import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertNotNull;
+import static org.testng.AssertJUnit.assertNotSame;
import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
-import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
+import jalview.commands.EditCommand;
+import jalview.commands.EditCommand.Action;
import jalview.datamodel.PDBEntry.Type;
+import jalview.gui.JvOptionPane;
+import jalview.util.MapList;
+import java.io.File;
+import java.util.ArrayList;
import java.util.Arrays;
+import java.util.BitSet;
import java.util.List;
import java.util.Vector;
+import junit.extensions.PA;
+
+import org.testng.Assert;
+import org.testng.annotations.BeforeClass;
import org.testng.annotations.BeforeMethod;
import org.testng.annotations.Test;
public class SequenceTest
{
+
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
Sequence seq;
@BeforeMethod(alwaysRun = true)
assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
+
+ BitSet gapfield = aseq.getInsertionsAsBits();
+ BitSet expectedgaps = new BitSet();
+ expectedgaps.set(2, 5);
+ expectedgaps.set(6, 9);
+
+ assertEquals(6, expectedgaps.cardinality());
+
+ assertEquals("getInsertionsAsBits didn't mark expected number of gaps",
+ 6, gapfield.cardinality());
+
+ assertEquals("getInsertionsAsBits not correct.", expectedgaps, gapfield);
+ }
+
+ @Test(groups = ("Functional"))
+ public void testIsProtein()
+ {
+ // test Protein
+ assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
+ // test DNA
+ assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
+ // test RNA
+ SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
+ assertFalse(sq.isProtein());
+ // change sequence, should trigger an update of cached result
+ sq.setSequence("ASDFASDFADSF");
+ assertTrue(sq.isProtein());
}
@Test(groups = { "Functional" })
{
AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
1f);
- AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
- 1f);
+ addAnnotation("label2", "desc2", "calcId2", 1f);
AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
1f);
AlignmentAnnotation[] anns = seq.getAnnotation("label1");
@Test(groups = { "Functional" })
public void testGetAlignmentAnnotations_forCalcIdAndLabel()
{
- AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
- 1f);
+ addAnnotation("label1", "desc1", "calcId1", 1f);
AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
1f);
- AlignmentAnnotation ann3 = addAnnotation("label2", "desc3", "calcId3",
- 1f);
+ addAnnotation("label2", "desc3", "calcId3", 1f);
AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
1f);
- AlignmentAnnotation ann5 = addAnnotation("label5", "desc3", null, 1f);
- AlignmentAnnotation ann6 = addAnnotation(null, "desc3", "calcId3", 1f);
+ addAnnotation("label5", "desc3", null, 1f);
+ addAnnotation(null, "desc3", "calcId3", 1f);
+
List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
"label2");
assertEquals(2, anns.size());
@Test(groups = { "Functional" })
public void testFindIndex()
{
+ /*
+ * call sequenceChanged() after each test to invalidate any cursor,
+ * forcing the 1-arg findIndex to be executed
+ */
SequenceI sq = new Sequence("test", "ABCDEF");
assertEquals(0, sq.findIndex(0));
+ sq.sequenceChanged();
assertEquals(1, sq.findIndex(1));
+ sq.sequenceChanged();
assertEquals(5, sq.findIndex(5));
+ sq.sequenceChanged();
assertEquals(6, sq.findIndex(6));
+ sq.sequenceChanged();
assertEquals(6, sq.findIndex(9));
- sq = new Sequence("test", "-A--B-C-D-E-F--");
- assertEquals(2, sq.findIndex(1));
- assertEquals(5, sq.findIndex(2));
- assertEquals(7, sq.findIndex(3));
+ sq = new Sequence("test/8-13", "-A--B-C-D-E-F--");
+ assertEquals(2, sq.findIndex(8));
+ sq.sequenceChanged();
+ assertEquals(5, sq.findIndex(9));
+ sq.sequenceChanged();
+ assertEquals(7, sq.findIndex(10));
// before start returns 0
+ sq.sequenceChanged();
assertEquals(0, sq.findIndex(0));
+ sq.sequenceChanged();
assertEquals(0, sq.findIndex(-1));
// beyond end returns last residue column
+ sq.sequenceChanged();
assertEquals(13, sq.findIndex(99));
-
}
/**
- * Tests for the method that returns a dataset sequence position (base 1) for
+ * Tests for the method that returns a dataset sequence position (start..) for
* an aligned column position (base 0).
*/
@Test(groups = { "Functional" })
public void testFindPosition()
{
- SequenceI sq = new Sequence("test", "ABCDEF");
- assertEquals(1, sq.findPosition(0));
- assertEquals(6, sq.findPosition(5));
+ /*
+ * call sequenceChanged() after each test to invalidate any cursor,
+ * forcing the 1-arg findPosition to be executed
+ */
+ SequenceI sq = new Sequence("test/8-13", "ABCDEF");
+ assertEquals(8, sq.findPosition(0));
+ // Sequence should now hold a cursor at [8, 0]
+ assertEquals("test:Pos8:Col1:startCol1:endCol0:tok0",
+ PA.getValue(sq, "cursor").toString());
+ SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ int token = (int) PA.getValue(sq, "changeCount");
+ assertEquals(new SequenceCursor(sq, 8, 1, token), cursor);
+
+ sq.sequenceChanged();
+
+ /*
+ * find F13 at column offset 5, cursor should update to [13, 6]
+ * endColumn is found and saved in cursor
+ */
+ assertEquals(13, sq.findPosition(5));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(++token, (int) PA.getValue(sq, "changeCount"));
+ assertEquals(new SequenceCursor(sq, 13, 6, token), cursor);
+ assertEquals("test:Pos13:Col6:startCol1:endCol6:tok1",
+ PA.getValue(sq, "cursor").toString());
+
// assertEquals(-1, seq.findPosition(6)); // fails
- sq = new Sequence("test", "AB-C-D--");
- assertEquals(1, sq.findPosition(0));
- assertEquals(2, sq.findPosition(1));
+ sq = new Sequence("test/8-11", "AB-C-D--");
+ token = (int) PA.getValue(sq, "changeCount"); // 0
+ assertEquals(8, sq.findPosition(0));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 8, 1, token), cursor);
+ assertEquals("test:Pos8:Col1:startCol1:endCol0:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(9, sq.findPosition(1));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor);
+ assertEquals("test:Pos9:Col2:startCol1:endCol0:tok1",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
// gap position 'finds' residue to the right (not the left as per javadoc)
- assertEquals(3, sq.findPosition(2));
- assertEquals(3, sq.findPosition(3));
- assertEquals(4, sq.findPosition(4));
- assertEquals(4, sq.findPosition(5));
+ // cursor is set to the last residue position found [B 2]
+ assertEquals(10, sq.findPosition(2));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor);
+ assertEquals("test:Pos9:Col2:startCol1:endCol0:tok2",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(10, sq.findPosition(3));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor);
+ assertEquals("test:Pos10:Col4:startCol1:endCol0:tok3",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ // column[4] is the gap after C - returns D11
+ // cursor is set to [C 4]
+ assertEquals(11, sq.findPosition(4));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor);
+ assertEquals("test:Pos10:Col4:startCol1:endCol0:tok4",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(11, sq.findPosition(5)); // D
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor);
+ // lastCol has been found and saved in the cursor
+ assertEquals("test:Pos11:Col6:startCol1:endCol6:tok5",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
// returns 1 more than sequence length if off the end ?!?
- assertEquals(5, sq.findPosition(6));
- assertEquals(5, sq.findPosition(7));
+ assertEquals(12, sq.findPosition(6));
- sq = new Sequence("test", "--AB-C-DEF--");
- assertEquals(1, sq.findPosition(0));
- assertEquals(1, sq.findPosition(1));
- assertEquals(1, sq.findPosition(2));
- assertEquals(2, sq.findPosition(3));
- assertEquals(3, sq.findPosition(4));
- assertEquals(3, sq.findPosition(5));
- assertEquals(4, sq.findPosition(6));
- assertEquals(4, sq.findPosition(7));
- assertEquals(5, sq.findPosition(8));
- assertEquals(6, sq.findPosition(9));
- assertEquals(7, sq.findPosition(10));
- assertEquals(7, sq.findPosition(11));
+ sq.sequenceChanged();
+ assertEquals(12, sq.findPosition(7));
+
+ /*
+ * first findPosition should also set firstResCol in cursor
+ */
+ sq = new Sequence("test/8-13", "--AB-C-DEF--");
+ assertEquals(8, sq.findPosition(0));
+ assertNull(PA.getValue(sq, "cursor"));
+
+ sq.sequenceChanged();
+ assertEquals(8, sq.findPosition(1));
+ assertNull(PA.getValue(sq, "cursor"));
+
+ sq.sequenceChanged();
+ assertEquals(8, sq.findPosition(2));
+ assertEquals("test:Pos8:Col3:startCol3:endCol0:tok2",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(9, sq.findPosition(3));
+ assertEquals("test:Pos9:Col4:startCol3:endCol0:tok3",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ // column[4] is a gap, returns next residue pos (C10)
+ // cursor is set to last residue found [B]
+ assertEquals(10, sq.findPosition(4));
+ assertEquals("test:Pos9:Col4:startCol3:endCol0:tok4",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(10, sq.findPosition(5));
+ assertEquals("test:Pos10:Col6:startCol3:endCol0:tok5",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ // column[6] is a gap, returns next residue pos (D11)
+ // cursor is set to last residue found [C]
+ assertEquals(11, sq.findPosition(6));
+ assertEquals("test:Pos10:Col6:startCol3:endCol0:tok6",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(11, sq.findPosition(7));
+ assertEquals("test:Pos11:Col8:startCol3:endCol0:tok7",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(12, sq.findPosition(8));
+ assertEquals("test:Pos12:Col9:startCol3:endCol0:tok8",
+ PA.getValue(sq, "cursor").toString());
+
+ /*
+ * when the last residue column is found, it is set in the cursor
+ */
+ sq.sequenceChanged();
+ assertEquals(13, sq.findPosition(9));
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok9",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(14, sq.findPosition(10));
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok10",
+ PA.getValue(sq, "cursor").toString());
+
+ /*
+ * findPosition for column beyond sequence length
+ * returns 1 more than last residue position
+ */
+ sq.sequenceChanged();
+ assertEquals(14, sq.findPosition(11));
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok11",
+ PA.getValue(sq, "cursor").toString());
+
+ sq.sequenceChanged();
+ assertEquals(14, sq.findPosition(99));
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok12",
+ PA.getValue(sq, "cursor").toString());
+
+ /*
+ * gapped sequence ending in non-gap
+ */
+ sq = new Sequence("test/8-13", "--AB-C-DEF");
+ assertEquals(13, sq.findPosition(9));
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+ sq.sequenceChanged();
+ assertEquals(12, sq.findPosition(8));
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ // sequenceChanged() invalidates cursor.lastResidueColumn
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals("test:Pos12:Col9:startCol3:endCol0:tok1",
+ cursor.toString());
+ // findPosition with cursor accepts base 1 column values
+ assertEquals(13, ((Sequence) sq).findPosition(10, cursor));
+ assertEquals(13, sq.findPosition(9)); // F13
+ // lastResidueColumn has now been found and saved in cursor
+ assertEquals("test:Pos13:Col10:startCol3:endCol10:tok1",
+ PA.getValue(sq, "cursor").toString());
}
@Test(groups = { "Functional" })
public void testDeleteChars()
{
+ /*
+ * internal delete
+ */
+ SequenceI sq = new Sequence("test", "ABCDEF");
+ assertNull(PA.getValue(sq, "datasetSequence"));
+ assertEquals(1, sq.getStart());
+ assertEquals(6, sq.getEnd());
+ sq.deleteChars(2, 3);
+ assertEquals("ABDEF", sq.getSequenceAsString());
+ assertEquals(1, sq.getStart());
+ assertEquals(5, sq.getEnd());
+ assertNull(PA.getValue(sq, "datasetSequence"));
+
+ /*
+ * delete at start
+ */
+ sq = new Sequence("test", "ABCDEF");
+ sq.deleteChars(0, 2);
+ assertEquals("CDEF", sq.getSequenceAsString());
+ assertEquals(3, sq.getStart());
+ assertEquals(6, sq.getEnd());
+ assertNull(PA.getValue(sq, "datasetSequence"));
+
+ /*
+ * delete at end
+ */
+ sq = new Sequence("test", "ABCDEF");
+ sq.deleteChars(4, 6);
+ assertEquals("ABCD", sq.getSequenceAsString());
+ assertEquals(1, sq.getStart());
+ assertEquals(4, sq.getEnd());
+ assertNull(PA.getValue(sq, "datasetSequence"));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testDeleteChars_withDbRefsAndFeatures()
+ {
+ /*
+ * internal delete - new dataset sequence created
+ * gets a copy of any dbrefs
+ */
SequenceI sq = new Sequence("test", "ABCDEF");
+ sq.createDatasetSequence();
+ DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123");
+ sq.addDBRef(dbr1);
+ Object ds = PA.getValue(sq, "datasetSequence");
+ assertNotNull(ds);
assertEquals(1, sq.getStart());
assertEquals(6, sq.getEnd());
sq.deleteChars(2, 3);
assertEquals("ABDEF", sq.getSequenceAsString());
assertEquals(1, sq.getStart());
assertEquals(5, sq.getEnd());
+ Object newDs = PA.getValue(sq, "datasetSequence");
+ assertNotNull(newDs);
+ assertNotSame(ds, newDs);
+ assertNotNull(sq.getDBRefs());
+ assertEquals(1, sq.getDBRefs().length);
+ assertNotSame(dbr1, sq.getDBRefs()[0]);
+ assertEquals(dbr1, sq.getDBRefs()[0]);
+ /*
+ * internal delete with sequence features
+ * (failure case for JAL-2541)
+ */
+ sq = new Sequence("test", "ABCDEF");
+ sq.createDatasetSequence();
+ SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
+ "CathGroup");
+ sq.addSequenceFeature(sf1);
+ ds = PA.getValue(sq, "datasetSequence");
+ assertNotNull(ds);
+ assertEquals(1, sq.getStart());
+ assertEquals(6, sq.getEnd());
+ sq.deleteChars(2, 4);
+ assertEquals("ABEF", sq.getSequenceAsString());
+ assertEquals(1, sq.getStart());
+ assertEquals(4, sq.getEnd());
+ newDs = PA.getValue(sq, "datasetSequence");
+ assertNotNull(newDs);
+ assertNotSame(ds, newDs);
+ List<SequenceFeature> sfs = sq.getSequenceFeatures();
+ assertEquals(1, sfs.size());
+ assertNotSame(sf1, sfs.get(0));
+ assertEquals(sf1, sfs.get(0));
+
+ /*
+ * delete at start - no new dataset sequence created
+ * any sequence features remain as before
+ */
sq = new Sequence("test", "ABCDEF");
+ sq.createDatasetSequence();
+ ds = PA.getValue(sq, "datasetSequence");
+ sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup");
+ sq.addSequenceFeature(sf1);
sq.deleteChars(0, 2);
assertEquals("CDEF", sq.getSequenceAsString());
assertEquals(3, sq.getStart());
assertEquals(6, sq.getEnd());
+ assertSame(ds, PA.getValue(sq, "datasetSequence"));
+ sfs = sq.getSequenceFeatures();
+ assertNotNull(sfs);
+ assertEquals(1, sfs.size());
+ assertSame(sf1, sfs.get(0));
+
+ /*
+ * delete at end - no new dataset sequence created
+ * any dbrefs remain as before
+ */
+ sq = new Sequence("test", "ABCDEF");
+ sq.createDatasetSequence();
+ ds = PA.getValue(sq, "datasetSequence");
+ dbr1 = new DBRefEntry("Uniprot", "0", "a123");
+ sq.addDBRef(dbr1);
+ sq.deleteChars(4, 6);
+ assertEquals("ABCD", sq.getSequenceAsString());
+ assertEquals(1, sq.getStart());
+ assertEquals(4, sq.getEnd());
+ assertSame(ds, PA.getValue(sq, "datasetSequence"));
+ assertNotNull(sq.getDBRefs());
+ assertEquals(1, sq.getDBRefs().length);
+ assertSame(dbr1, sq.getDBRefs()[0]);
}
@Test(groups = { "Functional" })
SequenceI sq = new Sequence("test", "GATCAT");
sq.createDatasetSequence();
- assertNull(sq.getSequenceFeatures());
+ assertTrue(sq.getSequenceFeatures().isEmpty());
/*
* SequenceFeature on sequence
*/
- SequenceFeature sf = new SequenceFeature();
+ SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 4, 2f, null);
sq.addSequenceFeature(sf);
- SequenceFeature[] sfs = sq.getSequenceFeatures();
- assertEquals(1, sfs.length);
- assertSame(sf, sfs[0]);
-
+ List<SequenceFeature> sfs = sq.getSequenceFeatures();
+ assertEquals(1, sfs.size());
+ assertSame(sf, sfs.get(0));
/*
* SequenceFeature on sequence and dataset sequence; returns that on
* Note JAL-2046: spurious: we have no use case for this at the moment.
* This test also buggy - as sf2.equals(sf), no new feature is added
*/
- SequenceFeature sf2 = new SequenceFeature();
+ SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
+ null);
sq.getDatasetSequence().addSequenceFeature(sf2);
sfs = sq.getSequenceFeatures();
- assertEquals(1, sfs.length);
- assertSame(sf, sfs[0]);
+ assertEquals(1, sfs.size());
+ assertSame(sf, sfs.get(0));
/*
* SequenceFeature on dataset sequence only
* Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
*/
sq.setSequenceFeatures(null);
- assertNull(sq.getDatasetSequence().getSequenceFeatures());
+ assertTrue(sq.getDatasetSequence().getSequenceFeatures().isEmpty());
/*
* Corrupt case - no SequenceFeature, dataset's dataset is the original
* is there a usecase for this ? setDatasetSequence should throw an error if
* this actually occurs.
*/
- sq.getDatasetSequence().setDatasetSequence(sq); // loop!
- assertNull(sq.getSequenceFeatures());
+ try
+ {
+ sq.getDatasetSequence().setDatasetSequence(sq); // loop!
+ Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference");
+ } catch (IllegalArgumentException e)
+ {
+ // TODO Jalview error/exception class for raising implementation errors
+ assertTrue(e.getMessage().toLowerCase()
+ .contains("implementation error"));
+ }
+ assertTrue(sq.getSequenceFeatures().isEmpty());
}
/**
}
/**
+ * test createDatasetSequence behaves to doc
+ */
+ @Test(groups = { "Functional" })
+ public void testCreateDatasetSequence()
+ {
+ SequenceI sq = new Sequence("my", "ASDASD");
+ sq.addSequenceFeature(new SequenceFeature("type", "desc", 1, 10, 1f,
+ "group"));
+ sq.addDBRef(new DBRefEntry("source", "version", "accession"));
+ assertNull(sq.getDatasetSequence());
+ assertNotNull(PA.getValue(sq, "sequenceFeatureStore"));
+ assertNotNull(PA.getValue(sq, "dbrefs"));
+
+ SequenceI rds = sq.createDatasetSequence();
+ assertNotNull(rds);
+ assertNull(rds.getDatasetSequence());
+ assertSame(sq.getDatasetSequence(), rds);
+
+ // sequence features and dbrefs transferred to dataset sequence
+ assertNull(PA.getValue(sq, "sequenceFeatureStore"));
+ assertNull(PA.getValue(sq, "dbrefs"));
+ assertNotNull(PA.getValue(rds, "sequenceFeatureStore"));
+ assertNotNull(PA.getValue(rds, "dbrefs"));
+ }
+
+ /**
* Test for deriveSequence applied to a sequence with a dataset
*/
@Test(groups = { "Functional" })
sq.setStart(3);
sq.setEnd(4);
+ sq.setDescription("Test sequence description..");
+ sq.setVamsasId("TestVamsasId");
+ sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
+
+ sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
+ sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
+
+ sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
+ sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
+
+ // these are the same as ones already added
+ DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
+ DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
+
+ List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
+ pdb2pdb });
+
+ sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
+ sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing
+
+ PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
+ PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
+ PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
+ "filePath/test2");
+ PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
+ "filePath/test2");
+ sq.getDatasetSequence().addPDBId(pdbe1a);
+ sq.getDatasetSequence().addPDBId(pdbe1b);
+ sq.getDatasetSequence().addPDBId(pdbe2a);
+ sq.getDatasetSequence().addPDBId(pdbe2b);
+
+ /*
+ * test we added pdb entries to the dataset sequence
+ */
+ Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays
+ .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
+ "PDB Entries were not found on dataset sequence.");
+
+ /*
+ * we should recover a pdb entry that is on the dataset sequence via PDBEntry
+ */
+ Assert.assertEquals(pdbe1a,
+ sq.getDatasetSequence().getPDBEntry("1PDB"),
+ "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
+ ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
+ System.out.println(">>>>>> " + sq.getSequenceAsString().length());
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ Annotation[] annots = annotsList.toArray(new Annotation[0]);
+ sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
+ "Test annot description", annots));
+ sq.getDatasetSequence().addAlignmentAnnotation(
+ new AlignmentAnnotation("Test annot", "Test annot description",
+ annots));
+ Assert.assertEquals(sq.getDescription(), "Test sequence description..");
+ Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset
+ // sequence
+ Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(sq.getAnnotation());
+ Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same
+ // as
+ // sq.getDBRefs()
+ Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
+ 4);
+ Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
+
Sequence derived = (Sequence) sq.deriveSequence();
+
+ Assert.assertEquals(derived.getDescription(),
+ "Test sequence description..");
+ Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset
+ Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(derived.getAnnotation());
+ Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5);
+ Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
+ .size(), 4);
+ Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
+
assertEquals("CD", derived.getSequenceAsString());
assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
- assertNull(sq.sequenceFeatures);
- assertNull(derived.sequenceFeatures);
// derived sequence should access dataset sequence features
assertNotNull(sq.getSequenceFeatures());
- assertArrayEquals(sq.getSequenceFeatures(),
- derived.getSequenceFeatures());
+ assertEquals(sq.getSequenceFeatures(), derived.getSequenceFeatures());
+
+ /*
+ * verify we have primary db refs *just* for PDB IDs with associated
+ * PDBEntry objects
+ */
+
+ assertEquals(primRefs, sq.getPrimaryDBRefs());
+ assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
+
+ assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
+
}
/**
12.4f, "group"));
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
-
+
SequenceI copy = new Sequence(seq1);
assertNull(copy.getDatasetSequence());
assertEquals(anns[0].score, seq1.getAnnotation()[0].score);
// copy has a copy of the sequence feature:
- SequenceFeature[] sfs = copy.getSequenceFeatures();
- assertEquals(1, sfs.length);
- if (seq1.getDatasetSequence()!=null && copy.getDatasetSequence()==seq1.getDatasetSequence()) {
- assertTrue(sfs[0] == seq1.getSequenceFeatures()[0]);
- } else {
- assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+ List<SequenceFeature> sfs = copy.getSequenceFeatures();
+ assertEquals(1, sfs.size());
+ if (seq1.getDatasetSequence() != null
+ && copy.getDatasetSequence() == seq1.getDatasetSequence())
+ {
+ assertSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
}
- assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0]));
+ else
+ {
+ assertNotSame(sfs.get(0), seq1.getSequenceFeatures().get(0));
+ }
+ assertEquals(sfs.get(0), seq1.getSequenceFeatures().get(0));
// copy has a copy of the PDB entry
Vector<PDBEntry> pdbs = copy.getAllPDBEntries();
assertEquals(' ', sq.getCharAt(5));
assertEquals(' ', sq.getCharAt(-1));
}
+
+ @Test(groups = { "Functional" })
+ public void testAddSequenceFeatures()
+ {
+ SequenceI sq = new Sequence("", "abcde");
+ // type may not be null
+ assertFalse(sq.addSequenceFeature(new SequenceFeature(null, "desc", 4,
+ 8, 0f, null)));
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
+ 8, 0f, null)));
+ // can't add a duplicate feature
+ assertFalse(sq.addSequenceFeature(new SequenceFeature("Cath", "desc",
+ 4, 8, 0f, null)));
+ // can add a different feature
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Scop", "desc", 4,
+ 8, 0f, null))); // different type
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath",
+ "description", 4, 8, 0f, null)));// different description
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 3,
+ 8, 0f, null))); // different start position
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
+ 9, 0f, null))); // different end position
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
+ 8, 1f, null))); // different score
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
+ 8, Float.NaN, null))); // score NaN
+ assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4,
+ 8, 0f, "Metal"))); // different group
+ assertEquals(8, sq.getFeatures().getAllFeatures().size());
+ }
+
+ /**
+ * Tests for adding (or updating) dbrefs
+ *
+ * @see DBRefEntry#updateFrom(DBRefEntry)
+ */
+ @Test(groups = { "Functional" })
+ public void testAddDBRef()
+ {
+ SequenceI sq = new Sequence("", "abcde");
+ assertNull(sq.getDBRefs());
+ DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
+ sq.addDBRef(dbref);
+ assertEquals(1, sq.getDBRefs().length);
+ assertSame(dbref, sq.getDBRefs()[0]);
+
+ /*
+ * change of version - new entry
+ */
+ DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
+ sq.addDBRef(dbref2);
+ assertEquals(2, sq.getDBRefs().length);
+ assertSame(dbref, sq.getDBRefs()[0]);
+ assertSame(dbref2, sq.getDBRefs()[1]);
+
+ /*
+ * matches existing entry - not added
+ */
+ sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
+ assertEquals(2, sq.getDBRefs().length);
+
+ /*
+ * different source = new entry
+ */
+ DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
+ sq.addDBRef(dbref3);
+ assertEquals(3, sq.getDBRefs().length);
+ assertSame(dbref3, sq.getDBRefs()[2]);
+
+ /*
+ * different ref = new entry
+ */
+ DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
+ sq.addDBRef(dbref4);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref4, sq.getDBRefs()[3]);
+
+ /*
+ * matching ref with a mapping - map updated
+ */
+ DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
+ Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
+ 1, 1 }, 3, 1));
+ dbref5.setMap(map);
+ sq.addDBRef(dbref5);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref4, sq.getDBRefs()[3]);
+ assertSame(map, dbref4.getMap());
+
+ /*
+ * 'real' version replaces "0" version
+ */
+ dbref2.setVersion("0");
+ DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
+ dbref2.getAccessionId());
+ sq.addDBRef(dbref6);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref2, sq.getDBRefs()[1]);
+ assertEquals("3", dbref2.getVersion());
+
+ /*
+ * 'real' version replaces "source:0" version
+ */
+ dbref3.setVersion("Uniprot:0");
+ DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
+ dbref3.getAccessionId());
+ sq.addDBRef(dbref7);
+ assertEquals(4, sq.getDBRefs().length);
+ assertSame(dbref3, sq.getDBRefs()[2]);
+ assertEquals("3", dbref2.getVersion());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetPrimaryDBRefs_peptide()
+ {
+ SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
+
+ // no dbrefs
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
+ // empty dbrefs
+ sq.setDBRefs(new DBRefEntry[] {});
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
+ // primary - uniprot
+ DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
+ sq.addDBRef(upentry1);
+
+ // primary - uniprot with congruent map
+ DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
+ upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
+ new int[] { 10, 22 }, 1, 1)));
+ sq.addDBRef(upentry2);
+
+ // primary - uniprot with map of enclosing sequence
+ DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
+ upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
+ new int[] { 8, 24 }, 1, 1)));
+ sq.addDBRef(upentry3);
+
+ // not primary - uniprot with map of sub-sequence (5')
+ DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
+ upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
+ new int[] { 10, 18 }, 1, 1)));
+ sq.addDBRef(upentry4);
+
+ // not primary - uniprot with map that overlaps 3'
+ DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
+ upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
+ new int[] { 12, 22 }, 1, 1)));
+ sq.addDBRef(upentry5);
+
+ // not primary - uniprot with map to different coordinates frame
+ DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
+ upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
+ new int[] { 112, 118 }, 1, 1)));
+ sq.addDBRef(upentry6);
+
+ // not primary - dbref to 'non-core' database
+ DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
+ sq.addDBRef(upentry7);
+
+ // primary - type is PDB
+ DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
+ sq.addDBRef(pdbentry);
+
+ // not primary - PDBEntry has no file
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+
+ // not primary - no PDBEntry
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
+
+ // add corroborating PDB entry for primary DBref -
+ // needs to have a file as well as matching ID
+ // note PDB ID is not treated as case sensitive
+ sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
+ .toString()));
+
+ // not valid DBRef - no file..
+ sq.addPDBId(new PDBEntry("1AAA", null, null, null));
+
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(4, primaryDBRefs.size());
+ assertTrue("Couldn't find simple primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry1));
+ assertTrue("Couldn't find mapped primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry2));
+ assertTrue("Couldn't find mapped context reference (UNIPROT)",
+ primaryDBRefs.contains(upentry3));
+ assertTrue("Couldn't find expected PDB primary reference",
+ primaryDBRefs.contains(pdbentry));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetPrimaryDBRefs_nucleotide()
+ {
+ SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
+
+ // primary - Ensembl
+ DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
+ sq.addDBRef(dbr1);
+
+ // not primary - Ensembl 'transcript' mapping of sub-sequence
+ DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
+ dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
+ new int[] { 1, 11 }, 1, 1)));
+ sq.addDBRef(dbr2);
+
+ // primary - EMBL with congruent map
+ DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
+ dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
+ new int[] { 10, 34 }, 1, 1)));
+ sq.addDBRef(dbr3);
+
+ // not primary - to non-core database
+ DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
+ sq.addDBRef(dbr4);
+
+ // not primary - to protein
+ DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
+ sq.addDBRef(dbr5);
+
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(2, primaryDBRefs.size());
+ assertTrue(primaryDBRefs.contains(dbr1));
+ assertTrue(primaryDBRefs.contains(dbr3));
+ }
+
+ /**
+ * Test the method that updates the list of PDBEntry from any new DBRefEntry
+ * for PDB
+ */
+ @Test(groups = { "Functional" })
+ public void testUpdatePDBIds()
+ {
+ PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
+ seq.addPDBId(pdbe1);
+ seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
+ seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
+ // 7 is not a valid chain code:
+ seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
+
+ seq.updatePDBIds();
+ List<PDBEntry> pdbIds = seq.getAllPDBEntries();
+ assertEquals(4, pdbIds.size());
+ assertSame(pdbe1, pdbIds.get(0));
+ // chain code got added to 3A6S:
+ assertEquals("B", pdbe1.getChainCode());
+ assertEquals("1A70", pdbIds.get(1).getId());
+ // 4BQGA is parsed into id + chain
+ assertEquals("4BQG", pdbIds.get(2).getId());
+ assertEquals("a", pdbIds.get(2).getChainCode());
+ assertEquals("2GIS7", pdbIds.get(3).getId());
+ assertNull(pdbIds.get(3).getChainCode());
+ }
+
+ /**
+ * Test the method that either adds a pdbid or updates an existing one
+ */
+ @Test(groups = { "Functional" })
+ public void testAddPDBId()
+ {
+ PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
+ seq.addPDBId(pdbe);
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+ assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
+
+ // add the same entry
+ seq.addPDBId(pdbe);
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+ // add an identical entry
+ seq.addPDBId(new PDBEntry("3A6S", null, null, null));
+ assertEquals(1, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+ // add a different entry
+ PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
+ seq.addPDBId(pdbe2);
+ assertEquals(2, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getAllPDBEntries().get(0));
+ assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+ // update pdbe with chain code, file, type
+ PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
+ seq.addPDBId(pdbe3);
+ assertEquals(2, seq.getAllPDBEntries().size());
+ assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
+ assertEquals("3A6S", pdbe.getId()); // unchanged
+ assertEquals("A", pdbe.getChainCode()); // updated
+ assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
+ assertEquals("filepath", pdbe.getFile()); // updated
+ assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+ // add with a different file path
+ PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
+ seq.addPDBId(pdbe4);
+ assertEquals(3, seq.getAllPDBEntries().size());
+ assertSame(pdbe4, seq.getAllPDBEntries().get(2));
+
+ // add with a different chain code
+ PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
+ seq.addPDBId(pdbe5);
+ assertEquals(4, seq.getAllPDBEntries().size());
+ assertSame(pdbe5, seq.getAllPDBEntries().get(3));
+ }
+
+ @Test(
+ groups = { "Functional" },
+ expectedExceptions = { IllegalArgumentException.class })
+ public void testSetDatasetSequence_toSelf()
+ {
+ seq.setDatasetSequence(seq);
+ }
+
+ @Test(
+ groups = { "Functional" },
+ expectedExceptions = { IllegalArgumentException.class })
+ public void testSetDatasetSequence_cascading()
+ {
+ SequenceI seq2 = new Sequence("Seq2", "xyz");
+ seq2.createDatasetSequence();
+ seq.setDatasetSequence(seq2);
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindFeatures()
+ {
+ SequenceI sq = new Sequence("test/8-16", "-ABC--DEF--GHI--");
+ sq.createDatasetSequence();
+
+ assertTrue(sq.findFeatures(1, 99).isEmpty());
+
+ // add non-positional feature
+ SequenceFeature sf0 = new SequenceFeature("Cath", "desc", 0, 0, 2f,
+ null);
+ sq.addSequenceFeature(sf0);
+ // add feature on BCD
+ SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 9, 11, 2f,
+ null);
+ sq.addSequenceFeature(sf1);
+ // add feature on DE
+ SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 11, 12, 2f,
+ null);
+ sq.addSequenceFeature(sf2);
+ // add contact feature at [B, H]
+ SequenceFeature sf3 = new SequenceFeature("Disulphide bond", "desc", 9,
+ 15, 2f,
+ null);
+ sq.addSequenceFeature(sf3);
+ // add contact feature at [F, G]
+ SequenceFeature sf4 = new SequenceFeature("Disulfide Bond", "desc", 13,
+ 14, 2f,
+ null);
+ sq.addSequenceFeature(sf4);
+
+ // no features in columns 1-2 (-A)
+ List<SequenceFeature> found = sq.findFeatures(1, 2);
+ assertTrue(found.isEmpty());
+
+ // columns 1-6 (-ABC--) includes BCD and B/H feature but not DE
+ found = sq.findFeatures(1, 6);
+ assertEquals(2, found.size());
+ assertTrue(found.contains(sf1));
+ assertTrue(found.contains(sf3));
+
+ // columns 5-6 (--) includes (enclosing) BCD but not (contact) B/H feature
+ found = sq.findFeatures(5, 6);
+ assertEquals(1, found.size());
+ assertTrue(found.contains(sf1));
+
+ // columns 7-10 (DEF-) includes BCD, DE, F/G but not B/H feature
+ found = sq.findFeatures(7, 10);
+ assertEquals(3, found.size());
+ assertTrue(found.contains(sf1));
+ assertTrue(found.contains(sf2));
+ assertTrue(found.contains(sf4));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindIndex_withCursor()
+ {
+ Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
+
+ // find F given A
+ assertEquals(10, sq.findIndex(13, new SequenceCursor(sq, 8, 2, 0)));
+
+ // find A given F
+ assertEquals(2, sq.findIndex(8, new SequenceCursor(sq, 13, 10, 0)));
+
+ // find C given C
+ assertEquals(6, sq.findIndex(10, new SequenceCursor(sq, 10, 6, 0)));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindPosition_withCursor()
+ {
+ Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
+
+ // find F pos given A - lastCol gets set in cursor
+ assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0)));
+ assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ // find A pos given F - first residue column is saved in cursor
+ assertEquals(8, sq.findPosition(2, new SequenceCursor(sq, 13, 10, 0)));
+ assertEquals("test:Pos8:Col2:startCol2:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ // find C pos given C (neither startCol nor endCol is set)
+ assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 10, 6, 0)));
+ assertEquals("test:Pos10:Col6:startCol0:endCol0:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ // now the grey area - what residue position for a gapped column? JAL-2562
+
+ // find 'residue' for column 3 given cursor for D (so working left)
+ // returns B9; cursor is updated to [B 5]
+ assertEquals(9, sq.findPosition(3, new SequenceCursor(sq, 11, 7, 0)));
+ assertEquals("test:Pos9:Col5:startCol0:endCol0:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ // find 'residue' for column 8 given cursor for D (so working right)
+ // returns E12; cursor is updated to [D 7]
+ assertEquals(12, sq.findPosition(8, new SequenceCursor(sq, 11, 7, 0)));
+ assertEquals("test:Pos11:Col7:startCol0:endCol0:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ // find 'residue' for column 12 given cursor for B
+ // returns 1 more than last residue position; cursor is updated to [F 10]
+ // lastCol position is saved in cursor
+ assertEquals(14, sq.findPosition(12, new SequenceCursor(sq, 9, 5, 0)));
+ assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ /*
+ * findPosition for column beyond length of sequence
+ * returns 1 more than the last residue position
+ * cursor is set to last real residue position [F 10]
+ */
+ assertEquals(14, sq.findPosition(99, new SequenceCursor(sq, 8, 2, 0)));
+ assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+
+ /*
+ * and the case without a trailing gap
+ */
+ sq = new Sequence("test/8-13", "-A--BCD-EF");
+ // first find C from A
+ assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 8, 2, 0)));
+ SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals("test:Pos10:Col6:startCol0:endCol0:tok0",
+ cursor.toString());
+ // now 'find' 99 from C
+ // cursor is set to [F 10] and saved lastCol
+ assertEquals(14, sq.findPosition(99, cursor));
+ assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0",
+ PA.getValue(sq, "cursor").toString());
+ }
+
+ @Test
+ public void testIsValidCursor()
+ {
+ Sequence sq = new Sequence("Seq", "ABC--DE-F", 8, 13);
+ assertFalse(sq.isValidCursor(null));
+
+ /*
+ * cursor is valid if it has valid sequence ref and changeCount token
+ * and positions within the range of the sequence
+ */
+ int changeCount = (int) PA.getValue(sq, "changeCount");
+ SequenceCursor cursor = new SequenceCursor(sq, 13, 1, changeCount);
+ assertTrue(sq.isValidCursor(cursor));
+
+ /*
+ * column position outside [0 - length] is rejected
+ */
+ cursor = new SequenceCursor(sq, 13, -1, changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+ cursor = new SequenceCursor(sq, 13, 10, changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+ cursor = new SequenceCursor(sq, 7, 8, changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+ cursor = new SequenceCursor(sq, 14, 2, changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+
+ /*
+ * wrong sequence is rejected
+ */
+ cursor = new SequenceCursor(null, 13, 1, changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+ cursor = new SequenceCursor(new Sequence("Seq", "abc"), 13, 1,
+ changeCount);
+ assertFalse(sq.isValidCursor(cursor));
+
+ /*
+ * wrong token value is rejected
+ */
+ cursor = new SequenceCursor(sq, 13, 1, changeCount + 1);
+ assertFalse(sq.isValidCursor(cursor));
+ cursor = new SequenceCursor(sq, 13, 1, changeCount - 1);
+ assertFalse(sq.isValidCursor(cursor));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFindPosition_withCursorAndEdits()
+ {
+ Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--");
+
+ // find F pos given A
+ assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0)));
+ int token = (int) PA.getValue(sq, "changeCount"); // 0
+ SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 13, 10, token), cursor);
+
+ /*
+ * setSequence should invalidate the cursor cached by the sequence
+ */
+ sq.setSequence("-A-BCD-EF---"); // one gap removed
+ assertEquals(8, sq.getStart()); // sanity check
+ assertEquals(11, sq.findPosition(5)); // D11
+ // cursor should now be at [D 6]
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor);
+
+ /*
+ * deleteChars should invalidate the cached cursor
+ */
+ sq.deleteChars(2, 5); // delete -BC
+ assertEquals("-AD-EF---", sq.getSequenceAsString());
+ assertEquals(8, sq.getStart()); // sanity check
+ assertEquals(10, sq.findPosition(4)); // E10
+ // cursor should now be at [E 5]
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 10, 5, ++token), cursor);
+
+ /*
+ * Edit to insert gaps should invalidate the cached cursor
+ * insert 2 gaps at column[3] to make -AD---EF---
+ */
+ SequenceI[] seqs = new SequenceI[] { sq };
+ AlignmentI al = new Alignment(seqs);
+ new EditCommand().appendEdit(Action.INSERT_GAP, seqs, 3, 2, al, true);
+ assertEquals("-AD---EF---", sq.getSequenceAsString());
+ assertEquals(10, sq.findPosition(4)); // E10
+ // cursor should now be at [D 3]
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 9, 3, ++token), cursor);
+
+ /*
+ * insertCharAt should invalidate the cached cursor
+ * insert CC at column[4] to make -AD-CC--EF---
+ */
+ sq.insertCharAt(4, 2, 'C');
+ assertEquals("-AD-CC--EF---", sq.getSequenceAsString());
+ assertEquals(13, sq.findPosition(9)); // F13
+ // cursor should now be at [F 10]
+ cursor = (SequenceCursor) PA.getValue(sq, "cursor");
+ assertEquals(new SequenceCursor(sq, 13, 10, ++token), cursor);
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetSequence()
+ {
+ String seqstring = "-A--BCD-EF--";
+ Sequence sq = new Sequence("test/8-13", seqstring);
+ sq.createDatasetSequence();
+ assertTrue(Arrays.equals(sq.getSequence(), seqstring.toCharArray()));
+ assertTrue(Arrays.equals(sq.getDatasetSequence().getSequence(),
+ "ABCDEF".toCharArray()));
+
+ // verify a copy of the sequence array is returned
+ char[] theSeq = (char[]) PA.getValue(sq, "sequence");
+ assertNotSame(theSeq, sq.getSequence());
+ theSeq = (char[]) PA.getValue(sq.getDatasetSequence(), "sequence");
+ assertNotSame(theSeq, sq.getDatasetSequence().getSequence());
+ }
+
+ @Test(groups = { "Functional" })
+ public void testReplace()
+ {
+ String seqstring = "-A--BCD-EF--";
+ SequenceI sq = new Sequence("test/8-13", seqstring);
+ assertEquals(0, PA.getValue(sq, "changeCount"));
+
+ assertEquals(0, sq.replace('A', 'A')); // same char
+ assertEquals(seqstring, sq.getSequenceAsString());
+ assertEquals(0, PA.getValue(sq, "changeCount"));
+
+ assertEquals(0, sq.replace('X', 'Y')); // not there
+ assertEquals(seqstring, sq.getSequenceAsString());
+ assertEquals(0, PA.getValue(sq, "changeCount"));
+
+ assertEquals(1, sq.replace('A', 'K'));
+ assertEquals("-K--BCD-EF--", sq.getSequenceAsString());
+ assertEquals(1, PA.getValue(sq, "changeCount"));
+
+ assertEquals(6, sq.replace('-', '.'));
+ assertEquals(".K..BCD.EF..", sq.getSequenceAsString());
+ assertEquals(2, PA.getValue(sq, "changeCount"));
+ }
}