/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2b1)
- * Copyright (C) 2014 The Jalview Authors
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
*/
package jalview.analysis;
-import static org.junit.Assert.assertTrue;
-
-import org.junit.Test;
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.assertSame;
+import static org.testng.AssertJUnit.assertTrue;
+import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Annotation;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResults.Match;
import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.io.AppletFormatAdapter;
+import jalview.io.FormatAdapter;
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
+
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.HashSet;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Map;
+import java.util.Set;
-public class AlignmentUtilsTests
+import org.testng.annotations.Test;
+
+public class AlignmentUtilsTests
{
- public static Sequence ts=new Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
- @Test
- public void testExpandFlanks()
+ // @formatter:off
+ private static final String TEST_DATA =
+ "# STOCKHOLM 1.0\n" +
+ "#=GS D.melanogaster.1 AC AY119185.1/838-902\n" +
+ "#=GS D.melanogaster.2 AC AC092237.1/57223-57161\n" +
+ "#=GS D.melanogaster.3 AC AY060611.1/560-627\n" +
+ "D.melanogaster.1 G.AGCC.CU...AUGAUCGA\n" +
+ "#=GR D.melanogaster.1 SS ................((((\n" +
+ "D.melanogaster.2 C.AUUCAACU.UAUGAGGAU\n" +
+ "#=GR D.melanogaster.2 SS ................((((\n" +
+ "D.melanogaster.3 G.UGGCGCU..UAUGACGCA\n" +
+ "#=GR D.melanogaster.3 SS (.(((...(....(((((((\n" +
+ "//";
+
+ private static final String AA_SEQS_1 =
+ ">Seq1Name\n" +
+ "K-QY--L\n" +
+ ">Seq2Name\n" +
+ "-R-FP-W-\n";
+
+ private static final String CDNA_SEQS_1 =
+ ">Seq1Name\n" +
+ "AC-GG--CUC-CAA-CT\n" +
+ ">Seq2Name\n" +
+ "-CG-TTA--ACG---AAGT\n";
+
+ private static final String CDNA_SEQS_2 =
+ ">Seq1Name\n" +
+ "GCTCGUCGTACT\n" +
+ ">Seq2Name\n" +
+ "GGGTCAGGCAGT\n";
+ // @formatter:on
+
+ // public static Sequence ts=new
+ // Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
+ public static Sequence ts = new Sequence("short",
+ "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
+
+ @Test(groups = { "Functional" })
+ public void testExpandContext()
{
AlignmentI al = new Alignment(new Sequence[] {});
- for (int i=4;i<14;i+=3)
+ for (int i = 4; i < 14; i += 2)
{
- SequenceI s1=ts.deriveSequence().getSubSequence(i, i+7);
+ SequenceI s1 = ts.deriveSequence().getSubSequence(i, i + 7);
al.addSequence(s1);
}
- System.out.println(new AppletFormatAdapter().formatSequences("Clustal", al, true));
- for (int flnk=-1;flnk<25; flnk++)
+ System.out.println(new AppletFormatAdapter().formatSequences("Clustal",
+ al, true));
+ for (int flnk = -1; flnk < 25; flnk++)
{
- AlignmentI exp;
- System.out.println("\nFlank size: "+flnk);
- System.out.println(new AppletFormatAdapter().formatSequences("Clustal", exp=AlignmentUtils.expandContext(al, flnk), true));
- if (flnk==-1) {
- for (SequenceI sq:exp.getSequences())
+ AlignmentI exp = AlignmentUtils.expandContext(al, flnk);
+ System.out.println("\nFlank size: " + flnk);
+ System.out.println(new AppletFormatAdapter().formatSequences(
+ "Clustal", exp, true));
+ if (flnk == -1)
{
+ /*
+ * Full expansion to complete sequences
+ */
+ for (SequenceI sq : exp.getSequences())
+ {
String ung = sq.getSequenceAsString().replaceAll("-+", "");
- assertTrue("Flanking sequence not the same as original dataset sequence.\n"+ung+"\n"+sq.getDatasetSequence().getSequenceAsString(),ung.equalsIgnoreCase(sq.getDatasetSequence().getSequenceAsString()));
+ final String errorMsg = "Flanking sequence not the same as original dataset sequence.\n"
+ + ung
+ + "\n"
+ + sq.getDatasetSequence().getSequenceAsString();
+ assertTrue(errorMsg, ung.equalsIgnoreCase(sq.getDatasetSequence()
+ .getSequenceAsString()));
+ }
}
+ else if (flnk == 24)
+ {
+ /*
+ * Last sequence is fully expanded, others have leading gaps to match
+ */
+ assertTrue(exp.getSequenceAt(4).getSequenceAsString()
+ .startsWith("abc"));
+ assertTrue(exp.getSequenceAt(3).getSequenceAsString()
+ .startsWith("--abc"));
+ assertTrue(exp.getSequenceAt(2).getSequenceAsString()
+ .startsWith("----abc"));
+ assertTrue(exp.getSequenceAt(1).getSequenceAsString()
+ .startsWith("------abc"));
+ assertTrue(exp.getSequenceAt(0).getSequenceAsString()
+ .startsWith("--------abc"));
}
- }
+ }
+ }
+
+ /**
+ * Test that annotations are correctly adjusted by expandContext
+ */
+ @Test(groups = { "Functional" })
+ public void testExpandContext_annotation()
+ {
+ AlignmentI al = new Alignment(new Sequence[] {});
+ SequenceI ds = new Sequence("Seq1", "ABCDEFGHI");
+ // subsequence DEF:
+ SequenceI seq1 = ds.deriveSequence().getSubSequence(3, 6);
+ al.addSequence(seq1);
+
+ /*
+ * Annotate DEF with 4/5/6 respectively
+ */
+ Annotation[] anns = new Annotation[] { new Annotation(4),
+ new Annotation(5), new Annotation(6) };
+ AlignmentAnnotation ann = new AlignmentAnnotation("SS",
+ "secondary structure", anns);
+ seq1.addAlignmentAnnotation(ann);
+
+ /*
+ * The annotations array should match aligned positions
+ */
+ assertEquals(3, ann.annotations.length);
+ assertEquals(4, ann.annotations[0].value, 0.001);
+ assertEquals(5, ann.annotations[1].value, 0.001);
+ assertEquals(6, ann.annotations[2].value, 0.001);
+
+ /*
+ * Check annotation to sequence position mappings before expanding the
+ * sequence; these are set up in Sequence.addAlignmentAnnotation ->
+ * Annotation.setSequenceRef -> createSequenceMappings
+ */
+ assertNull(ann.getAnnotationForPosition(1));
+ assertNull(ann.getAnnotationForPosition(2));
+ assertNull(ann.getAnnotationForPosition(3));
+ assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
+ assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
+ assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
+ assertNull(ann.getAnnotationForPosition(7));
+ assertNull(ann.getAnnotationForPosition(8));
+ assertNull(ann.getAnnotationForPosition(9));
+
+ /*
+ * Expand the subsequence to the full sequence abcDEFghi
+ */
+ AlignmentI expanded = AlignmentUtils.expandContext(al, -1);
+ assertEquals("abcDEFghi", expanded.getSequenceAt(0)
+ .getSequenceAsString());
+
+ /*
+ * Confirm the alignment and sequence have the same SS annotation,
+ * referencing the expanded sequence
+ */
+ ann = expanded.getSequenceAt(0).getAnnotation()[0];
+ assertSame(ann, expanded.getAlignmentAnnotation()[0]);
+ assertSame(expanded.getSequenceAt(0), ann.sequenceRef);
+
+ /*
+ * The annotations array should have null values except for annotated
+ * positions
+ */
+ assertNull(ann.annotations[0]);
+ assertNull(ann.annotations[1]);
+ assertNull(ann.annotations[2]);
+ assertEquals(4, ann.annotations[3].value, 0.001);
+ assertEquals(5, ann.annotations[4].value, 0.001);
+ assertEquals(6, ann.annotations[5].value, 0.001);
+ assertNull(ann.annotations[6]);
+ assertNull(ann.annotations[7]);
+ assertNull(ann.annotations[8]);
+
+ /*
+ * sequence position mappings should be unchanged
+ */
+ assertNull(ann.getAnnotationForPosition(1));
+ assertNull(ann.getAnnotationForPosition(2));
+ assertNull(ann.getAnnotationForPosition(3));
+ assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
+ assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
+ assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
+ assertNull(ann.getAnnotationForPosition(7));
+ assertNull(ann.getAnnotationForPosition(8));
+ assertNull(ann.getAnnotationForPosition(9));
+ }
+
+ /**
+ * Test method that returns a map of lists of sequences by sequence name.
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testGetSequencesByName() throws IOException
+ {
+ final String data = ">Seq1Name\nKQYL\n" + ">Seq2Name\nRFPW\n"
+ + ">Seq1Name\nABCD\n";
+ AlignmentI al = loadAlignment(data, "FASTA");
+ Map<String, List<SequenceI>> map = AlignmentUtils
+ .getSequencesByName(al);
+ assertEquals(2, map.keySet().size());
+ assertEquals(2, map.get("Seq1Name").size());
+ assertEquals("KQYL", map.get("Seq1Name").get(0).getSequenceAsString());
+ assertEquals("ABCD", map.get("Seq1Name").get(1).getSequenceAsString());
+ assertEquals(1, map.get("Seq2Name").size());
+ assertEquals("RFPW", map.get("Seq2Name").get(0).getSequenceAsString());
+ }
+
+ /**
+ * Helper method to load an alignment and ensure dataset sequences are set up.
+ *
+ * @param data
+ * @param format
+ * TODO
+ * @return
+ * @throws IOException
+ */
+ protected AlignmentI loadAlignment(final String data, String format)
+ throws IOException
+ {
+ AlignmentI a = new FormatAdapter().readFile(data,
+ AppletFormatAdapter.PASTE, format);
+ a.setDataset(null);
+ return a;
+ }
+
+ /**
+ * Test mapping of protein to cDNA, for the case where we have no sequence
+ * cross-references, so mappings are made first-served 1-1 where sequences
+ * translate.
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_noXrefs() throws IOException
+ {
+ List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
+ AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
+ protein.setDataset(null);
+
+ List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
+ dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAA")); // = EIQ
+ dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
+ dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG")); // = EIQ
+ AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
+ cdna.setDataset(null);
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
+
+ // 3 mappings made, each from 1 to 1 sequence
+ assertEquals(3, protein.getCodonFrames().size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
+
+ // V12345 mapped to A22222
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ Mapping[] protMappings = acf.getProtMappings();
+ assertEquals(1, protMappings.length);
+ MapList mapList = protMappings[0].getMap();
+ assertEquals(3, mapList.getFromRatio());
+ assertEquals(1, mapList.getToRatio());
+ assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
+ .get(0)));
+ assertEquals(1, mapList.getFromRanges().size());
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
+ assertEquals(1, mapList.getToRanges().size());
+
+ // V12346 mapped to A33333
+ acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+
+ // V12347 mapped to A11111
+ acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+
+ // no mapping involving the 'extra' A44444
+ assertTrue(protein.getCodonFrame(cdna.getSequenceAt(3)).isEmpty());
+ }
+
+ /**
+ * Test for the alignSequenceAs method that takes two sequences and a mapping.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_withMapping_noIntrons()
+ {
+ MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1);
+
+ /*
+ * No existing gaps in dna:
+ */
+ checkAlignSequenceAs("GGGAAA", "-A-L-", false, false, map,
+ "---GGG---AAA");
+
+ /*
+ * Now introduce gaps in dna but ignore them when realigning.
+ */
+ checkAlignSequenceAs("-G-G-G-A-A-A-", "-A-L-", false, false, map,
+ "---GGG---AAA");
+
+ /*
+ * Now include gaps in dna when realigning. First retaining 'mapped' gaps
+ * only, i.e. those within the exon region.
+ */
+ checkAlignSequenceAs("-G-G--G-A--A-A-", "-A-L-", true, false, map,
+ "---G-G--G---A--A-A");
+
+ /*
+ * Include all gaps in dna when realigning (within and without the exon
+ * region). The leading gap, and the gaps between codons, are subsumed by
+ * the protein alignment gap.
+ */
+ checkAlignSequenceAs("-G-GG--AA-A---", "-A-L-", true, true, map,
+ "---G-GG---AA-A---");
+
+ /*
+ * Include only unmapped gaps in dna when realigning (outside the exon
+ * region). The leading gap, and the gaps between codons, are subsumed by
+ * the protein alignment gap.
+ */
+ checkAlignSequenceAs("-G-GG--AA-A-", "-A-L-", false, true, map,
+ "---GGG---AAA---");
+ }
+
+ /**
+ * Test for the alignSequenceAs method that takes two sequences and a mapping.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_withMapping_withIntrons()
+ {
+ /*
+ * Exons at codon 2 (AAA) and 4 (TTT)
+ */
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+
+ /*
+ * Simple case: no gaps in dna
+ */
+ checkAlignSequenceAs("GGGAAACCCTTTGGG", "--A-L-", false, false, map,
+ "GGG---AAACCCTTTGGG");
+
+ /*
+ * Add gaps to dna - but ignore when realigning.
+ */
+ checkAlignSequenceAs("-G-G-G--A--A---AC-CC-T-TT-GG-G-", "--A-L-",
+ false, false, map, "GGG---AAACCCTTTGGG");
+
+ /*
+ * Add gaps to dna - include within exons only when realigning.
+ */
+ checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
+ true, false, map, "GGG---A--A---ACCCT-TTGGG");
+
+ /*
+ * Include gaps outside exons only when realigning.
+ */
+ checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
+ false, true, map, "-G-G-GAAAC-CCTTT-GG-G-");
+
+ /*
+ * Include gaps following first intron if we are 'preserving mapped gaps'
+ */
+ checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
+ true, true, map, "-G-G-G--A--A---A-C-CC-T-TT-GG-G-");
+
+ /*
+ * Include all gaps in dna when realigning.
+ */
+ checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
+ true, true, map, "-G-G-G--A--A---A-C-CC-T-TT-GG-G-");
+ }
+
+ /**
+ * Test for the case where not all of the protein sequence is mapped to cDNA.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_withMapping_withUnmappedProtein()
+ {
+ /*
+ * Exons at codon 2 (AAA) and 4 (TTT) mapped to A and P
+ */
+ final MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] {
+ 1, 1, 3, 3 }, 3, 1);
+
+ /*
+ * -L- 'aligns' ccc------
+ */
+ checkAlignSequenceAs("gggAAAcccTTTggg", "-A-L-P-", false, false, map,
+ "gggAAAccc------TTTggg");
+ }
+
+ /**
+ * Helper method that performs and verifies the method under test.
+ *
+ * @param alignee
+ * the sequence to be realigned
+ * @param alignModel
+ * the sequence whose alignment is to be copied
+ * @param preserveMappedGaps
+ * @param preserveUnmappedGaps
+ * @param map
+ * @param expected
+ */
+ protected void checkAlignSequenceAs(final String alignee,
+ final String alignModel, final boolean preserveMappedGaps,
+ final boolean preserveUnmappedGaps, MapList map,
+ final String expected)
+ {
+ SequenceI alignMe = new Sequence("Seq1", alignee);
+ alignMe.createDatasetSequence();
+ SequenceI alignFrom = new Sequence("Seq2", alignModel);
+ alignFrom.createDatasetSequence();
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(alignMe.getDatasetSequence(), alignFrom.getDatasetSequence(), map);
+
+ AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "---", '-',
+ preserveMappedGaps, preserveUnmappedGaps);
+ assertEquals(expected, alignMe.getSequenceAsString());
+ }
+
+ /**
+ * Test for the alignSequenceAs method where we preserve gaps in introns only.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_keepIntronGapsOnly()
+ {
+
+ /*
+ * Intron GGGAAA followed by exon CCCTTT
+ */
+ MapList map = new MapList(new int[] { 7, 12 }, new int[] { 1, 2 }, 3, 1);
+
+ checkAlignSequenceAs("GG-G-AA-A-C-CC-T-TT", "AL", false, true, map,
+ "GG-G-AA-ACCCTTT");
+ }
+
+ /**
+ * Test for the method that generates an aligned translated sequence from one
+ * mapping.
+ */
+ @Test(groups = { "Functional" })
+ public void testGetAlignedTranslation_dnaLikeProtein()
+ {
+ // dna alignment will be replaced
+ SequenceI dna = new Sequence("Seq1", "T-G-CC-A--T-TAC-CAG-");
+ dna.createDatasetSequence();
+ // protein alignment will be 'applied' to dna
+ SequenceI protein = new Sequence("Seq1", "-CH-Y--Q-");
+ protein.createDatasetSequence();
+ MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
+
+ final SequenceI aligned = AlignmentUtils.getAlignedTranslation(protein,
+ '-', acf);
+ assertEquals("---TGCCAT---TAC------CAG---",
+ aligned.getSequenceAsString());
+ assertSame(aligned.getDatasetSequence(), dna.getDatasetSequence());
+ }
+
+ /**
+ * Test the method that realigns protein to match mapped codon alignment.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignProteinAsDna()
+ {
+ // seq1 codons are [1,2,3] [4,5,6] [7,8,9] [10,11,12]
+ SequenceI dna1 = new Sequence("Seq1", "TGCCATTACCAG-");
+ // seq2 codons are [1,3,4] [5,6,7] [8,9,10] [11,12,13]
+ SequenceI dna2 = new Sequence("Seq2", "T-GCCATTACCAG");
+ // seq3 codons are [1,2,3] [4,5,7] [8,9,10] [11,12,13]
+ SequenceI dna3 = new Sequence("Seq3", "TGCCA-TTACCAG");
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
+ dna.setDataset(null);
+
+ // protein alignment will be realigned like dna
+ SequenceI prot1 = new Sequence("Seq1", "CHYQ");
+ SequenceI prot2 = new Sequence("Seq2", "CHYQ");
+ SequenceI prot3 = new Sequence("Seq3", "CHYQ");
+ SequenceI prot4 = new Sequence("Seq4", "R-QSV"); // unmapped, unchanged
+ AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
+ prot3, prot4 });
+ protein.setDataset(null);
+
+ MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
+ acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
+ acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ acfs.add(acf);
+ protein.setCodonFrames(acfs);
+
+ /*
+ * Translated codon order is [1,2,3] [1,3,4] [4,5,6] [4,5,7] [5,6,7] [7,8,9]
+ * [8,9,10] [10,11,12] [11,12,13]
+ */
+ AlignmentUtils.alignProteinAsDna(protein, dna);
+ assertEquals("C-H--Y-Q-", prot1.getSequenceAsString());
+ assertEquals("-C--H-Y-Q", prot2.getSequenceAsString());
+ assertEquals("C--H--Y-Q", prot3.getSequenceAsString());
+ assertEquals("R-QSV", prot4.getSequenceAsString());
+ }
+
+ /**
+ * Test the method that tests whether a CDNA sequence translates to a protein
+ * sequence
+ */
+ @Test(groups = { "Functional" })
+ public void testTranslatesAs()
+ {
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(), 0,
+ "FPKG".toCharArray()));
+ // with start codon (not in protein)
+ assertTrue(AlignmentUtils.translatesAs("atgtttcccaaaggg".toCharArray(),
+ 3, "FPKG".toCharArray()));
+ // with stop codon1 (not in protein)
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
+ 0, "FPKG".toCharArray()));
+ // with stop codon1 (in protein as *)
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
+ 0, "FPKG*".toCharArray()));
+ // with stop codon2 (not in protein)
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtag".toCharArray(),
+ 0, "FPKG".toCharArray()));
+ // with stop codon3 (not in protein)
+ assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtga".toCharArray(),
+ 0, "FPKG".toCharArray()));
+ // with start and stop codon1
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttcccaaagggtaa".toCharArray(), 3, "FPKG".toCharArray()));
+ // with start and stop codon1 (in protein as *)
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttcccaaagggtaa".toCharArray(), 3, "FPKG*".toCharArray()));
+ // with start and stop codon2
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttcccaaagggtag".toCharArray(), 3, "FPKG".toCharArray()));
+ // with start and stop codon3
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttcccaaagggtga".toCharArray(), 3, "FPKG".toCharArray()));
+
+ // with embedded stop codon
+ assertTrue(AlignmentUtils.translatesAs(
+ "atgtttTAGcccaaaTAAgggtga".toCharArray(), 3,
+ "F*PK*G".toCharArray()));
+
+ // wrong protein
+ assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
+ 0, "FPMG".toCharArray()));
+ }
+
+ /**
+ * Test mapping of protein to cDNA, for cases where the cDNA has start and/or
+ * stop codons in addition to the protein coding sequence.
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_withStartAndStopCodons()
+ throws IOException
+ {
+ List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
+ AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
+ protein.setDataset(null);
+
+ List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ // start + SAR:
+ dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC"));
+ // = EIQ + stop
+ dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAATAA"));
+ // = start +EIQ + stop
+ dnaseqs.add(new Sequence("EMBL|A33333", "ATGGAAATCCAGTAG"));
+ dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG"));
+ AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
+ cdna.setDataset(null);
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
+
+ // 3 mappings made, each from 1 to 1 sequence
+ assertEquals(3, protein.getCodonFrames().size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
+
+ // V12345 mapped from A22222
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ Mapping[] protMappings = acf.getProtMappings();
+ assertEquals(1, protMappings.length);
+ MapList mapList = protMappings[0].getMap();
+ assertEquals(3, mapList.getFromRatio());
+ assertEquals(1, mapList.getToRatio());
+ assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
+ .get(0)));
+ assertEquals(1, mapList.getFromRanges().size());
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
+ assertEquals(1, mapList.getToRanges().size());
+
+ // V12346 mapped from A33333 starting position 4
+ acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ protMappings = acf.getProtMappings();
+ assertEquals(1, protMappings.length);
+ mapList = protMappings[0].getMap();
+ assertEquals(3, mapList.getFromRatio());
+ assertEquals(1, mapList.getToRatio());
+ assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
+ .get(0)));
+ assertEquals(1, mapList.getFromRanges().size());
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
+ assertEquals(1, mapList.getToRanges().size());
+
+ // V12347 mapped to A11111 starting position 4
+ acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ protMappings = acf.getProtMappings();
+ assertEquals(1, protMappings.length);
+ mapList = protMappings[0].getMap();
+ assertEquals(3, mapList.getFromRatio());
+ assertEquals(1, mapList.getToRatio());
+ assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
+ .get(0)));
+ assertEquals(1, mapList.getFromRanges().size());
+ assertTrue(Arrays.equals(new int[] { 1, 3 },
+ mapList.getToRanges().get(0)));
+ assertEquals(1, mapList.getToRanges().size());
+
+ // no mapping involving the 'extra' A44444
+ assertTrue(protein.getCodonFrame(cdna.getSequenceAt(3)).isEmpty());
+ }
+
+ /**
+ * Test mapping of protein to cDNA, for the case where we have some sequence
+ * cross-references. Verify that 1-to-many mappings are made where
+ * cross-references exist and sequences are mappable.
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_withXrefs() throws IOException
+ {
+ List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
+ AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
+ protein.setDataset(null);
+
+ List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
+ dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ
+ dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
+ dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG")); // = EIQ
+ dnaseqs.add(new Sequence("EMBL|A55555", "GAGATTCAG")); // = EIQ
+ AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[5]));
+ cdna.setDataset(null);
+
+ // Xref A22222 to V12345 (should get mapped)
+ dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
+ // Xref V12345 to A44444 (should get mapped)
+ protseqs.get(0).addDBRef(new DBRefEntry("EMBL", "1", "A44444"));
+ // Xref A33333 to V12347 (sequence mismatch - should not get mapped)
+ dnaseqs.get(2).addDBRef(new DBRefEntry("UNIPROT", "1", "V12347"));
+ // as V12345 is mapped to A22222 and A44444, this leaves V12346 unmapped.
+ // it should get paired up with the unmapped A33333
+ // A11111 should be mapped to V12347
+ // A55555 is spare and has no xref so is not mapped
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
+
+ // 4 protein mappings made for 3 proteins, 2 to V12345, 1 each to V12346/7
+ assertEquals(3, protein.getCodonFrames().size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
+
+ // one mapping for each of the first 4 cDNA sequences
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(2)).size());
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(3)).size());
+
+ // V12345 mapped to A22222 and A44444
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
+ assertEquals(2, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ assertEquals(cdna.getSequenceAt(3).getDatasetSequence(),
+ acf.getdnaSeqs()[1]);
+
+ // V12346 mapped to A33333
+ acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+
+ // V12347 mapped to A11111
+ acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+
+ // no mapping involving the 'extra' A55555
+ assertTrue(protein.getCodonFrame(cdna.getSequenceAt(4)).isEmpty());
+ }
+
+ /**
+ * Test mapping of protein to cDNA, for the case where we have some sequence
+ * cross-references. Verify that once we have made an xref mapping we don't
+ * also map un-xrefd sequeces.
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinAlignmentToCdna_prioritiseXrefs()
+ throws IOException
+ {
+ List<SequenceI> protseqs = new ArrayList<SequenceI>();
+ protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
+ protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
+ AlignmentI protein = new Alignment(
+ protseqs.toArray(new SequenceI[protseqs.size()]));
+ protein.setDataset(null);
+
+ List<SequenceI> dnaseqs = new ArrayList<SequenceI>();
+ dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ
+ dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ
+ AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs
+ .size()]));
+ cdna.setDataset(null);
+
+ // Xref A22222 to V12345 (should get mapped)
+ // A11111 should then be mapped to the unmapped V12346
+ dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
+
+ assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
+
+ // 2 protein mappings made
+ assertEquals(2, protein.getCodonFrames().size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
+
+ // one mapping for each of the cDNA sequences
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(0)).size());
+ assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
+
+ // V12345 mapped to A22222
+ AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
+ .get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+
+ // V12346 mapped to A11111
+ acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
+ assertEquals(1, acf.getdnaSeqs().length);
+ assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
+ acf.getdnaSeqs()[0]);
+ }
+
+ /**
+ * Test the method that shows or hides sequence annotations by type(s) and
+ * selection group.
+ */
+ @Test(groups = { "Functional" })
+ public void testShowOrHideSequenceAnnotations()
+ {
+ SequenceI seq1 = new Sequence("Seq1", "AAA");
+ SequenceI seq2 = new Sequence("Seq2", "BBB");
+ SequenceI seq3 = new Sequence("Seq3", "CCC");
+ Annotation[] anns = new Annotation[] { new Annotation(2f) };
+ AlignmentAnnotation ann1 = new AlignmentAnnotation("Structure", "ann1",
+ anns);
+ ann1.setSequenceRef(seq1);
+ AlignmentAnnotation ann2 = new AlignmentAnnotation("Structure", "ann2",
+ anns);
+ ann2.setSequenceRef(seq2);
+ AlignmentAnnotation ann3 = new AlignmentAnnotation("Structure", "ann3",
+ anns);
+ AlignmentAnnotation ann4 = new AlignmentAnnotation("Temp", "ann4", anns);
+ ann4.setSequenceRef(seq1);
+ AlignmentAnnotation ann5 = new AlignmentAnnotation("Temp", "ann5", anns);
+ ann5.setSequenceRef(seq2);
+ AlignmentAnnotation ann6 = new AlignmentAnnotation("Temp", "ann6", anns);
+ AlignmentI al = new Alignment(new SequenceI[] { seq1, seq2, seq3 });
+ al.addAnnotation(ann1); // Structure for Seq1
+ al.addAnnotation(ann2); // Structure for Seq2
+ al.addAnnotation(ann3); // Structure for no sequence
+ al.addAnnotation(ann4); // Temp for seq1
+ al.addAnnotation(ann5); // Temp for seq2
+ al.addAnnotation(ann6); // Temp for no sequence
+ List<String> types = new ArrayList<String>();
+ List<SequenceI> scope = new ArrayList<SequenceI>();
+
+ /*
+ * Set all sequence related Structure to hidden (ann1, ann2)
+ */
+ types.add("Structure");
+ AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, false,
+ false);
+ assertFalse(ann1.visible);
+ assertFalse(ann2.visible);
+ assertTrue(ann3.visible); // not sequence-related, not affected
+ assertTrue(ann4.visible); // not Structure, not affected
+ assertTrue(ann5.visible); // "
+ assertTrue(ann6.visible); // not sequence-related, not affected
+
+ /*
+ * Set Temp in {seq1, seq3} to hidden
+ */
+ types.clear();
+ types.add("Temp");
+ scope.add(seq1);
+ scope.add(seq3);
+ AlignmentUtils.showOrHideSequenceAnnotations(al, types, scope, false,
+ false);
+ assertFalse(ann1.visible); // unchanged
+ assertFalse(ann2.visible); // unchanged
+ assertTrue(ann3.visible); // not sequence-related, not affected
+ assertFalse(ann4.visible); // Temp for seq1 hidden
+ assertTrue(ann5.visible); // not in scope, not affected
+ assertTrue(ann6.visible); // not sequence-related, not affected
+
+ /*
+ * Set Temp in all sequences to hidden
+ */
+ types.clear();
+ types.add("Temp");
+ scope.add(seq1);
+ scope.add(seq3);
+ AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, false,
+ false);
+ assertFalse(ann1.visible); // unchanged
+ assertFalse(ann2.visible); // unchanged
+ assertTrue(ann3.visible); // not sequence-related, not affected
+ assertFalse(ann4.visible); // Temp for seq1 hidden
+ assertFalse(ann5.visible); // Temp for seq2 hidden
+ assertTrue(ann6.visible); // not sequence-related, not affected
+
+ /*
+ * Set all types in {seq1, seq3} to visible
+ */
+ types.clear();
+ scope.clear();
+ scope.add(seq1);
+ scope.add(seq3);
+ AlignmentUtils.showOrHideSequenceAnnotations(al, types, scope, true,
+ true);
+ assertTrue(ann1.visible); // Structure for seq1 set visible
+ assertFalse(ann2.visible); // not in scope, unchanged
+ assertTrue(ann3.visible); // not sequence-related, not affected
+ assertTrue(ann4.visible); // Temp for seq1 set visible
+ assertFalse(ann5.visible); // not in scope, unchanged
+ assertTrue(ann6.visible); // not sequence-related, not affected
+
+ /*
+ * Set all types in all scope to hidden
+ */
+ AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, true,
+ false);
+ assertFalse(ann1.visible);
+ assertFalse(ann2.visible);
+ assertTrue(ann3.visible); // not sequence-related, not affected
+ assertFalse(ann4.visible);
+ assertFalse(ann5.visible);
+ assertTrue(ann6.visible); // not sequence-related, not affected
+ }
+
+ /**
+ * Tests for the method that checks if one sequence cross-references another
+ */
+ @Test(groups = { "Functional" })
+ public void testHasCrossRef()
+ {
+ assertFalse(AlignmentUtils.hasCrossRef(null, null));
+ SequenceI seq1 = new Sequence("EMBL|A12345", "ABCDEF");
+ assertFalse(AlignmentUtils.hasCrossRef(seq1, null));
+ assertFalse(AlignmentUtils.hasCrossRef(null, seq1));
+ SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
+ assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
+
+ // different ref
+ seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20193"));
+ assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
+
+ // case-insensitive; version number is ignored
+ seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20192"));
+ assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
+
+ // right case!
+ seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
+ assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
+ // test is one-way only
+ assertFalse(AlignmentUtils.hasCrossRef(seq2, seq1));
+ }
+
+ /**
+ * Tests for the method that checks if either sequence cross-references the
+ * other
+ */
+ @Test(groups = { "Functional" })
+ public void testHaveCrossRef()
+ {
+ assertFalse(AlignmentUtils.hasCrossRef(null, null));
+ SequenceI seq1 = new Sequence("EMBL|A12345", "ABCDEF");
+ assertFalse(AlignmentUtils.haveCrossRef(seq1, null));
+ assertFalse(AlignmentUtils.haveCrossRef(null, seq1));
+ SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
+ assertFalse(AlignmentUtils.haveCrossRef(seq1, seq2));
+
+ seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
+ assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
+ // next is true for haveCrossRef, false for hasCrossRef
+ assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
+
+ // now the other way round
+ seq1.setDBRefs(null);
+ seq2.addDBRef(new DBRefEntry("EMBL", "1", "A12345"));
+ assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
+ assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
+
+ // now both ways
+ seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
+ assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
+ assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
+ }
+
+ /**
+ * Test the method that extracts the cds-only part of a dna alignment.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC");
+ SequenceI pep1 = new Sequence("pep1", "GF");
+ SequenceI pep2 = new Sequence("pep2", "GFP");
+ dna1.createDatasetSequence();
+ dna2.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds5", 13, 15, 0f,
+ null));
+
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+ map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 },
+ 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
+ dna1, dna2 }, mappings, '-');
+ assertEquals(2, cds.getSequences().size());
+ assertEquals("---GGG---TTT---", cds.getSequenceAt(0)
+ .getSequenceAsString());
+ assertEquals("GGG---TTT---CCC", cds.getSequenceAt(1)
+ .getSequenceAsString());
+
+ /*
+ * Verify updated mappings
+ */
+ assertEquals(2, mappings.size());
+
+ /*
+ * Mapping from pep1 to GGGTTT in first new exon sequence
+ */
+ List<AlignedCodonFrame> pep1Mapping = MappingUtils
+ .findMappingsForSequence(pep1, mappings);
+ assertEquals(1, pep1Mapping.size());
+ // map G to GGG
+ SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ Match m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+
+ /*
+ * Mapping from pep2 to GGGTTTCCC in second new exon sequence
+ */
+ List<AlignedCodonFrame> pep2Mapping = MappingUtils
+ .findMappingsForSequence(pep2, mappings);
+ assertEquals(1, pep2Mapping.size());
+ // map G to GGG
+ sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ // map F to TTT
+ sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ // map P to CCC
+ sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
+ m = sr.getResults().get(0);
+ assertSame(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ }
+
+ /**
+ * Test the method that makes a cds-only sequence from a DNA sequence and its
+ * product mapping. Test includes the expected case that the DNA sequence
+ * already has a protein product (Uniprot translation) which in turn has an
+ * x-ref to the EMBLCDS record.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsSequences()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI pep1 = new Sequence("pep1", "GF");
+ dna1.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep1.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "2", "A12345"));
+
+ /*
+ * Make the mapping from dna to protein. The protein sequence has a DBRef to
+ * EMBLCDS|A12345.
+ */
+ Set<AlignedCodonFrame> mappings = new HashSet<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignedCodonFrame newMapping = new AlignedCodonFrame();
+ List<int[]> ungappedColumns = new ArrayList<int[]>();
+ ungappedColumns.add(new int[] { 4, 6 });
+ ungappedColumns.add(new int[] { 10, 12 });
+ List<SequenceI> cdsSeqs = AlignmentUtils.makeCdsSequences(dna1, acf,
+ ungappedColumns,
+ newMapping, '-');
+ assertEquals(1, cdsSeqs.size());
+ SequenceI cdsSeq = cdsSeqs.get(0);
+
+ assertEquals("GGGTTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12345", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("2", cdsRef.getVersion());
+ assertEquals("A12345", cdsRef.getAccessionId());
+ }
+
+ /**
+ * Test the method that makes a cds-only alignment from a DNA sequence and its
+ * product mappings, for the case where there are multiple exon mappings to
+ * different protein products.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment_multipleProteins()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
+ SequenceI pep1 = new Sequence("pep1", "GF"); // GGGTTT
+ SequenceI pep2 = new Sequence("pep2", "KP"); // aaaccc
+ SequenceI pep3 = new Sequence("pep3", "KF"); // aaaTTT
+ dna1.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds5", 1, 3, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds6", 10, 12, 0f,
+ null));
+ pep1.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "2", "A12345"));
+ pep2.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "3", "A12346"));
+ pep3.getDatasetSequence().addDBRef(
+ new DBRefEntry("EMBLCDS", "4", "A12347"));
+
+ /*
+ * Make the mappings from dna to protein
+ */
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ // map ...GGG...TTT to GF
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 2 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ // map aaa...ccc to KP
+ map = new MapList(new int[] { 1, 3, 7, 9 }, new int[] { 1, 2 }, 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ // map aaa......TTT to KF
+ map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 2 }, 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ /*
+ * Create the Exon alignment; also replaces the dna-to-protein mappings with
+ * exon-to-protein and exon-to-dna mappings
+ */
+ AlignmentI exal = AlignmentUtils.makeCdsAlignment(
+ new SequenceI[] { dna1 }, mappings, '-');
+
+ /*
+ * Verify we have 3 cds sequences, mapped to pep1/2/3 respectively
+ */
+ List<SequenceI> cds = exal.getSequences();
+ assertEquals(3, cds.size());
+
+ SequenceI cdsSeq = cds.get(0);
+ assertEquals("---GGG---TTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12345", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("2", cdsRef.getVersion());
+ assertEquals("A12345", cdsRef.getAccessionId());
+
+ cdsSeq = cds.get(1);
+ assertEquals("aaa---ccc---", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12346", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("3", cdsRef.getVersion());
+ assertEquals("A12346", cdsRef.getAccessionId());
+
+ cdsSeq = cds.get(2);
+ assertEquals("aaa------TTT", cdsSeq.getSequenceAsString());
+ assertEquals("dna1|A12347", cdsSeq.getName());
+ assertEquals(1, cdsSeq.getDBRefs().length);
+ cdsRef = cdsSeq.getDBRefs()[0];
+ assertEquals("EMBLCDS", cdsRef.getSource());
+ assertEquals("4", cdsRef.getVersion());
+ assertEquals("A12347", cdsRef.getAccessionId());
+
+ /*
+ * Verify there are mappings from each cds sequence to its protein product
+ * and also to its dna source
+ */
+ Iterator<AlignedCodonFrame> newMappingsIterator = mappings.iterator();
+
+ // mappings for dna1 - exon1 - pep1
+ AlignedCodonFrame cdsMapping = newMappingsIterator.next();
+ List<Mapping> dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(0).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("G(1) in CDS should map to G(4) in DNA", 4, dnaMappings
+ .get(0).getMap().getToPosition(1));
+ List<Mapping> peptideMappings = cdsMapping
+ .getMappingsForSequence(pep1);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep1.getDatasetSequence(), peptideMappings.get(0).getTo());
+
+ // mappings for dna1 - cds2 - pep2
+ cdsMapping = newMappingsIterator.next();
+ dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(1).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("c(4) in CDS should map to c(7) in DNA", 7, dnaMappings
+ .get(0).getMap().getToPosition(4));
+ peptideMappings = cdsMapping.getMappingsForSequence(pep2);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep2.getDatasetSequence(), peptideMappings.get(0).getTo());
+
+ // mappings for dna1 - cds3 - pep3
+ cdsMapping = newMappingsIterator.next();
+ dnaMappings = cdsMapping.getMappingsForSequence(dna1);
+ assertEquals(1, dnaMappings.size());
+ assertSame(cds.get(2).getDatasetSequence(), dnaMappings.get(0)
+ .getTo());
+ assertEquals("T(4) in CDS should map to T(10) in DNA", 10, dnaMappings
+ .get(0).getMap().getToPosition(4));
+ peptideMappings = cdsMapping.getMappingsForSequence(pep3);
+ assertEquals(1, peptideMappings.size());
+ assertSame(pep3.getDatasetSequence(), peptideMappings.get(0).getTo());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testIsMappable()
+ {
+ SequenceI dna1 = new Sequence("dna1", "cgCAGtgGT");
+ SequenceI aa1 = new Sequence("aa1", "RSG");
+ AlignmentI al1 = new Alignment(new SequenceI[] { dna1 });
+ AlignmentI al2 = new Alignment(new SequenceI[] { aa1 });
+
+ assertFalse(AlignmentUtils.isMappable(null, null));
+ assertFalse(AlignmentUtils.isMappable(al1, null));
+ assertFalse(AlignmentUtils.isMappable(null, al1));
+ assertFalse(AlignmentUtils.isMappable(al1, al1));
+ assertFalse(AlignmentUtils.isMappable(al2, al2));
+
+ assertTrue(AlignmentUtils.isMappable(al1, al2));
+ assertTrue(AlignmentUtils.isMappable(al2, al1));
+ }
+
+ /**
+ * Test creating a mapping when the sequences involved do not start at residue
+ * 1
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapProteinSequenceToCdna_forSubsequence()
+ throws IOException
+ {
+ SequenceI prot = new Sequence("UNIPROT|V12345", "E-I--Q", 10, 12);
+ prot.createDatasetSequence();
+
+ SequenceI dna = new Sequence("EMBL|A33333", "GAA--AT-C-CAG", 40, 48);
+ dna.createDatasetSequence();
+
+ MapList map = AlignmentUtils.mapProteinSequenceToCdna(prot, dna);
+ assertEquals(10, map.getToLowest());
+ assertEquals(12, map.getToHighest());
+ assertEquals(40, map.getFromLowest());
+ assertEquals(48, map.getFromHighest());
+ }
+
+ /**
+ * Test for the alignSequenceAs method where we have protein mapped to protein
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_mappedProteinProtein()
+ {
+
+ SequenceI alignMe = new Sequence("Match", "MGAASEV");
+ alignMe.createDatasetSequence();
+ SequenceI alignFrom = new Sequence("Query", "LQTGYMGAASEVMFSPTRR");
+ alignFrom.createDatasetSequence();
+
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ // this is like a domain or motif match of part of a peptide sequence
+ MapList map = new MapList(new int[] { 6, 12 }, new int[] { 1, 7 }, 1, 1);
+ acf.addMap(alignFrom.getDatasetSequence(),
+ alignMe.getDatasetSequence(), map);
+
+ AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "-", '-', true,
+ true);
+ assertEquals("-----MGAASEV-------", alignMe.getSequenceAsString());
+ }
+
+ /**
+ * Test for the alignSequenceAs method where there are trailing unmapped
+ * residues in the model sequence
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignSequenceAs_withTrailingPeptide()
+ {
+ // map first 3 codons to KPF; G is a trailing unmapped residue
+ MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
+
+ checkAlignSequenceAs("AAACCCTTT", "K-PFG", true, true, map,
+ "AAA---CCCTTT---");
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ // no overlap
+ dna.addSequenceFeature(new SequenceFeature("type1", "desc1", 1, 2, 1f,
+ null));
+ // partial overlap - to [1, 1]
+ dna.addSequenceFeature(new SequenceFeature("type2", "desc2", 3, 4, 2f,
+ null));
+ // exact overlap - to [1, 3]
+ dna.addSequenceFeature(new SequenceFeature("type3", "desc3", 4, 6, 3f,
+ null));
+ // spanning overlap - to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // exactly overlaps whole mapped range [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // no overlap (internal)
+ dna.addSequenceFeature(new SequenceFeature("type6", "desc6", 7, 9, 6f,
+ null));
+ // no overlap (3' end)
+ dna.addSequenceFeature(new SequenceFeature("type7", "desc7", 13, 15,
+ 7f, null));
+ // overlap (3' end) - to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+ // extended overlap - to [6, +]
+ dna.addSequenceFeature(new SequenceFeature("type9", "desc9", 12, 13,
+ 9f, null));
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ /*
+ * transferFeatures() will build 'partial overlap' for regions
+ * that partially overlap 5' or 3' (start or end) of target sequence
+ */
+ AlignmentUtils.transferFeatures(dna, cds, map, null);
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(6, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type2", sf.getType());
+ assertEquals("desc2", sf.getDescription());
+ assertEquals(2f, sf.getScore());
+ assertEquals(1, sf.getBegin());
+ assertEquals(1, sf.getEnd());
+
+ sf = sfs[1];
+ assertEquals("type3", sf.getType());
+ assertEquals("desc3", sf.getDescription());
+ assertEquals(3f, sf.getScore());
+ assertEquals(1, sf.getBegin());
+ assertEquals(3, sf.getEnd());
+
+ sf = sfs[2];
+ assertEquals("type4", sf.getType());
+ assertEquals(2, sf.getBegin());
+ assertEquals(5, sf.getEnd());
+
+ sf = sfs[3];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+
+ sf = sfs[4];
+ assertEquals("type8", sf.getType());
+ assertEquals(6, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+
+ sf = sfs[5];
+ assertEquals("type9", sf.getType());
+ assertEquals(6, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures_withOmit()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ // [5, 11] maps to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // [4, 12] maps to [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // [12, 12] maps to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+
+ // desc4 and desc8 are the 'omit these' varargs
+ AlignmentUtils.transferFeatures(dna, cds, map, null, "type4", "type8");
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Tests for transferring features between mapped sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testTransferFeatures_withSelect()
+ {
+ SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
+ SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
+
+ MapList map = new MapList(new int[] { 4, 6, 10, 12 },
+ new int[] { 1, 6 }, 1, 1);
+
+ // [5, 11] maps to [2, 5]
+ dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
+ null));
+ // [4, 12] maps to [1, 6]
+ dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
+ null));
+ // [12, 12] maps to [6, 6]
+ dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
+ 8f, null));
+
+ // "type5" is the 'select this type' argument
+ AlignmentUtils.transferFeatures(dna, cds, map, "type5");
+ SequenceFeature[] sfs = cds.getSequenceFeatures();
+ assertEquals(1, sfs.length);
+
+ SequenceFeature sf = sfs[0];
+ assertEquals("type5", sf.getType());
+ assertEquals(1, sf.getBegin());
+ assertEquals(6, sf.getEnd());
+ }
+
+ /**
+ * Test the method that extracts the cds-only part of a dna alignment, for the
+ * case where the cds should be aligned to match its nucleotide sequence.
+ */
+ @Test(groups = { "Functional" })
+ public void testMakeCdsAlignment_alternativeTranscripts()
+ {
+ SequenceI dna1 = new Sequence("dna1", "aaaGGGCC-----CTTTaaaGGG");
+ // alternative transcript of same dna skips CCC codon
+ SequenceI dna2 = new Sequence("dna2", "aaaGGGCC-----cttTaaaGGG");
+ // dna3 has no mapping (protein product) so should be ignored here
+ SequenceI dna3 = new Sequence("dna3", "aaaGGGCCCCCGGGcttTaaaGGG");
+ SequenceI pep1 = new Sequence("pep1", "GPFG");
+ SequenceI pep2 = new Sequence("pep2", "GPG");
+ dna1.createDatasetSequence();
+ dna2.createDatasetSequence();
+ dna3.createDatasetSequence();
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 8, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 9, 12, 0f,
+ null));
+ dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 16, 18, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 4, 8, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
+ null));
+ dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 16, 18, 0f,
+ null));
+
+ List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ MapList map = new MapList(new int[] { 4, 12, 16, 18 },
+ new int[] { 1, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
+ mappings.add(acf);
+ map = new MapList(new int[] { 4, 8, 12, 12, 16, 18 },
+ new int[] { 1, 3 },
+ 3, 1);
+ acf = new AlignedCodonFrame();
+ acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
+ mappings.add(acf);
+
+ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
+ dna1, dna2, dna3 }, mappings, '-');
+ assertEquals(2, cds.getSequences().size());
+ assertEquals("GGGCCCTTTGGG", cds.getSequenceAt(0).getSequenceAsString());
+ assertEquals("GGGCC---TGGG", cds.getSequenceAt(1).getSequenceAsString());
+
+ /*
+ * Verify updated mappings
+ */
+ assertEquals(2, mappings.size());
+
+ /*
+ * Mapping from pep1 to GGGTTT in first new CDS sequence
+ */
+ List<AlignedCodonFrame> pep1Mapping = MappingUtils
+ .findMappingsForSequence(pep1, mappings);
+ assertEquals(1, pep1Mapping.size());
+ /*
+ * maps GPFG to 1-3,4-6,7-9,10-12
+ */
+ SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ Match m = sr.getResults().get(0);
+ assertEquals(cds.getSequenceAt(0).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 3, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep1, 4, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(10, m.getStart());
+ assertEquals(12, m.getEnd());
+
+ /*
+ * GPG in pep2 map to 1-3,4-6,7-9 in second CDS sequence
+ */
+ List<AlignedCodonFrame> pep2Mapping = MappingUtils
+ .findMappingsForSequence(pep2, mappings);
+ assertEquals(1, pep2Mapping.size());
+ sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
+ assertEquals(1, sr.getResults().size());
+ m = sr.getResults().get(0);
+ assertEquals(cds.getSequenceAt(1).getDatasetSequence(),
+ m.getSequence());
+ assertEquals(1, m.getStart());
+ assertEquals(3, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(4, m.getStart());
+ assertEquals(6, m.getEnd());
+ sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
+ m = sr.getResults().get(0);
+ assertEquals(7, m.getStart());
+ assertEquals(9, m.getEnd());
+ }
+
+ /**
+ * Tests for gapped column in sequences
+ */
+ @Test(groups = { "Functional" })
+ public void testIsGappedColumn()
+ {
+ SequenceI seq1 = new Sequence("Seq1", "a--c.tc-a-g");
+ SequenceI seq2 = new Sequence("Seq2", "aa---t--a-g");
+ SequenceI seq3 = new Sequence("Seq3", "ag-c t-g-");
+ List<SequenceI> seqs = Arrays
+ .asList(new SequenceI[] { seq1, seq2, seq3 });
+ // the column number is base 1
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 1));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 2));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 3));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 4));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 5));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 6));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 7));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 8));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 9));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 10));
+ assertFalse(AlignmentUtils.isGappedColumn(seqs, 11));
+ // out of bounds:
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 0));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, 100));
+ assertTrue(AlignmentUtils.isGappedColumn(seqs, -100));
+ assertTrue(AlignmentUtils.isGappedColumn(null, 0));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindCdsColumns()
+ {
+ // TODO target method belongs in a general-purpose alignment
+ // analysis method to find columns for feature
+
+ /*
+ * NB this method assumes CDS ranges are contiguous (no introns)
+ */
+ SequenceI gene = new Sequence("gene", "aaacccgggtttaaacccgggttt");
+ SequenceI seq1 = new Sequence("Seq1", "--ac-cgGG-GGaaACC--GGtt-");
+ SequenceI seq2 = new Sequence("Seq2", "AA--CCGG--g-AAA--cG-GTTt");
+ seq1.createDatasetSequence();
+ seq2.createDatasetSequence();
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 5, 6, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 7, 8, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 11, 13, 0f,
+ null));
+ seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 14, 15, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 1, 2, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 3, 6, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 8, 10, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
+ null));
+ seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 13, 15, 0f,
+ null));
+
+ List<int[]> cdsColumns = AlignmentUtils.findCdsColumns(new SequenceI[] {
+ seq1, seq2 });
+ assertEquals(4, cdsColumns.size());
+ assertEquals("[1, 2]", Arrays.toString(cdsColumns.get(0)));
+ assertEquals("[5, 9]", Arrays.toString(cdsColumns.get(1)));
+ assertEquals("[11, 17]", Arrays.toString(cdsColumns.get(2)));
+ assertEquals("[19, 23]", Arrays.toString(cdsColumns.get(3)));
+ }
+
+ /**
+ * Test the method that realigns protein to match mapped codon alignment.
+ */
+ @Test(groups = { "Functional" })
+ public void testAlignProteinAsDna_incompleteStartCodon()
+ {
+ // seq1: incomplete start codon (not mapped), then [3, 11]
+ SequenceI dna1 = new Sequence("Seq1", "ccAAA-TTT-GGG-");
+ // seq2 codons are [4, 5], [8, 11]
+ SequenceI dna2 = new Sequence("Seq2", "ccaAA-ttT-GGG-");
+ // seq3 incomplete start codon at 'tt'
+ SequenceI dna3 = new Sequence("Seq3", "ccaaa-ttt-GGG-");
+ AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
+ dna.setDataset(null);
+
+ // prot1 has 'X' for incomplete start codon (not mapped)
+ SequenceI prot1 = new Sequence("Seq1", "XKFG"); // X for incomplete start
+ SequenceI prot2 = new Sequence("Seq2", "NG");
+ SequenceI prot3 = new Sequence("Seq3", "XG"); // X for incomplete start
+ AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
+ prot3 });
+ protein.setDataset(null);
+
+ // map dna1 [3, 11] to prot1 [2, 4] KFG
+ MapList map = new MapList(new int[] { 3, 11 }, new int[] { 2, 4 }, 3, 1);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
+
+ // map dna2 [4, 5] [8, 11] to prot2 [1, 2] NG
+ map = new MapList(new int[] { 4, 5, 8, 11 }, new int[] { 1, 2 }, 3, 1);
+ acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
+
+ // map dna3 [9, 11] to prot3 [2, 2] G
+ map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1);
+ acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
+
+ ArrayList<AlignedCodonFrame> acfs = new ArrayList<AlignedCodonFrame>();
+ acfs.add(acf);
+ protein.setCodonFrames(acfs);
+
+ /*
+ * verify X is included in the aligned proteins, and placed just
+ * before the first mapped residue
+ * CCT is between CCC and TTT
+ */
+ AlignmentUtils.alignProteinAsDna(protein, dna);
+ assertEquals("XK-FG", prot1.getSequenceAsString());
+ assertEquals("--N-G", prot2.getSequenceAsString());
+ assertEquals("---XG", prot3.getSequenceAsString());
}
}