alignAsSameSequences(al1, al2));
+ assertEquals(aligned1, al1.getSequenceAt(0).getSequenceAsString());
+ assertEquals(aligned2, al1.getSequenceAt(1).getSequenceAsString());
+
+ /*
+ * add another sequence to 'unaligned' - should fail, since now not
+ * all unaligned sequences share a dataset with aligned sequences
+ */
+ SequenceI dna6 = new Sequence("dna6", "CCCgggtttAAA");
+ dna6.createDatasetSequence();
+ al1.addSequence(dna6);
+ // JAL-2110 JBP Comment: what's the use case for this behaviour ?
+ assertFalse(AlignmentUtils.alignAsSameSequences(al1, al2));
+ }
+
+ @Test(groups = "Functional")
+ public void testAlignAsSameSequencesMultipleSubSeq()
+ {
+ SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA");
+ SequenceI as1 = dna1.deriveSequence(); // cccGGGTTTaaa/1-12
+ SequenceI as2 = dna1.deriveSequence().getSubSequence(3, 7); // GGGT/4-7
+ SequenceI as3 = dna2.deriveSequence(); // CCCgggtttAAA/1-12
+ as1.insertCharAt(6, 5, '-');
+ assertEquals("cccGGG-----TTTaaa", as1.getSequenceAsString());
+ as2.insertCharAt(6, 5, '-');
+ assertEquals("GGGT-----", as2.getSequenceAsString());
+ as3.insertCharAt(3, 5, '-');
+ assertEquals("CCC-----gggtttAAA", as3.getSequenceAsString());
+ AlignmentI aligned = new Alignment(new SequenceI[] { as1, as2, as3 });
+
+ // why do we need to cast this still ?
+ ((Alignment) aligned).createDatasetAlignment();
+ SequenceI uas1 = dna1.deriveSequence();
+ SequenceI uas2 = dna1.deriveSequence().getSubSequence(3, 7);
+ SequenceI uas3 = dna2.deriveSequence();
+ AlignmentI tobealigned = new Alignment(new SequenceI[] { uas1, uas2,
+ uas3 });
+ ((Alignment) tobealigned).createDatasetAlignment();
+
+ /*
+ * alignAs lines up dataset sequences and removes empty columns (two)
+ */
+ assertTrue(AlignmentUtils.alignAsSameSequences(tobealigned, aligned));
+ assertEquals("cccGGG---TTTaaa", uas1.getSequenceAsString());
+ assertEquals("GGGT", uas2.getSequenceAsString());
+ assertEquals("CCC---gggtttAAA", uas3.getSequenceAsString());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testTransferGeneLoci()
+ {
+ SequenceI from = new Sequence("transcript",
+ "aaacccgggTTTAAACCCGGGtttaaacccgggttt");
+ SequenceI to = new Sequence("CDS", "TTTAAACCCGGG");
+ MapList map = new MapList(new int[] { 1, 12 }, new int[] { 10, 21 }, 1,
+ 1);
+
+ /*
+ * first with nothing to transfer
+ */
+ AlignmentUtils.transferGeneLoci(from, map, to);
+ assertNull(to.getGeneLoci());
+
+ /*
+ * next with gene loci set on 'from' sequence
+ */
+ int[] exons = new int[] { 100, 105, 155, 164, 210, 229 };
+ MapList geneMap = new MapList(new int[] { 1, 36 }, exons, 1, 1);
+ from.setGeneLoci("human", "GRCh38", "7", geneMap);
+ AlignmentUtils.transferGeneLoci(from, map, to);
+
+ GeneLociI toLoci = to.getGeneLoci();
+ assertNotNull(toLoci);
+ // DBRefEntry constructor upper-cases 'source'
+ assertEquals("HUMAN", toLoci.getSpeciesId());
+ assertEquals("GRCh38", toLoci.getAssemblyId());
+ assertEquals("7", toLoci.getChromosomeId());
+
+ /*
+ * transcript 'exons' are 1-6, 7-16, 17-36
+ * CDS 1:12 is transcript 10-21
+ * transcript 'CDS' is 10-16, 17-21
+ * which is 'gene' 158-164, 210-214
+ */
+ MapList toMap = toLoci.getMapping();
+ assertEquals(1, toMap.getFromRanges().size());
+ assertEquals(2, toMap.getFromRanges().get(0).length);
+ assertEquals(1, toMap.getFromRanges().get(0)[0]);
+ assertEquals(12, toMap.getFromRanges().get(0)[1]);
+ assertEquals(2, toMap.getToRanges().size());
+ assertEquals(2, toMap.getToRanges().get(0).length);
+ assertEquals(158, toMap.getToRanges().get(0)[0]);
+ assertEquals(164, toMap.getToRanges().get(0)[1]);
+ assertEquals(210, toMap.getToRanges().get(1)[0]);
+ assertEquals(214, toMap.getToRanges().get(1)[1]);
+ // or summarised as (but toString might change in future):
+ assertEquals("[ [1, 12] ] 1:1 to [ [158, 164] [210, 214] ]",
+ toMap.toString());
+
+ /*
+ * an existing value is not overridden
+ */
+ geneMap = new MapList(new int[] { 1, 36 }, new int[] { 36, 1 }, 1, 1);
+ from.setGeneLoci("inhuman", "GRCh37", "6", geneMap);
+ AlignmentUtils.transferGeneLoci(from, map, to);
+ assertEquals("GRCh38", toLoci.getAssemblyId());
+ assertEquals("7", toLoci.getChromosomeId());
+ toMap = toLoci.getMapping();
+ assertEquals("[ [1, 12] ] 1:1 to [ [158, 164] [210, 214] ]",
+ toMap.toString());
+ }
+
+ /**
+ * Tests for the method that maps nucleotide to protein based on CDS features
+ */
+ @Test(groups = "Functional")
+ public void testMapCdsToProtein()
+ {
+ SequenceI peptide = new Sequence("pep", "KLQ");
+
+ /*
+ * Case 1: CDS 3 times length of peptide
+ * NB method only checks lengths match, not translation
+ */
+ SequenceI dna = new Sequence("dna", "AACGacgtCTCCT");
+ dna.createDatasetSequence();
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null));
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 13, null));
+ MapList ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertEquals(3, ml.getFromRatio());
+ assertEquals(1, ml.getToRatio());
+ assertEquals("[[1, 3]]",
+ Arrays.deepToString(ml.getToRanges().toArray()));
+ assertEquals("[[1, 4], [9, 13]]",
+ Arrays.deepToString(ml.getFromRanges().toArray()));
+
+ /*
+ * Case 2: CDS 3 times length of peptide + stop codon
+ * (note code does not currently check trailing codon is a stop codon)
+ */
+ dna = new Sequence("dna", "AACGacgtCTCCTCCC");
+ dna.createDatasetSequence();
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null));
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 16, null));
+ ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertEquals(3, ml.getFromRatio());
+ assertEquals(1, ml.getToRatio());
+ assertEquals("[[1, 3]]",
+ Arrays.deepToString(ml.getToRanges().toArray()));
+ assertEquals("[[1, 4], [9, 13]]",
+ Arrays.deepToString(ml.getFromRanges().toArray()));
+
+ /*
+ * Case 3: CDS longer than 3 * peptide + stop codon - no mapping is made
+ */
+ dna = new Sequence("dna", "AACGacgtCTCCTTGATCA");
+ dna.createDatasetSequence();
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null));
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 19, null));
+ ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertNull(ml);
+
+ /*
+ * Case 4: CDS shorter than 3 * peptide - no mapping is made
+ */
+ dna = new Sequence("dna", "AACGacgtCTCC");
+ dna.createDatasetSequence();
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null));
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 12, null));
+ ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertNull(ml);
+
+ /*
+ * Case 5: CDS 3 times length of peptide + part codon - mapping is truncated
+ */
+ dna = new Sequence("dna", "AACGacgtCTCCTTG");
+ dna.createDatasetSequence();
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null));
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 15, null));
+ ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertEquals(3, ml.getFromRatio());
+ assertEquals(1, ml.getToRatio());
+ assertEquals("[[1, 3]]",
+ Arrays.deepToString(ml.getToRanges().toArray()));
+ assertEquals("[[1, 4], [9, 13]]",
+ Arrays.deepToString(ml.getFromRanges().toArray()));
+
+ /*
+ * Case 6: incomplete start codon corresponding to X in peptide
+ */
+ dna = new Sequence("dna", "ACGacgtCTCCTTGG");
+ dna.createDatasetSequence();
+ SequenceFeature sf = new SequenceFeature("CDS", "", 1, 3, null);
+ sf.setPhase("2"); // skip 2 positions (AC) to start of next codon (GCT)
+ dna.addSequenceFeature(sf);
+ dna.addSequenceFeature(new SequenceFeature("CDS", "", 8, 15, null));
+ peptide = new Sequence("pep", "XLQ");
+ ml = AlignmentUtils.mapCdsToProtein(dna, peptide);
+ assertEquals("[[2, 3]]",
+ Arrays.deepToString(ml.getToRanges().toArray()));
+ assertEquals("[[3, 3], [8, 12]]",
+ Arrays.deepToString(ml.getFromRanges().toArray()));
+ }
+
+ /**
+ * Tests for the method that locates the CDS sequence that has a mapping to
+ * the given protein. That is, given a transcript-to-peptide mapping, find the
+ * cds-to-peptide mapping that relates to both, and return the CDS sequence.
+ */
+ @Test
+ public void testFindCdsForProtein()
+ {
+ List<AlignedCodonFrame> mappings = new ArrayList<>();
+ AlignedCodonFrame acf1 = new AlignedCodonFrame();
+ mappings.add(acf1);
+
+ SequenceI dna1 = new Sequence("dna1", "cgatATcgGCTATCTATGacg");
+ dna1.createDatasetSequence();
+
+ // NB we currently exclude STOP codon from CDS sequences
+ // the test would need to change if this changes in future
+ SequenceI cds1 = new Sequence("cds1", "ATGCTATCT");
+ cds1.createDatasetSequence();
+
+ SequenceI pep1 = new Sequence("pep1", "MLS");
+ pep1.createDatasetSequence();
+ List<AlignedCodonFrame> seqMappings = new ArrayList<>();
+ MapList mapList = new MapList(
+ new int[]
+ { 5, 6, 9, 15 }, new int[] { 1, 3 }, 3, 1);
+ Mapping dnaToPeptide = new Mapping(pep1.getDatasetSequence(), mapList);
+
+ // add dna to peptide mapping
+ seqMappings.add(acf1);
+ acf1.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(),
+ mapList);
+
+ /*
+ * first case - no dna-to-CDS mapping exists - search fails
+ */
+ SequenceI seq = AlignmentUtils.findCdsForProtein(mappings, dna1,
+ seqMappings, dnaToPeptide);
+ assertNull(seq);
+
+ /*
+ * second case - CDS-to-peptide mapping exists but no dna-to-CDS
+ * - search fails
+ */
+ // todo this test fails if the mapping is added to acf1, not acf2
+ // need to tidy up use of lists of mappings in AlignedCodonFrame
+ AlignedCodonFrame acf2 = new AlignedCodonFrame();
+ mappings.add(acf2);
+ MapList cdsToPeptideMapping = new MapList(new int[]
+ { 1, 9 }, new int[] { 1, 3 }, 3, 1);
+ acf2.addMap(cds1.getDatasetSequence(), pep1.getDatasetSequence(),
+ cdsToPeptideMapping);
+ assertNull(AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings,
+ dnaToPeptide));
+
+ /*
+ * third case - add dna-to-CDS mapping - CDS is now found!
+ */
+ MapList dnaToCdsMapping = new MapList(new int[] { 5, 6, 9, 15 },
+ new int[]
+ { 1, 9 }, 1, 1);
+ acf1.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(),
+ dnaToCdsMapping);
+ seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings,
+ dnaToPeptide);
+ assertSame(seq, cds1.getDatasetSequence());
+ }
+
+ /**
+ * Tests for the method that locates the CDS sequence that has a mapping to
+ * the given protein. That is, given a transcript-to-peptide mapping, find the
+ * cds-to-peptide mapping that relates to both, and return the CDS sequence.
+ * This test is for the case where transcript and CDS are the same length.
+ */
+ @Test
+ public void testFindCdsForProtein_noUTR()
+ {
+ List<AlignedCodonFrame> mappings = new ArrayList<>();
+ AlignedCodonFrame acf1 = new AlignedCodonFrame();
+ mappings.add(acf1);
+
+ SequenceI dna1 = new Sequence("dna1", "ATGCTATCTTAA");
+ dna1.createDatasetSequence();
+
+ // NB we currently exclude STOP codon from CDS sequences
+ // the test would need to change if this changes in future
+ SequenceI cds1 = new Sequence("cds1", "ATGCTATCT");
+ cds1.createDatasetSequence();
+
+ SequenceI pep1 = new Sequence("pep1", "MLS");
+ pep1.createDatasetSequence();
+ List<AlignedCodonFrame> seqMappings = new ArrayList<>();
+ MapList mapList = new MapList(
+ new int[]
+ { 1, 9 }, new int[] { 1, 3 }, 3, 1);
+ Mapping dnaToPeptide = new Mapping(pep1.getDatasetSequence(), mapList);
+
+ // add dna to peptide mapping
+ seqMappings.add(acf1);
+ acf1.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(),
+ mapList);
+
+ /*
+ * first case - transcript lacks CDS features - it appears to be
+ * the CDS sequence and is returned
+ */
+ SequenceI seq = AlignmentUtils.findCdsForProtein(mappings, dna1,
+ seqMappings, dnaToPeptide);
+ assertSame(seq, dna1.getDatasetSequence());
+
+ /*
+ * second case - transcript has CDS feature - this means it is
+ * not returned as a match for CDS (CDS sequences don't have CDS features)
+ */
+ dna1.addSequenceFeature(
+ new SequenceFeature(SequenceOntologyI.CDS, "cds", 1, 12, null));
+ seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings,
+ dnaToPeptide);
+ assertNull(seq);
+
+ /*
+ * third case - CDS-to-peptide mapping exists but no dna-to-CDS
+ * - search fails
+ */
+ // todo this test fails if the mapping is added to acf1, not acf2
+ // need to tidy up use of lists of mappings in AlignedCodonFrame
+ AlignedCodonFrame acf2 = new AlignedCodonFrame();
+ mappings.add(acf2);
+ MapList cdsToPeptideMapping = new MapList(new int[]
+ { 1, 9 }, new int[] { 1, 3 }, 3, 1);
+ acf2.addMap(cds1.getDatasetSequence(), pep1.getDatasetSequence(),
+ cdsToPeptideMapping);
+ assertNull(AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings,
+ dnaToPeptide));
+
+ /*
+ * fourth case - add dna-to-CDS mapping - CDS is now found!
+ */
+ MapList dnaToCdsMapping = new MapList(new int[] { 1, 9 },
+ new int[]
+ { 1, 9 }, 1, 1);
+ acf1.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(),
+ dnaToCdsMapping);
+ seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings,
+ dnaToPeptide);
+ assertSame(seq, cds1.getDatasetSequence());
+ }
}