/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.1)
- * Copyright (C) 2014 The Jalview Authors
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
- * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.analysis;
+ "GCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAAATCATTATATAATACAGTAGCAACCCTCTATTG\n"
+ "TGTACATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGAA\n";
-
@Test
public void translationWithUntranslatableCodonsTest()
{
jalview.datamodel.AlignmentI alf = null;
try
{
- alf = new jalview.io.FormatAdapter().readFile(JAL_1312_example_align_fasta,
- jalview.io.FormatAdapter.PASTE, "FASTA");
+ alf = new jalview.io.FormatAdapter().readFile(
+ JAL_1312_example_align_fasta, jalview.io.FormatAdapter.PASTE,
+ "FASTA");
} catch (IOException x)
{
x.printStackTrace();