import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
import jalview.datamodel.PDBEntry.Type;
+import jalview.gui.JvOptionPane;
+import jalview.util.MapList;
+import java.io.File;
+import java.util.ArrayList;
import java.util.Arrays;
+import java.util.BitSet;
import java.util.List;
import java.util.Vector;
+import org.testng.Assert;
+import org.testng.annotations.BeforeClass;
import org.testng.annotations.BeforeMethod;
import org.testng.annotations.Test;
public class SequenceTest
{
+
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
Sequence seq;
@BeforeMethod(alwaysRun = true)
assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
+
+ BitSet gapfield = aseq.getInsertionsAsBits();
+ BitSet expectedgaps = new BitSet();
+ expectedgaps.set(2, 4);
+ expectedgaps.set(6, 8);
+
+ assertEquals("getInsertionsAsBits not correct.", expectedgaps, gapfield);
+ }
+
+ @Test(groups = ("Functional"))
+ public void testIsProtein()
+ {
+ // test Protein
+ assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
+ // test DNA
+ assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
+ // test RNA
+ SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
+ assertFalse(sq.isProtein());
+ // change sequence, should trigger an update of cached result
+ sq.setSequence("ASDFASDFADSF");
+ assertTrue(sq.isProtein());
+ /*
+ * in situ change of sequence doesn't change hashcode :-O
+ * (sequence should not expose internal implementation)
+ */
+ for (int i = 0; i < sq.getSequence().length; i++)
+ {
+ sq.getSequence()[i] = "acgtu".charAt(i % 5);
+ }
+ assertTrue(sq.isProtein()); // but it isn't
}
@Test(groups = { "Functional" })
{
AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
1f);
- AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
- 1f);
+ addAnnotation("label2", "desc2", "calcId2", 1f);
AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
1f);
AlignmentAnnotation[] anns = seq.getAnnotation("label1");
@Test(groups = { "Functional" })
public void testGetAlignmentAnnotations_forCalcIdAndLabel()
{
- AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
- 1f);
+ addAnnotation("label1", "desc1", "calcId1", 1f);
AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
1f);
- AlignmentAnnotation ann3 = addAnnotation("label2", "desc3", "calcId3",
- 1f);
+ addAnnotation("label2", "desc3", "calcId3", 1f);
AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
1f);
- AlignmentAnnotation ann5 = addAnnotation("label5", "desc3", null, 1f);
- AlignmentAnnotation ann6 = addAnnotation(null, "desc3", "calcId3", 1f);
+ addAnnotation("label5", "desc3", null, 1f);
+ addAnnotation(null, "desc3", "calcId3", 1f);
+
List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
"label2");
assertEquals(2, anns.size());
/*
* SequenceFeature on sequence and dataset sequence; returns that on
* sequence
+ *
+ * Note JAL-2046: spurious: we have no use case for this at the moment.
+ * This test also buggy - as sf2.equals(sf), no new feature is added
*/
SequenceFeature sf2 = new SequenceFeature();
sq.getDatasetSequence().addSequenceFeature(sf2);
/*
* SequenceFeature on dataset sequence only
+ * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
*/
sq.setSequenceFeatures(null);
- sfs = sq.getSequenceFeatures();
- assertEquals(1, sfs.length);
- assertSame(sf2, sfs[0]);
+ assertNull(sq.getDatasetSequence().getSequenceFeatures());
/*
* Corrupt case - no SequenceFeature, dataset's dataset is the original
* sequence. Test shows no infinite loop results.
*/
sq.getDatasetSequence().setSequenceFeatures(null);
- sq.getDatasetSequence().setDatasetSequence(sq); // loop!
+ /**
+ * is there a usecase for this ? setDatasetSequence should throw an error if
+ * this actually occurs.
+ */
+ try
+ {
+ sq.getDatasetSequence().setDatasetSequence(sq); // loop!
+ Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference");
+ } catch (IllegalArgumentException e)
+ {
+ // TODO Jalview error/exception class for raising implementation errors
+ assertTrue(e.getMessage().toLowerCase()
+ .contains("implementation error"));
+ }
assertNull(sq.getSequenceFeatures());
}
}
/**
+ * test createDatasetSequence behaves to doc
+ */
+ @Test(groups = { "Functional" })
+ public void testCreateDatasetSequence()
+ {
+ SequenceI sq = new Sequence("my", "ASDASD");
+ assertNull(sq.getDatasetSequence());
+ SequenceI rds = sq.createDatasetSequence();
+ assertNotNull(rds);
+ assertNull(rds.getDatasetSequence());
+ assertEquals(sq.getDatasetSequence(), rds);
+ }
+
+ /**
* Test for deriveSequence applied to a sequence with a dataset
*/
@Test(groups = { "Functional" })
sq.setStart(3);
sq.setEnd(4);
+ sq.setDescription("Test sequence description..");
+ sq.setVamsasId("TestVamsasId");
+ sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
+
+ sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
+
+ sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
+ sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
+
+ // these are the same as ones already added
+ DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
+ DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
+
+ List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
+ pdb2pdb });
+
+ sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
+ sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing
+
+ PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
+ PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
+ PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
+ "filePath/test2");
+ PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
+ "filePath/test2");
+ sq.getDatasetSequence().addPDBId(pdbe1a);
+ sq.getDatasetSequence().addPDBId(pdbe1b);
+ sq.getDatasetSequence().addPDBId(pdbe2a);
+ sq.getDatasetSequence().addPDBId(pdbe2b);
+
+ /*
+ * test we added pdb entries to the dataset sequence
+ */
+ Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays
+ .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
+ "PDB Entries were not found on dataset sequence.");
+
+ /*
+ * we should recover a pdb entry that is on the dataset sequence via PDBEntry
+ */
+ Assert.assertEquals(pdbe1a,
+ sq.getDatasetSequence().getPDBEntry("1PDB"),
+ "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
+ ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
+ System.out.println(">>>>>> " + sq.getSequenceAsString().length());
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ Annotation[] annots = annotsList.toArray(new Annotation[0]);
+ sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
+ "Test annot description", annots));
+ sq.getDatasetSequence().addAlignmentAnnotation(
+ new AlignmentAnnotation("Test annot", "Test annot description",
+ annots));
+ Assert.assertEquals(sq.getDescription(), "Test sequence description..");
+ Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset
+ // sequence
+ Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(sq.getAnnotation());
+ Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same
+ // as
+ // sq.getDBRefs()
+ Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
+ 4);
+ Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
+
Sequence derived = (Sequence) sq.deriveSequence();
+
+ Assert.assertEquals(derived.getDescription(),
+ "Test sequence description..");
+ Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset
+ Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(derived.getAnnotation());
+ Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5);
+ Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
+ .size(), 4);
+ Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
+
assertEquals("CD", derived.getSequenceAsString());
assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
assertNull(sq.sequenceFeatures);
- // assertNull(derived.sequenceFeatures);
+ assertNull(derived.sequenceFeatures);
+ // derived sequence should access dataset sequence features
assertNotNull(sq.getSequenceFeatures());
- // derived sequence has a copy of the sequence features (is this right?)
assertArrayEquals(sq.getSequenceFeatures(),
derived.getSequenceFeatures());
+
+ /*
+ * verify we have primary db refs *just* for PDB IDs with associated
+ * PDBEntry objects
+ */
+
+ assertEquals(primRefs, sq.getPrimaryDBRefs());
+ assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
+
+ assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
+
}
/**
12.4f, "group"));
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
-
+
SequenceI copy = new Sequence(seq1);
assertNull(copy.getDatasetSequence());
seq1.setDescription("description");
seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
1.3d));
+ // JAL-2046 - what is the contract for using a derived sequence's
+ // addSequenceFeature ?
seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
12.4f, "group"));
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
// copy has a copy of the sequence feature:
SequenceFeature[] sfs = copy.getSequenceFeatures();
assertEquals(1, sfs.length);
- assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+ if (seq1.getDatasetSequence() != null
+ && copy.getDatasetSequence() == seq1.getDatasetSequence())
+ {
+ assertTrue(sfs[0] == seq1.getSequenceFeatures()[0]);
+ }
+ else
+ {
+ assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+ }
assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0]));
// copy has a copy of the PDB entry
assertEquals(' ', sq.getCharAt(5));
assertEquals(' ', sq.getCharAt(-1));
}
+
+ /**
+ * Tests for adding (or updating) dbrefs
+ *
+ * @see DBRefEntry#updateFrom(DBRefEntry)
+ */
+ @Test(groups = { "Functional" })
+ public void testAddDBRef()
+ {
+ SequenceI sq = new Sequence("", "abcde");
+ assertNull(sq.getDBRefs());
+ DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
+ sq.addDBRef(dbref);
+ assertEquals(1, sq.getDBRefs().length);
+ assertSame(dbref, sq.getDBRefs()[0]);
+
+ /*
+ * change of version - new entry
+ */
+ DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
+ sq.addDBRef(dbref2);
+ assertEquals(2, sq.getDBRefs().length);
+ assertSame(dbref, sq.getDBRefs()[0]);
+ assertSame(dbref2, sq.getDBRefs()[1]);
+
+ /*
+ * matches existing entry - not added
+ */
+ sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
+ assertEquals(2, sq.getDBRefs().length);
+
+ /*
+ * different source = new entry
+ */
+ DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
+ sq.addDBRef(dbref3);
+ assertEquals(3, sq.getDBRefs().length);
+ assertSame(dbref3, sq.getDBRefs()[2]);
+
+ /*
+ * different ref = new entry
+ */
+ DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
+ sq.addDBRef(dbref4);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref4, sq.getDBRefs()[3]);
+
+ /*
+ * matching ref with a mapping - map updated
+ */
+ DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
+ Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
+ 1, 1 }, 3, 1));
+ dbref5.setMap(map);
+ sq.addDBRef(dbref5);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref4, sq.getDBRefs()[3]);
+ assertSame(map, dbref4.getMap());
+
+ /*
+ * 'real' version replaces "0" version
+ */
+ dbref2.setVersion("0");
+ DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
+ dbref2.getAccessionId());
+ sq.addDBRef(dbref6);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref2, sq.getDBRefs()[1]);
+ assertEquals("3", dbref2.getVersion());
+
+ /*
+ * 'real' version replaces "source:0" version
+ */
+ dbref3.setVersion("Uniprot:0");
+ DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
+ dbref3.getAccessionId());
+ sq.addDBRef(dbref7);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref3, sq.getDBRefs()[2]);
+ assertEquals("3", dbref2.getVersion());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetPrimaryDBRefs_peptide()
+ {
+ SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
+
+ // no dbrefs
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
+ // empty dbrefs
+ sq.setDBRefs(new DBRefEntry[] {});
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
+ // primary - uniprot
+ DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
+ sq.addDBRef(upentry1);
+
+ // primary - uniprot with congruent map
+ DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
+ upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
+ new int[] { 10, 22 }, 1, 1)));
+ sq.addDBRef(upentry2);
+
+ // primary - uniprot with map of enclosing sequence
+ DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
+ upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
+ new int[] { 8, 24 }, 1, 1)));
+ sq.addDBRef(upentry3);
+
+ // not primary - uniprot with map of sub-sequence (5')
+ DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
+ upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
+ new int[] { 10, 18 }, 1, 1)));
+ sq.addDBRef(upentry4);
+
+ // not primary - uniprot with map that overlaps 3'
+ DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
+ upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
+ new int[] { 12, 22 }, 1, 1)));
+ sq.addDBRef(upentry5);
+
+ // not primary - uniprot with map to different coordinates frame
+ DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
+ upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
+ new int[] { 112, 118 }, 1, 1)));
+ sq.addDBRef(upentry6);
+
+ // not primary - dbref to 'non-core' database
+ DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
+ sq.addDBRef(upentry7);
+
+ // primary - type is PDB
+ DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
+ sq.addDBRef(pdbentry);
+
+ // not primary - PDBEntry has no file
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+
+ // not primary - no PDBEntry
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
+
+ // add corroborating PDB entry for primary DBref -
+ // needs to have a file as well as matching ID
+ // note PDB ID is not treated as case sensitive
+ sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
+ .toString()));
+
+ // not valid DBRef - no file..
+ sq.addPDBId(new PDBEntry("1AAA", null, null, null));
+
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(4, primaryDBRefs.size());
+ assertTrue("Couldn't find simple primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry1));
+ assertTrue("Couldn't find mapped primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry2));
+ assertTrue("Couldn't find mapped context reference (UNIPROT)",
+ primaryDBRefs.contains(upentry3));
+ assertTrue("Couldn't find expected PDB primary reference",
+ primaryDBRefs.contains(pdbentry));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetPrimaryDBRefs_nucleotide()
+ {
+ SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
+
+ // primary - Ensembl
+ DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
+ sq.addDBRef(dbr1);
+
+ // not primary - Ensembl 'transcript' mapping of sub-sequence
+ DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
+ dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
+ new int[] { 1, 11 }, 1, 1)));
+ sq.addDBRef(dbr2);
+
+ // primary - EMBL with congruent map
+ DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
+ dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
+ new int[] { 10, 34 }, 1, 1)));
+ sq.addDBRef(dbr3);
+
+ // not primary - to non-core database
+ DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
+ sq.addDBRef(dbr4);
+
+ // not primary - to protein
+ DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
+ sq.addDBRef(dbr5);
+
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(2, primaryDBRefs.size());
+ assertTrue(primaryDBRefs.contains(dbr1));
+ assertTrue(primaryDBRefs.contains(dbr3));
+ }
+
+ /**
+ * Test the method that updates the list of PDBEntry from any new DBRefEntry
+ * for PDB
+ */
+ @Test(groups = { "Functional" })
+ public void testUpdatePDBIds()
+ {
+ PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
+ seq.addPDBId(pdbe1);
+ seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
+ // 7 is not a valid chain code:
+ seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
+
+ seq.updatePDBIds();
+ List<PDBEntry> pdbIds = seq.getAllPDBEntries();
+ assertEquals(4, pdbIds.size());
+ assertSame(pdbe1, pdbIds.get(0));
+ // chain code got added to 3A6S:
+ assertEquals("B", pdbe1.getChainCode());
+ assertEquals("1A70", pdbIds.get(1).getId());
+ // 4BQGA is parsed into id + chain
+ assertEquals("4BQG", pdbIds.get(2).getId());
+ assertEquals("a", pdbIds.get(2).getChainCode());
+ assertEquals("2GIS7", pdbIds.get(3).getId());
+ assertNull(pdbIds.get(3).getChainCode());
+ }
+
+ /**
+ * Test the method that either adds a pdbid or updates an existing one
+ */
+ @Test(groups = { "Functional" })
+ public void testAddPDBId()
+ {
+ PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
+ seq.addPDBId(pdbe);
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+ assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
+
+ // add the same entry
+ seq.addPDBId(pdbe);
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+ // add an identical entry
+ seq.addPDBId(new PDBEntry("3A6S", null, null, null));
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+ // add a different entry
+ PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
+ seq.addPDBId(pdbe2);
+ assertEquals(2, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getAllPDBEntries().get(0));
+ assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+ // update pdbe with chain code, file, type
+ PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
+ seq.addPDBId(pdbe3);
+ assertEquals(2, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
+ assertEquals("3A6S", pdbe.getId()); // unchanged
+ assertEquals("A", pdbe.getChainCode()); // updated
+ assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
+ assertEquals("filepath", pdbe.getFile()); // updated
+ assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+ // add with a different file path
+ PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
+ seq.addPDBId(pdbe4);
+ assertEquals(3, seq.getAllPDBEntries().size());
+ assertSame(pdbe4, seq.getAllPDBEntries().get(2));
+
+ // add with a different chain code
+ PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
+ seq.addPDBId(pdbe5);
+ assertEquals(4, seq.getAllPDBEntries().size());
+ assertSame(pdbe5, seq.getAllPDBEntries().get(3));
+ }
+
+ @Test(
+ groups = { "Functional" },
+ expectedExceptions = { IllegalArgumentException.class })
+ public void testSetDatasetSequence_toSelf()
+ {
+ seq.setDatasetSequence(seq);
+ }
+
+ @Test(
+ groups = { "Functional" },
+ expectedExceptions = { IllegalArgumentException.class })
+ public void testSetDatasetSequence_cascading()
+ {
+ SequenceI seq2 = new Sequence("Seq2", "xyz");
+ seq2.createDatasetSequence();
+ seq.setDatasetSequence(seq2);
+ }
}