*/
package jalview.analysis;
-import static org.junit.Assert.assertEquals;
-import static org.junit.Assert.assertFalse;
-import static org.junit.Assert.assertSame;
-import static org.junit.Assert.assertTrue;
-
-import java.io.IOException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Collections;
-import java.util.List;
-import java.util.Map;
-
-import org.junit.Test;
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.assertSame;
+import static org.testng.AssertJUnit.assertTrue;
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.datamodel.Annotation;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.Mapping;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResults.Match;
import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.io.AppletFormatAdapter;
import jalview.io.FormatAdapter;
import jalview.util.MapList;
+import jalview.util.MappingUtils;
+
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.HashSet;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Map;
+import java.util.Set;
+
+import org.testng.annotations.Test;
-public class AlignmentUtilsTests
+public class AlignmentUtilsTests
{
// @formatter:off
private static final String TEST_DATA =
"GGGTCAGGCAGT\n";
// @formatter:on
- public static Sequence ts=new Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
+ // public static Sequence ts=new
+ // Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
+ public static Sequence ts = new Sequence("short",
+ "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
- @Test
- public void testExpandFlanks()
+ @Test(groups = { "Functional" })
+ public void testExpandContext()
{
AlignmentI al = new Alignment(new Sequence[] {});
- for (int i=4;i<14;i+=3)
+ for (int i = 4; i < 14; i += 2)
{
- SequenceI s1=ts.deriveSequence().getSubSequence(i, i+7);
+ SequenceI s1 = ts.deriveSequence().getSubSequence(i, i + 7);
al.addSequence(s1);
}
- System.out.println(new AppletFormatAdapter().formatSequences("Clustal", al, true));
- for (int flnk=-1;flnk<25; flnk++)
+ System.out.println(new AppletFormatAdapter().formatSequences("Clustal",
+ al, true));
+ for (int flnk = -1; flnk < 25; flnk++)
{
- AlignmentI exp;
- System.out.println("\nFlank size: "+flnk);
- System.out.println(new AppletFormatAdapter().formatSequences("Clustal", exp=AlignmentUtils.expandContext(al, flnk), true));
- if (flnk==-1) {
- for (SequenceI sq:exp.getSequences())
+ AlignmentI exp = AlignmentUtils.expandContext(al, flnk);
+ System.out.println("\nFlank size: " + flnk);
+ System.out.println(new AppletFormatAdapter().formatSequences(
+ "Clustal", exp, true));
+ if (flnk == -1)
{
+ /*
+ * Full expansion to complete sequences
+ */
+ for (SequenceI sq : exp.getSequences())
+ {
String ung = sq.getSequenceAsString().replaceAll("-+", "");
- assertTrue("Flanking sequence not the same as original dataset sequence.\n"+ung+"\n"+sq.getDatasetSequence().getSequenceAsString(),ung.equalsIgnoreCase(sq.getDatasetSequence().getSequenceAsString()));
+ final String errorMsg = "Flanking sequence not the same as original dataset sequence.\n"
+ + ung
+ + "\n"
+ + sq.getDatasetSequence().getSequenceAsString();
+ assertTrue(errorMsg, ung.equalsIgnoreCase(sq.getDatasetSequence()
+ .getSequenceAsString()));
+ }
}
+ else if (flnk == 24)
+ {
+ /*
+ * Last sequence is fully expanded, others have leading gaps to match
+ */
+ assertTrue(exp.getSequenceAt(4).getSequenceAsString()
+ .startsWith("abc"));
+ assertTrue(exp.getSequenceAt(3).getSequenceAsString()
+ .startsWith("--abc"));
+ assertTrue(exp.getSequenceAt(2).getSequenceAsString()
+ .startsWith("----abc"));
+ assertTrue(exp.getSequenceAt(1).getSequenceAsString()
+ .startsWith("------abc"));
+ assertTrue(exp.getSequenceAt(0).getSequenceAsString()
+ .startsWith("--------abc"));
}
}
- }
+ }
+
+ /**
+ * Test that annotations are correctly adjusted by expandContext
+ */
+ @Test(groups = { "Functional" })
+ public void testExpandContext_annotation()
+ {
+ AlignmentI al = new Alignment(new Sequence[] {});
+ SequenceI ds = new Sequence("Seq1", "ABCDEFGHI");
+ // subsequence DEF:
+ SequenceI seq1 = ds.deriveSequence().getSubSequence(3, 6);
+ al.addSequence(seq1);
+
+ /*
+ * Annotate DEF with 4/5/6 respectively
+ */
+ Annotation[] anns = new Annotation[] { new Annotation(4),
+ new Annotation(5), new Annotation(6) };
+ AlignmentAnnotation ann = new AlignmentAnnotation("SS",
+ "secondary structure", anns);
+ seq1.addAlignmentAnnotation(ann);
+
+ /*
+ * The annotations array should match aligned positions
+ */
+ assertEquals(3, ann.annotations.length);
+ assertEquals(4, ann.annotations[0].value, 0.001);
+ assertEquals(5, ann.annotations[1].value, 0.001);
+ assertEquals(6, ann.annotations[2].value, 0.001);
+
+ /*
+ * Check annotation to sequence position mappings before expanding the
+ * sequence; these are set up in Sequence.addAlignmentAnnotation ->
+ * Annotation.setSequenceRef -> createSequenceMappings
+ */
+ assertNull(ann.getAnnotationForPosition(1));
+ assertNull(ann.getAnnotationForPosition(2));
+ assertNull(ann.getAnnotationForPosition(3));
+ assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
+ assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
+ assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
+ assertNull(ann.getAnnotationForPosition(7));
+ assertNull(ann.getAnnotationForPosition(8));
+ assertNull(ann.getAnnotationForPosition(9));
+
+ /*
+ * Expand the subsequence to the full sequence abcDEFghi
+ */
+ AlignmentI expanded = AlignmentUtils.expandContext(al, -1);
+ assertEquals("abcDEFghi", expanded.getSequenceAt(0)
+ .getSequenceAsString());
+
+ /*
+ * Confirm the alignment and sequence have the same SS annotation,
+ * referencing the expanded sequence
+ */
+ ann = expanded.getSequenceAt(0).getAnnotation()[0];
+ assertSame(ann, expanded.getAlignmentAnnotation()[0]);
+ assertSame(expanded.getSequenceAt(0), ann.sequenceRef);
+
+ /*
+ * The annotations array should have null values except for annotated
+ * positions
+ */
+ assertNull(ann.annotations[0]);
+ assertNull(ann.annotations[1]);
+ assertNull(ann.annotations[2]);
+ assertEquals(4, ann.annotations[3].value, 0.001);
+ assertEquals(5, ann.annotations[4].value, 0.001);
+ assertEquals(6, ann.annotations[5].value, 0.001);
+ assertNull(ann.annotations[6]);
+ assertNull(ann.annotations[7]);
+ assertNull(ann.annotations[8]);
+
+ /*
+ * sequence position mappings should be unchanged
+ */
+ assertNull(ann.getAnnotationForPosition(1));
+ assertNull(ann.getAnnotationForPosition(2));
+ assertNull(ann.getAnnotationForPosition(3));
+ assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
+ assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
+ assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
+ assertNull(ann.getAnnotationForPosition(7));
+ assertNull(ann.getAnnotationForPosition(8));
+ assertNull(ann.getAnnotationForPosition(9));
+ }
/**
* Test method that returns a map of lists of sequences by sequence name.
*
* @throws IOException
*/
- @Test
+ @Test(groups = { "Functional" })
public void testGetSequencesByName() throws IOException
{
final String data = ">Seq1Name\nKQYL\n" + ">Seq2Name\nRFPW\n"
assertEquals(1, map.get("Seq2Name").size());
assertEquals("RFPW", map.get("Seq2Name").get(0).getSequenceAsString());
}
+
/**
* Helper method to load an alignment and ensure dataset sequences are set up.
*
* @param data
- * @param format TODO
+ * @param format
+ * TODO
* @return
* @throws IOException
*/
- protected AlignmentI loadAlignment(final String data, String format) throws IOException
+ protected AlignmentI loadAlignment(final String data, String format)
+ throws IOException
{
- Alignment a = new FormatAdapter().readFile(data,
+ AlignmentI a = new FormatAdapter().readFile(data,
AppletFormatAdapter.PASTE, format);
a.setDataset(null);
return a;
}
-
+
/**
* Test mapping of protein to cDNA, for the case where we have no sequence
* cross-references, so mappings are made first-served 1-1 where sequences
*
* @throws IOException
*/
- @Test
- public void testMapProteinToCdna_noXrefs() throws IOException
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_noXrefs() throws IOException
{
List<SequenceI> protseqs = new ArrayList<SequenceI>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
cdna.setDataset(null);
- assertTrue(AlignmentUtils.mapProteinToCdna(protein, cdna));
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 3 mappings made, each from 1 to 1 sequence
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
// V12345 mapped to A22222
- AlignedCodonFrame acf = protein.getCodonFrame(
- protein.getSequenceAt(0)).get(0);
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
MapList mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
- assertTrue(Arrays.equals(new int[]
- { 1, 9 }, mapList.getFromRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
+ .get(0)));
assertEquals(1, mapList.getFromRanges().size());
- assertTrue(Arrays.equals(new int[]
- { 1, 3 }, mapList.getToRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// V12346 mapped to A33333
/**
* Test for the alignSequenceAs method that takes two sequences and a mapping.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_noIntrons()
{
- MapList map = new MapList(new int[]
- { 1, 6 }, new int[]
- { 1, 2 }, 3, 1);
+ MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1);
/*
* No existing gaps in dna:
* region). The leading gap, and the gaps between codons, are subsumed by
* the protein alignment gap.
*/
- checkAlignSequenceAs("-G-GG--AA-A-", "-A-L-", true, true, map,
- "---G-GG---AA-A-");
+ checkAlignSequenceAs("-G-GG--AA-A---", "-A-L-", true, true, map,
+ "---G-GG---AA-A---");
/*
* Include only unmapped gaps in dna when realigning (outside the exon
* the protein alignment gap.
*/
checkAlignSequenceAs("-G-GG--AA-A-", "-A-L-", false, true, map,
- "---GGG---AAA-");
+ "---GGG---AAA---");
}
/**
* Test for the alignSequenceAs method that takes two sequences and a mapping.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_withIntrons()
{
/*
* Exons at codon 2 (AAA) and 4 (TTT)
*/
- MapList map = new MapList(new int[]
- { 4, 6, 10, 12 }, new int[]
- { 1, 2 }, 3, 1);
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
/*
* Simple case: no gaps in dna
/**
* Test for the case where not all of the protein sequence is mapped to cDNA.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_withUnmappedProtein()
{
-
/*
* Exons at codon 2 (AAA) and 4 (TTT) mapped to A and P
*/
- final MapList map = new MapList(new int[]
- { 4, 6, 10, 12 }, new int[]
- { 1, 1, 3, 3 }, 3, 1);
-
+ final MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] {
+ 1, 1, 3, 3 }, 3, 1);
/*
- * Expect alignment does nothing (aborts realignment). Change this test
- * first if different behaviour wanted.
+ * -L- 'aligns' ccc------
*/
- checkAlignSequenceAs("GGGAAACCCTTTGGG", "-A-L-P-", false,
- false, map, "GGGAAACCCTTTGGG");
+ checkAlignSequenceAs("gggAAAcccTTTggg", "-A-L-P-", false, false, map,
+ "gggAAAccc------TTTggg");
}
/**
* Helper method that performs and verifies the method under test.
*
- * @param dnaSeq
- * @param proteinSeq
+ * @param alignee
+ * the sequence to be realigned
+ * @param alignModel
+ * the sequence whose alignment is to be copied
* @param preserveMappedGaps
* @param preserveUnmappedGaps
* @param map
* @param expected
*/
- protected void checkAlignSequenceAs(final String dnaSeq,
- final String proteinSeq, final boolean preserveMappedGaps,
+ protected void checkAlignSequenceAs(final String alignee,
+ final String alignModel, final boolean preserveMappedGaps,
final boolean preserveUnmappedGaps, MapList map,
final String expected)
{
- SequenceI dna = new Sequence("Seq1", dnaSeq);
- dna.createDatasetSequence();
- SequenceI protein = new Sequence("Seq1", proteinSeq);
- protein.createDatasetSequence();
+ SequenceI alignMe = new Sequence("Seq1", alignee);
+ alignMe.createDatasetSequence();
+ SequenceI alignFrom = new Sequence("Seq2", alignModel);
+ alignFrom.createDatasetSequence();
AlignedCodonFrame acf = new AlignedCodonFrame();
- acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
+ acf.addMap(alignMe.getDatasetSequence(), alignFrom.getDatasetSequence(), map);
- AlignmentUtils.alignSequenceAs(dna, protein, acf, "---", '-',
+ AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "---", '-',
preserveMappedGaps, preserveUnmappedGaps);
- assertEquals(expected, dna.getSequenceAsString());
+ assertEquals(expected, alignMe.getSequenceAsString());
}
/**
* Test for the alignSequenceAs method where we preserve gaps in introns only.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testAlignSequenceAs_keepIntronGapsOnly()
{
/*
* Intron GGGAAA followed by exon CCCTTT
*/
- MapList map = new MapList(new int[]
- { 7, 12 }, new int[]
- { 1, 2 }, 3, 1);
-
- checkAlignSequenceAs("GG-G-AA-A-C-CC-T-TT", "AL",
- false, true, map, "GG-G-AA-ACCCTTT");
+ MapList map = new MapList(new int[] { 7, 12 }, new int[] { 1, 2 }, 3, 1);
+
+ checkAlignSequenceAs("GG-G-AA-A-C-CC-T-TT", "AL", false, true, map,
+ "GG-G-AA-ACCCTTT");
}
/**
* Test for the method that generates an aligned translated sequence from one
* mapping.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testGetAlignedTranslation_dnaLikeProtein()
{
// dna alignment will be replaced
// protein alignment will be 'applied' to dna
SequenceI protein = new Sequence("Seq1", "-CH-Y--Q-");
protein.createDatasetSequence();
- MapList map = new MapList(new int[]
- { 1, 12 }, new int[]
- { 1, 4 }, 3, 1);
+ MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
- final SequenceI aligned = AlignmentUtils
- .getAlignedTranslation(protein, '-', acf);
- assertEquals("---TGCCAT---TAC------CAG---", aligned.getSequenceAsString());
+ final SequenceI aligned = AlignmentUtils.getAlignedTranslation(protein,
+ '-', acf);
+ assertEquals("---TGCCAT---TAC------CAG---",
+ aligned.getSequenceAsString());
assertSame(aligned.getDatasetSequence(), dna.getDatasetSequence());
}
/**
* Test the method that realigns protein to match mapped codon alignment.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testAlignProteinAsDna()
{
// seq1 codons are [1,2,3] [4,5,6] [7,8,9] [10,11,12]
SequenceI dna2 = new Sequence("Seq2", "T-GCCATTACCAG");
// seq3 codons are [1,2,3] [4,5,7] [8,9,10] [11,12,13]
SequenceI dna3 = new Sequence("Seq3", "TGCCA-TTACCAG");
- AlignmentI dna = new Alignment(new SequenceI[]
- { dna1, dna2, dna3 });
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
dna.setDataset(null);
// protein alignment will be realigned like dna
SequenceI prot1 = new Sequence("Seq1", "CHYQ");
SequenceI prot2 = new Sequence("Seq2", "CHYQ");
SequenceI prot3 = new Sequence("Seq3", "CHYQ");
- AlignmentI protein = new Alignment(new SequenceI[]
- { prot1, prot2, prot3 });
+ SequenceI prot4 = new Sequence("Seq4", "R-QSV"); // unmapped, unchanged
+ AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
+ prot3, prot4 });
protein.setDataset(null);
- MapList map = new MapList(new int[]
- { 1, 12 }, new int[]
- { 1, 4 }, 3, 1);
+ MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
- protein.setCodonFrames(Collections.singleton(acf));
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ acfs.add(acf);
+ protein.setCodonFrames(acfs);
/*
* Translated codon order is [1,2,3] [1,3,4] [4,5,6] [4,5,7] [5,6,7] [7,8,9]
assertEquals("C-H--Y-Q-", prot1.getSequenceAsString());
assertEquals("-C--H-Y-Q", prot2.getSequenceAsString());
assertEquals("C--H--Y-Q", prot3.getSequenceAsString());
+ assertEquals("R-QSV", prot4.getSequenceAsString());
}
/**
* Test the method that tests whether a CDNA sequence translates to a protein
* sequence
*/
- @Test
+ @Test(groups = { "Functional" })
public void testTranslatesAs()
{
assertTrue(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(), 0,
"FPKG".toCharArray()));
- // with start codon
+ // with start codon (not in protein)
assertTrue(AlignmentUtils.translatesAs("atgtttcccaaaggg".toCharArray(),
3, "FPKG".toCharArray()));
- // with stop codon1
+ // with stop codon1 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
0, "FPKG".toCharArray()));
- // with stop codon2
+ // with stop codon1 (in protein as *)
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
+ 0, "FPKG*".toCharArray()));
+ // with stop codon2 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtag".toCharArray(),
0, "FPKG".toCharArray()));
- // with stop codon3
+ // with stop codon3 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtga".toCharArray(),
0, "FPKG".toCharArray()));
// with start and stop codon1
assertTrue(AlignmentUtils.translatesAs(
- "atgtttcccaaaggtaa".toCharArray(), 3, "FPKG".toCharArray()));
+ "atgtttcccaaagggtaa".toCharArray(), 3, "FPKG".toCharArray()));
+ // with start and stop codon1 (in protein as *)
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttcccaaagggtaa".toCharArray(), 3, "FPKG*".toCharArray()));
// with start and stop codon2
assertTrue(AlignmentUtils.translatesAs(
- "atgtttcccaaaggtag".toCharArray(), 3, "FPKG".toCharArray()));
+ "atgtttcccaaagggtag".toCharArray(), 3, "FPKG".toCharArray()));
// with start and stop codon3
assertTrue(AlignmentUtils.translatesAs(
- "atgtttcccaaaggtga".toCharArray(), 3, "FPKG".toCharArray()));
+ "atgtttcccaaagggtga".toCharArray(), 3, "FPKG".toCharArray()));
+
+ // with embedded stop codon
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttTAGcccaaaTAAgggtga".toCharArray(), 3,
+ "F*PK*G".toCharArray()));
// wrong protein
assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
- 0,
- "FPMG".toCharArray()));
+ 0, "FPMG".toCharArray()));
}
/**
*
* @throws IOException
*/
- @Test
- public void testMapProteinToCdna_withStartAndStopCodons()
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_withStartAndStopCodons()
throws IOException
{
List<SequenceI> protseqs = new ArrayList<SequenceI>();
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
-
+
List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
// start + SAR:
dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC"));
dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG"));
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
cdna.setDataset(null);
-
- assertTrue(AlignmentUtils.mapProteinToCdna(protein, cdna));
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 3 mappings made, each from 1 to 1 sequence
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
-
+
// V12345 mapped from A22222
- AlignedCodonFrame acf = protein.getCodonFrame(
- protein.getSequenceAt(0)).get(0);
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
MapList mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
- assertTrue(Arrays.equals(new int[]
- { 1, 9 }, mapList.getFromRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
+ .get(0)));
assertEquals(1, mapList.getFromRanges().size());
- assertTrue(Arrays.equals(new int[]
- { 1, 3 }, mapList.getToRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// V12346 mapped from A33333 starting position 4
mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
- assertTrue(Arrays.equals(new int[]
- { 4, 12 }, mapList.getFromRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
+ .get(0)));
assertEquals(1, mapList.getFromRanges().size());
- assertTrue(Arrays.equals(new int[]
- { 1, 3 }, mapList.getToRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
-
+
// V12347 mapped to A11111 starting position 4
acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
- assertTrue(Arrays.equals(new int[]
- { 4, 12 }, mapList.getFromRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
+ .get(0)));
assertEquals(1, mapList.getFromRanges().size());
- assertTrue(Arrays.equals(new int[]
- { 1, 3 }, mapList.getToRanges().get(0)));
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
-
+
// no mapping involving the 'extra' A44444
assertTrue(protein.getCodonFrame(cdna.getSequenceAt(3)).isEmpty());
}
*
* @throws IOException
*/
- @Test
- public void testMapProteinToCdna_withXrefs() throws IOException
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_withXrefs() throws IOException
{
List<SequenceI> protseqs = new ArrayList<SequenceI>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
-
+
List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ
dnaseqs.add(new Sequence("EMBL|A55555", "GAGATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[5]));
cdna.setDataset(null);
-
+
// Xref A22222 to V12345 (should get mapped)
dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
// Xref V12345 to A44444 (should get mapped)
// A11111 should be mapped to V12347
// A55555 is spare and has no xref so is not mapped
- assertTrue(AlignmentUtils.mapProteinToCdna(protein, cdna));
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 4 protein mappings made for 3 proteins, 2 to V12345, 1 each to V12346/7
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(2)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(3)).size());
-
+
// V12345 mapped to A22222 and A44444
- AlignedCodonFrame acf = protein.getCodonFrame(
- protein.getSequenceAt(0)).get(0);
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
assertEquals(2, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
assertEquals(cdna.getSequenceAt(3).getDatasetSequence(),
acf.getdnaSeqs()[1]);
-
+
// V12346 mapped to A33333
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
acf.getdnaSeqs()[0]);
-
+
// V12347 mapped to A11111
acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
acf.getdnaSeqs()[0]);
-
+
// no mapping involving the 'extra' A55555
assertTrue(protein.getCodonFrame(cdna.getSequenceAt(4)).isEmpty());
}
*
* @throws IOException
*/
- @Test
- public void testMapProteinToCdna_prioritiseXrefs() throws IOException
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_prioritiseXrefs()
+ throws IOException
{
List<SequenceI> protseqs = new ArrayList<SequenceI>();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
AlignmentI protein = new Alignment(
protseqs.toArray(new SequenceI[protseqs.size()]));
protein.setDataset(null);
-
+
List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs
.size()]));
cdna.setDataset(null);
-
+
// Xref A22222 to V12345 (should get mapped)
// A11111 should then be mapped to the unmapped V12346
dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
-
- assertTrue(AlignmentUtils.mapProteinToCdna(protein, cdna));
-
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
+
// 2 protein mappings made
assertEquals(2, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
-
+
// one mapping for each of the cDNA sequences
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
-
+
// V12345 mapped to A22222
AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
.get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
-
+
// V12346 mapped to A11111
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
* Test the method that shows or hides sequence annotations by type(s) and
* selection group.
*/
- @Test
+ @Test(groups = { "Functional" })
public void testShowOrHideSequenceAnnotations()
{
SequenceI seq1 = new Sequence("Seq1", "AAA");
SequenceI seq2 = new Sequence("Seq2", "BBB");
SequenceI seq3 = new Sequence("Seq3", "CCC");
- Annotation[] anns = new Annotation[]
- { new Annotation(2f) };
+ Annotation[] anns = new Annotation[] { new Annotation(2f) };
AlignmentAnnotation ann1 = new AlignmentAnnotation("Structure", "ann1",
anns);
ann1.setSequenceRef(seq1);
AlignmentAnnotation ann5 = new AlignmentAnnotation("Temp", "ann5", anns);
ann5.setSequenceRef(seq2);
AlignmentAnnotation ann6 = new AlignmentAnnotation("Temp", "ann6", anns);
- AlignmentI al = new Alignment(new SequenceI[] {seq1, seq2, seq3});
+ AlignmentI al = new Alignment(new SequenceI[] { seq1, seq2, seq3 });
al.addAnnotation(ann1); // Structure for Seq1
al.addAnnotation(ann2); // Structure for Seq2
al.addAnnotation(ann3); // Structure for no sequence
/**
* Tests for the method that checks if one sequence cross-references another
*/
- @Test
+ @Test(groups = { "Functional" })
public void testHasCrossRef()
{
assertFalse(AlignmentUtils.hasCrossRef(null, null));
assertFalse(AlignmentUtils.hasCrossRef(null, seq1));
SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
-
+
// different ref
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20193"));
assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
-
+
// case-insensitive; version number is ignored
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20192"));
assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
-
+
// right case!
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
* Tests for the method that checks if either sequence cross-references the
* other
*/
- @Test
+ @Test(groups = { "Functional" })
public void testHaveCrossRef()
{
assertFalse(AlignmentUtils.hasCrossRef(null, null));
assertFalse(AlignmentUtils.haveCrossRef(null, seq1));
SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
assertFalse(AlignmentUtils.haveCrossRef(seq1, seq2));
-
+
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
// next is true for haveCrossRef, false for hasCrossRef
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
-
+
// now the other way round
- seq1.setDBRef(null);
+ seq1.setDBRefs(null);
seq2.addDBRef(new DBRefEntry("EMBL", "1", "A12345"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
-
+
// now both ways
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
}
+
+ /**
+ * Test the method that extracts the cds-only part of a dna alignment.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC");
+ SequenceI pep1 = new Sequence("pep1", "GF");
+ SequenceI pep2 = new Sequence("pep2", "GFP");
+ dna1.createDatasetSequence();
+ dna2.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds5", 13, 15, 0f,
+ null));
+
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+ map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 },
+ 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
+ dna1, dna2 }, mappings, '-');
+ assertEquals(2, cds.getSequences().size());
+ assertEquals("---GGG---TTT---", cds.getSequenceAt(0)
+ .getSequenceAsString());
+ assertEquals("GGG---TTT---CCC", cds.getSequenceAt(1)
+ .getSequenceAsString());
+
+ /*
+ * Verify updated mappings
+ */
+ assertEquals(2, mappings.size());
+
+ /*
+ * Mapping from pep1 to GGGTTT in first new exon sequence
+ */
+ List<AlignedCodonFrame> pep1Mapping = MappingUtils
+ .findMappingsForSequence(pep1, mappings);
+ assertEquals(1, pep1Mapping.size());
+ // map G to GGG
+ SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ Match m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+
+ /*
+ * Mapping from pep2 to GGGTTTCCC in second new exon sequence
+ */
+ List<AlignedCodonFrame> pep2Mapping = MappingUtils
+ .findMappingsForSequence(pep2, mappings);
+ assertEquals(1, pep2Mapping.size());
+ // map G to GGG
+ sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ // map P to CCC
+ sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ }
+
+ /**
+ * Test the method that makes a cds-only sequence from a DNA sequence and its
+ * product mapping. Test includes the expected case that the DNA sequence
+ * already has a protein product (Uniprot translation) which in turn has an
+ * x-ref to the EMBLCDS record.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsSequences()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI pep1 = new Sequence("pep1", "GF");
+ dna1.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep1.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "2", "A12345"));
+
+ /*
+ * Make the mapping from dna to protein. The protein sequence has a DBRef to
+ * EMBLCDS|A12345.
+ */
+ Set<AlignedCodonFrame> mappings = new HashSet<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignedCodonFrame newMapping = new AlignedCodonFrame();
+ List<int[]> ungappedColumns = new ArrayList<int[]>();
+ ungappedColumns.add(new int[] { 4, 6 });
+ ungappedColumns.add(new int[] { 10, 12 });
+ List<SequenceI> cdsSeqs = AlignmentUtils.makeCdsSequences(dna1, acf,
+ ungappedColumns,
+ newMapping, '-');
+ assertEquals(1, cdsSeqs.size());
+ SequenceI cdsSeq = cdsSeqs.get(0);
+
+ assertEquals("GGGTTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12345", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("2", cdsRef.getVersion());
+ assertEquals("A12345", cdsRef.getAccessionId());
+ }
+
+ /**
+ * Test the method that makes a cds-only alignment from a DNA sequence and its
+ * product mappings, for the case where there are multiple exon mappings to
+ * different protein products.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment_multipleProteins()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI pep1 = new Sequence("pep1", "GF"); // GGGTTT
+ SequenceI pep2 = new Sequence("pep2", "KP"); // aaaccc
+ SequenceI pep3 = new Sequence("pep3", "KF"); // aaaTTT
+ dna1.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds5", 1, 3, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds6", 10, 12, 0f,
+ null));
+ pep1.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "2", "A12345"));
+ pep2.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "3", "A12346"));
+ pep3.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "4", "A12347"));
+
+ /*
+ * Make the mappings from dna to protein
+ */
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ // map ...GGG...TTT to GF
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ // map aaa...ccc to KP
+ map = new MapList(new int[] { 1, 3, 7, 9 }, new int[] { 1, 2 }, 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ // map aaa......TTT to KF
+ map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 2 }, 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ /*
+ * Create the Exon alignment; also replaces the dna-to-protein mappings with
+ * exon-to-protein and exon-to-dna mappings
+ */
+ AlignmentI exal = AlignmentUtils.makeCdsAlignment(
+ new SequenceI[] { dna1 }, mappings, '-');
+
+ /*
+ * Verify we have 3 cds sequences, mapped to pep1/2/3 respectively
+ */
+ List<SequenceI> cds = exal.getSequences();
+ assertEquals(3, cds.size());
+
+ SequenceI cdsSeq = cds.get(0);
+ assertEquals("---GGG---TTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12345", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("2", cdsRef.getVersion());
+ assertEquals("A12345", cdsRef.getAccessionId());
+
+ cdsSeq = cds.get(1);
+ assertEquals("aaa---ccc---", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12346", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("3", cdsRef.getVersion());
+ assertEquals("A12346", cdsRef.getAccessionId());
+
+ cdsSeq = cds.get(2);
+ assertEquals("aaa------TTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12347", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("4", cdsRef.getVersion());
+ assertEquals("A12347", cdsRef.getAccessionId());
+
+ /*
+ * Verify there are mappings from each cds sequence to its protein product
+ * and also to its dna source
+ */
+ Iterator<AlignedCodonFrame> newMappingsIterator = mappings.iterator();
+
+ // mappings for dna1 - exon1 - pep1
+ AlignedCodonFrame cdsMapping = newMappingsIterator.next();
+ List<Mapping> dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(0).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("G(1) in CDS should map to G(4) in DNA", 4, dnaMappings
+ .get(0).getMap().getToPosition(1));
+ List<Mapping> peptideMappings = cdsMapping
+ .getMappingsForSequence(pep1);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep1.getDatasetSequence(), peptideMappings.get(0).getTo());
+
+ // mappings for dna1 - cds2 - pep2
+ cdsMapping = newMappingsIterator.next();
+ dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(1).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("c(4) in CDS should map to c(7) in DNA", 7, dnaMappings
+ .get(0).getMap().getToPosition(4));
+ peptideMappings = cdsMapping.getMappingsForSequence(pep2);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep2.getDatasetSequence(), peptideMappings.get(0).getTo());
+
+ // mappings for dna1 - cds3 - pep3
+ cdsMapping = newMappingsIterator.next();
+ dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(2).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("T(4) in CDS should map to T(10) in DNA", 10, dnaMappings
+ .get(0).getMap().getToPosition(4));
+ peptideMappings = cdsMapping.getMappingsForSequence(pep3);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep3.getDatasetSequence(), peptideMappings.get(0).getTo());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testIsMappable()
+ {
+ SequenceI dna1 = new Sequence("dna1", "cgCAGtgGT");
+ SequenceI aa1 = new Sequence("aa1", "RSG");
+ AlignmentI al1 = new Alignment(new SequenceI[] { dna1 });
+ AlignmentI al2 = new Alignment(new SequenceI[] { aa1 });
+
+ assertFalse(AlignmentUtils.isMappable(null, null));
+ assertFalse(AlignmentUtils.isMappable(al1, null));
+ assertFalse(AlignmentUtils.isMappable(null, al1));
+ assertFalse(AlignmentUtils.isMappable(al1, al1));
+ assertFalse(AlignmentUtils.isMappable(al2, al2));
+
+ assertTrue(AlignmentUtils.isMappable(al1, al2));
+ assertTrue(AlignmentUtils.isMappable(al2, al1));
+ }
+
+ /**
+ * Test creating a mapping when the sequences involved do not start at residue
+ * 1
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinSequenceToCdna_forSubsequence()
+ throws IOException
+ {
+ SequenceI prot = new Sequence("UNIPROT|V12345", "E-I--Q", 10, 12);
+ prot.createDatasetSequence();
+
+ SequenceI dna = new Sequence("EMBL|A33333", "GAA--AT-C-CAG", 40, 48);
+ dna.createDatasetSequence();
+
+ MapList map = AlignmentUtils.mapProteinSequenceToCdna(prot, dna);
+ assertEquals(10, map.getToLowest());
+ assertEquals(12, map.getToHighest());
+ assertEquals(40, map.getFromLowest());
+ assertEquals(48, map.getFromHighest());
+ }
+
+ /**
+ * Test for the alignSequenceAs method where we have protein mapped to protein
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_mappedProteinProtein()
+ {
+
+ SequenceI alignMe = new Sequence("Match", "MGAASEV");
+ alignMe.createDatasetSequence();
+ SequenceI alignFrom = new Sequence("Query", "LQTGYMGAASEVMFSPTRR");
+ alignFrom.createDatasetSequence();
+
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ // this is like a domain or motif match of part of a peptide sequence
+ MapList map = new MapList(new int[] { 6, 12 }, new int[] { 1, 7 }, 1, 1);
+ acf.addMap(alignFrom.getDatasetSequence(),
+ alignMe.getDatasetSequence(), map);
+
+ AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "-", '-', true,
+ true);
+ assertEquals("-----MGAASEV-------", alignMe.getSequenceAsString());
+ }
+
+ /**
+ * Test for the alignSequenceAs method where there are trailing unmapped
+ * residues in the model sequence
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_withTrailingPeptide()
+ {
+ // map first 3 codons to KPF; G is a trailing unmapped residue
+ MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
+
+ checkAlignSequenceAs("AAACCCTTT", "K-PFG", true, true, map,
+ "AAA---CCCTTT---");
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ // no overlap
+ dna.addSequenceFeature(new SequenceFeature("type1", "desc1", 1, 2, 1f,
+ null));
+ // partial overlap - to [1, 1]
+ dna.addSequenceFeature(new SequenceFeature("type2", "desc2", 3, 4, 2f,
+ null));
+ // exact overlap - to [1, 3]
+ dna.addSequenceFeature(new SequenceFeature("type3", "desc3", 4, 6, 3f,
+ null));
+ // spanning overlap - to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // exactly overlaps whole mapped range [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // no overlap (internal)
+ dna.addSequenceFeature(new SequenceFeature("type6", "desc6", 7, 9, 6f,
+ null));
+ // no overlap (3' end)
+ dna.addSequenceFeature(new SequenceFeature("type7", "desc7", 13, 15,
+ 7f, null));
+ // overlap (3' end) - to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+ // extended overlap - to [6, +]
+ dna.addSequenceFeature(new SequenceFeature("type9", "desc9", 12, 13,
+ 9f, null));
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ /*
+ * transferFeatures() will build 'partial overlap' for regions
+ * that partially overlap 5' or 3' (start or end) of target sequence
+ */
+ AlignmentUtils.transferFeatures(dna, cds, map, null);
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(6, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type2", sf.getType());
+ assertEquals("desc2", sf.getDescription());
+ assertEquals(2f, sf.getScore());
+ assertEquals(1, sf.getBegin());
+ assertEquals(1, sf.getEnd());
+
+ sf = sfs[1];
+ assertEquals("type3", sf.getType());
+ assertEquals("desc3", sf.getDescription());
+ assertEquals(3f, sf.getScore());
+ assertEquals(1, sf.getBegin());
+ assertEquals(3, sf.getEnd());
+
+ sf = sfs[2];
+ assertEquals("type4", sf.getType());
+ assertEquals(2, sf.getBegin());
+ assertEquals(5, sf.getEnd());
+
+ sf = sfs[3];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+
+ sf = sfs[4];
+ assertEquals("type8", sf.getType());
+ assertEquals(6, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+
+ sf = sfs[5];
+ assertEquals("type9", sf.getType());
+ assertEquals(6, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures_withOmit()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ // [5, 11] maps to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // [4, 12] maps to [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // [12, 12] maps to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+
+ // desc4 and desc8 are the 'omit these' varargs
+ AlignmentUtils.transferFeatures(dna, cds, map, null, "type4", "type8");
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures_withSelect()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ // [5, 11] maps to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // [4, 12] maps to [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // [12, 12] maps to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+
+ // "type5" is the 'select this type' argument
+ AlignmentUtils.transferFeatures(dna, cds, map, "type5");
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Test the method that extracts the cds-only part of a dna alignment, for the
+ * case where the cds should be aligned to match its nucleotide sequence.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment_alternativeTranscripts()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGCC-----CTTTaaaGGG");
+ // alternative transcript of same dna skips CCC codon
+ SequenceI dna2 = new Sequence("dna2", "aaaGGGCC-----cttTaaaGGG");
+ // dna3 has no mapping (protein product) so should be ignored here
+ SequenceI dna3 = new Sequence("dna3", "aaaGGGCCCCCGGGcttTaaaGGG");
+ SequenceI pep1 = new Sequence("pep1", "GPFG");
+ SequenceI pep2 = new Sequence("pep2", "GPG");
+ dna1.createDatasetSequence();
+ dna2.createDatasetSequence();
+ dna3.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 8, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 9, 12, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 16, 18, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 4, 8, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 16, 18, 0f,
+ null));
+
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 12, 16, 18 },
+ new int[] { 1, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+ map = new MapList(new int[] { 4, 8, 12, 12, 16, 18 },
+ new int[] { 1, 3 },
+ 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
+ dna1, dna2, dna3 }, mappings, '-');
+ assertEquals(2, cds.getSequences().size());
+ assertEquals("GGGCCCTTTGGG", cds.getSequenceAt(0).getSequenceAsString());
+ assertEquals("GGGCC---TGGG", cds.getSequenceAt(1).getSequenceAsString());
+
+ /*
+ * Verify updated mappings
+ */
+ assertEquals(2, mappings.size());
+
+ /*
+ * Mapping from pep1 to GGGTTT in first new CDS sequence
+ */
+ List<AlignedCodonFrame> pep1Mapping = MappingUtils
+ .findMappingsForSequence(pep1, mappings);
+ assertEquals(1, pep1Mapping.size());
+ /*
+ * maps GPFG to 1-3,4-6,7-9,10-12
+ */
+ SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ Match m = sr.getResults().get(0);
+ assertEquals(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 3, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 4, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(10, m.getStart());
+ assertEquals(12, m.getEnd());
+
+ /*
+ * GPG in pep2 map to 1-3,4-6,7-9 in second CDS sequence
+ */
+ List<AlignedCodonFrame> pep2Mapping = MappingUtils
+ .findMappingsForSequence(pep2, mappings);
+ assertEquals(1, pep2Mapping.size());
+ sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ m = sr.getResults().get(0);
+ assertEquals(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ }
+
+ /**
+ * Tests for gapped column in sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testIsGappedColumn()
+ {
+ SequenceI seq1 = new Sequence("Seq1", "a--c.tc-a-g");
+ SequenceI seq2 = new Sequence("Seq2", "aa---t--a-g");
+ SequenceI seq3 = new Sequence("Seq3", "ag-c t-g-");
+ List<SequenceI> seqs = Arrays
+ .asList(new SequenceI[] { seq1, seq2, seq3 });
+ // the column number is base 1
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 1));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 2));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 3));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 4));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 5));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 6));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 7));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 8));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 9));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 10));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 11));
+ // out of bounds:
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 0));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 100));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, -100));
+ assertTrue(AlignmentUtils.isGappedColumn(null, 0));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindCdsColumns()
+ {
+ // TODO target method belongs in a general-purpose alignment
+ // analysis method to find columns for feature
+
+ /*
+ * NB this method assumes CDS ranges are contiguous (no introns)
+ */
+ SequenceI gene = new Sequence("gene", "aaacccgggtttaaacccgggttt");
+ SequenceI seq1 = new Sequence("Seq1", "--ac-cgGG-GGaaACC--GGtt-");
+ SequenceI seq2 = new Sequence("Seq2", "AA--CCGG--g-AAA--cG-GTTt");
+ seq1.createDatasetSequence();
+ seq2.createDatasetSequence();
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 5, 6, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 7, 8, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 11, 13, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 14, 15, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 1, 2, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 3, 6, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 8, 10, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 13, 15, 0f,
+ null));
+
+ List<int[]> cdsColumns = AlignmentUtils.findCdsColumns(new SequenceI[] {
+ seq1, seq2 });
+ assertEquals(4, cdsColumns.size());
+ assertEquals("[1, 2]", Arrays.toString(cdsColumns.get(0)));
+ assertEquals("[5, 9]", Arrays.toString(cdsColumns.get(1)));
+ assertEquals("[11, 17]", Arrays.toString(cdsColumns.get(2)));
+ assertEquals("[19, 23]", Arrays.toString(cdsColumns.get(3)));
+ }
+
+ /**
+ * Test the method that realigns protein to match mapped codon alignment.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignProteinAsDna_incompleteStartCodon()
+ {
+ // seq1: incomplete start codon (not mapped), then [3, 11]
+ SequenceI dna1 = new Sequence("Seq1", "ccAAA-TTT-GGG-");
+ // seq2 codons are [4, 5], [8, 11]
+ SequenceI dna2 = new Sequence("Seq2", "ccaAA-ttT-GGG-");
+ // seq3 incomplete start codon at 'tt'
+ SequenceI dna3 = new Sequence("Seq3", "ccaaa-ttt-GGG-");
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
+ dna.setDataset(null);
+
+ // prot1 has 'X' for incomplete start codon (not mapped)
+ SequenceI prot1 = new Sequence("Seq1", "XKFG"); // X for incomplete start
+ SequenceI prot2 = new Sequence("Seq2", "NG");
+ SequenceI prot3 = new Sequence("Seq3", "XG"); // X for incomplete start
+ AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
+ prot3 });
+ protein.setDataset(null);
+
+ // map dna1 [3, 11] to prot1 [2, 4] KFG
+ MapList map = new MapList(new int[] { 3, 11 }, new int[] { 2, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
+
+ // map dna2 [4, 5] [8, 11] to prot2 [1, 2] NG
+ map = new MapList(new int[] { 4, 5, 8, 11 }, new int[] { 1, 2 }, 3, 1);
+ acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
+
+ // map dna3 [9, 11] to prot3 [2, 2] G
+ map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1);
+ acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
+
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ acfs.add(acf);
+ protein.setCodonFrames(acfs);
+
+ /*
+ * verify X is included in the aligned proteins, and placed just
+ * before the first mapped residue
+ * CCT is between CCC and TTT
+ */
+ AlignmentUtils.alignProteinAsDna(protein, dna);
+ assertEquals("XK-FG", prot1.getSequenceAsString());
+ assertEquals("--N-G", prot2.getSequenceAsString());
+ assertEquals("---XG", prot3.getSequenceAsString());
+ }
}
git://source.jalview.org / jalview.git / blobdiff