+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.xdb.embl;
import java.io.StringReader;
// adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
// dna and translations truncated for convenience
private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
- // + "<ROOT>"
+ + "<ROOT>"
+ "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
+ " dataClass=\"STD\" taxonomicDivision=\"PRO\""
+ " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
*/
+ "<sequence>GGTATGTCCTCTAGTACAAAC\n"
+ "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
- + "</sequence></entry>";
+ + "</sequence></entry></ROOT>";
- static EmblEntry getEmblFile()
+ static EmblFile getEmblFile()
{
- return EmblFile.getEntry(new StringReader(TESTDATA));
+ return EmblFile.getEmblFile(new StringReader(TESTDATA));
}
}