package jalview.gui;
import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
import static org.testng.Assert.assertTrue;
+import java.awt.EventQueue;
+import java.awt.FontMetrics;
+import java.awt.event.MouseEvent;
+import java.lang.reflect.InvocationTargetException;
+
+import javax.swing.JLabel;
+
+import org.testng.annotations.AfterMethod;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
import jalview.api.AlignViewportI;
import jalview.bin.Cache;
import jalview.bin.Jalview;
+import jalview.commands.EditCommand;
+import jalview.commands.EditCommand.Action;
+import jalview.commands.EditCommand.Edit;
import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResultsI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceI;
import jalview.gui.SeqPanel.MousePos;
import jalview.io.DataSourceType;
import jalview.io.FileLoader;
+import jalview.util.MessageManager;
+import jalview.viewmodel.ViewportRanges;
-import java.awt.Event;
-import java.awt.event.MouseEvent;
-import org.testng.annotations.AfterMethod;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
+import junit.extensions.PA;
public class SeqPanelTest
{
JvOptionPane.setInteractiveMode(false);
JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
}
+
@Test(groups = "Functional")
public void testSetStatusReturnsNearestResiduePosition()
{
AlignmentI visAl = alignFrame.getViewport().getAlignment();
// Test either side of gap
- assertEquals(
- alignFrame.alignPanel.getSeqPanel().setStatusMessage(
- visAl.getSequenceAt(1), 1, 1), 2);
- assertEquals(alignFrame.statusBar.getText(),
+ assertEquals(alignFrame.alignPanel.getSeqPanel()
+ .setStatusMessage(visAl.getSequenceAt(1), 1, 1), 2);
+ assertEquals(((JLabel) PA.getValue(alignFrame, "statusBar")).getText(),
"Sequence 2 ID: Seq2 Residue: ALA (2)");
- assertEquals(
- alignFrame.alignPanel.getSeqPanel().setStatusMessage(
- visAl.getSequenceAt(1), 4, 1), 3);
- assertEquals(alignFrame.statusBar.getText(),
+ assertEquals(alignFrame.alignPanel.getSeqPanel()
+ .setStatusMessage(visAl.getSequenceAt(1), 4, 1), 3);
+ assertEquals(((JLabel) PA.getValue(alignFrame, "statusBar")).getText(),
"Sequence 2 ID: Seq2 Residue: GLU (3)");
// no status message at a gap, returns next residue position to the right
- assertEquals(
- alignFrame.alignPanel.getSeqPanel().setStatusMessage(
- visAl.getSequenceAt(1), 2, 1), 3);
- assertEquals(alignFrame.statusBar.getText(), "Sequence 2 ID: Seq2");
- assertEquals(
- alignFrame.alignPanel.getSeqPanel().setStatusMessage(
- visAl.getSequenceAt(1), 3, 1), 3);
- assertEquals(alignFrame.statusBar.getText(), "Sequence 2 ID: Seq2");
+ assertEquals(alignFrame.alignPanel.getSeqPanel()
+ .setStatusMessage(visAl.getSequenceAt(1), 2, 1), 3);
+ assertEquals(((JLabel) PA.getValue(alignFrame, "statusBar")).getText(),
+ "Sequence 2 ID: Seq2");
+ assertEquals(alignFrame.alignPanel.getSeqPanel()
+ .setStatusMessage(visAl.getSequenceAt(1), 3, 1), 3);
+ assertEquals(((JLabel) PA.getValue(alignFrame, "statusBar")).getText(),
+ "Sequence 2 ID: Seq2");
}
@Test(groups = "Functional")
al.getHeight());
AlignmentI visAl = alignFrame.getViewport().getAlignment();
- assertEquals(
- alignFrame.alignPanel.getSeqPanel().setStatusMessage(
- visAl.getSequenceAt(1), 1, 1), 2);
- assertEquals(alignFrame.statusBar.getText(),
+ assertEquals(alignFrame.alignPanel.getSeqPanel()
+ .setStatusMessage(visAl.getSequenceAt(1), 1, 1), 2);
+ assertEquals(((JLabel) PA.getValue(alignFrame, "statusBar")).getText(),
"Sequence 2 ID: Seq2 Residue: B (2)");
}
@Test(groups = "Functional")
+ public void testGetEditStatusMessage()
+ {
+ assertNull(SeqPanel.getEditStatusMessage(null));
+
+ EditCommand edit = new EditCommand(); // empty
+ assertNull(SeqPanel.getEditStatusMessage(edit));
+
+ SequenceI[] seqs = new SequenceI[] { new Sequence("a", "b") };
+
+ // 1 gap
+ edit.addEdit(edit.new Edit(Action.INSERT_GAP, seqs, 1, 1, '-'));
+ String expected = MessageManager.formatMessage("label.insert_gap", "1");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 3 more gaps makes +4
+ edit.addEdit(edit.new Edit(Action.INSERT_GAP, seqs, 1, 3, '-'));
+ expected = MessageManager.formatMessage("label.insert_gaps", "4");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 2 deletes makes + 2
+ edit.addEdit(edit.new Edit(Action.DELETE_GAP, seqs, 1, 2, '-'));
+ expected = MessageManager.formatMessage("label.insert_gaps", "2");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 2 more deletes makes 0 - no text
+ edit.addEdit(edit.new Edit(Action.DELETE_GAP, seqs, 1, 2, '-'));
+ assertNull(SeqPanel.getEditStatusMessage(edit));
+
+ // 1 more delete makes 1 delete
+ edit.addEdit(edit.new Edit(Action.DELETE_GAP, seqs, 1, 1, '-'));
+ expected = MessageManager.formatMessage("label.delete_gap", "1");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 1 more delete makes 2 deletes
+ edit.addEdit(edit.new Edit(Action.DELETE_GAP, seqs, 1, 1, '-'));
+ expected = MessageManager.formatMessage("label.delete_gaps", "2");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+ }
+
+ /**
+ * Tests that simulate 'locked editing', where an inserted gap is balanced by
+ * a gap deletion in the selection group, and vice versa
+ */
+ @Test(groups = "Functional")
+ public void testGetEditStatusMessage_lockedEditing()
+ {
+ EditCommand edit = new EditCommand(); // empty
+ SequenceI[] seqs = new SequenceI[] { new Sequence("a", "b") };
+
+ // 1 gap inserted, balanced by 1 delete
+ Edit e1 = edit.new Edit(Action.INSERT_GAP, seqs, 1, 1, '-');
+ edit.addEdit(e1);
+ Edit e2 = edit.new Edit(Action.DELETE_GAP, seqs, 5, 1, '-');
+ e2.setSystemGenerated(true);
+ edit.addEdit(e2);
+ String expected = MessageManager.formatMessage("label.insert_gap", "1");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 2 more gaps makes +3
+ Edit e3 = edit.new Edit(Action.INSERT_GAP, seqs, 1, 2, '-');
+ edit.addEdit(e3);
+ Edit e4 = edit.new Edit(Action.DELETE_GAP, seqs, 5, 2, '-');
+ e4.setSystemGenerated(true);
+ edit.addEdit(e4);
+ expected = MessageManager.formatMessage("label.insert_gaps", "3");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 2 deletes makes + 1
+ Edit e5 = edit.new Edit(Action.DELETE_GAP, seqs, 1, 2, '-');
+ edit.addEdit(e5);
+ Edit e6 = edit.new Edit(Action.INSERT_GAP, seqs, 5, 2, '-');
+ e6.setSystemGenerated(true);
+ edit.addEdit(e6);
+ expected = MessageManager.formatMessage("label.insert_gap", "1");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 1 more delete makes 0 - no text
+ Edit e7 = edit.new Edit(Action.DELETE_GAP, seqs, 1, 1, '-');
+ edit.addEdit(e7);
+ Edit e8 = edit.new Edit(Action.INSERT_GAP, seqs, 5, 1, '-');
+ e8.setSystemGenerated(true);
+ edit.addEdit(e8);
+ expected = MessageManager.formatMessage("label.insert_gaps", "2");
+ assertNull(SeqPanel.getEditStatusMessage(edit));
+
+ // 1 more delete makes 1 delete
+ Edit e9 = edit.new Edit(Action.DELETE_GAP, seqs, 1, 1, '-');
+ edit.addEdit(e9);
+ Edit e10 = edit.new Edit(Action.INSERT_GAP, seqs, 5, 1, '-');
+ e10.setSystemGenerated(true);
+ edit.addEdit(e10);
+ expected = MessageManager.formatMessage("label.delete_gap", "1");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+
+ // 2 more deletes makes 3 deletes
+ Edit e11 = edit.new Edit(Action.DELETE_GAP, seqs, 1, 2, '-');
+ edit.addEdit(e11);
+ Edit e12 = edit.new Edit(Action.INSERT_GAP, seqs, 5, 2, '-');
+ e12.setSystemGenerated(true);
+ edit.addEdit(e12);
+ expected = MessageManager.formatMessage("label.delete_gaps", "3");
+ assertEquals(SeqPanel.getEditStatusMessage(edit), expected);
+ }
+
public void testFindMousePosition_unwrapped()
{
String seqData = ">Seq1\nAACDE\n>Seq2\nAA--E\n";
/*
* mouse at top left of unwrapped panel
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
- 0, 0, 0, false, 0);
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, y, 0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
assertEquals(pos.seqIndex, 0);
@AfterMethod(alwaysRun = true)
public void tearDown()
{
- Desktop.instance.closeAll_actionPerformed(null);
+ Desktop.getInstance().closeAll_actionPerformed(null);
}
@Test(groups = "Functional")
- public void testFindMousePosition_wrapped()
+ public void testFindMousePosition_wrapped_annotations()
{
- Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "true");
- Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.setPropertyNoSave("SHOW_ANNOTATIONS", "true");
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "true");
AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
"examples/uniref50.fa", DataSourceType.FILE);
AlignViewportI av = alignFrame.getViewport();
av.setScaleAboveWrapped(false);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
+
+ alignFrame.alignPanel.updateLayout();
final int charHeight = av.getCharHeight();
final int charWidth = av.getCharWidth();
final int alignmentHeight = av.getAlignment().getHeight();
-
+
// sanity checks:
assertTrue(charHeight > 0);
assertTrue(charWidth > 0);
assertTrue(alignFrame.alignPanel.getSeqPanel().getWidth() > 0);
-
+
SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
int x = 0;
int y = 0;
-
+
/*
* mouse at top left of wrapped panel; there is a gap of charHeight
* above the alignment
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
- 0, 0, 0, false, 0);
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, y, 0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
assertEquals(pos.seqIndex, -1); // above sequences
* cursor at bottom of gap above
*/
y = charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
* cursor over top of first sequence
*/
y = charHeight;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
* cursor at bottom of first sequence
*/
y = 2 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
* cursor at top of second sequence
*/
y = 2 * charHeight;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
assertEquals(pos.annotationIndex, -1);
* cursor at bottom of second sequence
*/
y = 3 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
assertEquals(pos.annotationIndex, -1);
* cursor at bottom of last sequence
*/
y = charHeight * (1 + alignmentHeight) - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
/*
* cursor below sequences, in 3-pixel gap above annotations
+ * method reports index of nearest sequence above
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
/*
* cursor still in the gap above annotations, now at the bottom of it
- * method reports index of nearest sequence above
*/
y += SeqCanvas.SEQS_ANNOTATION_GAP - 1; // 3-1 = 2
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
- /*
- * cursor at the top of the first annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0); // over first annotation
+ AlignmentAnnotation[] annotationRows = av.getAlignment()
+ .getAlignmentAnnotation();
+ for (int n = 0; n < annotationRows.length; n++)
+ {
+ /*
+ * cursor at the top of the n'th annotation
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0,
+ 0, 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n); // over n'th annotation
- /*
- * cursor at the bottom of the first annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[0].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0);
-
- /*
- * cursor at the top of the second annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the bottom of the second annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[1].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
- /*
- * cursor at the top of the third annotation
- */
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
-
- /*
- * cursor at the bottom of the third annotation
- */
- y += av.getAlignment().getAlignmentAnnotation()[2].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
+ /*
+ * cursor at the bottom of the n'th annotation
+ */
+ y += annotationRows[n].height - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0,
+ 0, 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n);
+ }
/*
* cursor in gap between wrapped widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
* cursor at bottom of gap between wrapped widths
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
* cursor at top of first sequence, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
@Test(groups = "Functional")
public void testFindMousePosition_wrapped_scaleAbove()
{
- Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "true");
- Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+ Cache.setPropertyNoSave("SHOW_ANNOTATIONS", "true");
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "true");
AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
"examples/uniref50.fa", DataSourceType.FILE);
AlignViewportI av = alignFrame.getViewport();
av.setScaleAboveWrapped(true);
av.setScaleLeftWrapped(false);
av.setScaleRightWrapped(false);
- alignFrame.alignPanel.paintAlignment(false, false);
-
+ alignFrame.alignPanel.updateLayout();
+
final int charHeight = av.getCharHeight();
final int charWidth = av.getCharWidth();
final int alignmentHeight = av.getAlignment().getHeight();
-
+
// sanity checks:
assertTrue(charHeight > 0);
assertTrue(charWidth > 0);
assertTrue(alignFrame.alignPanel.getSeqPanel().getWidth() > 0);
-
+
SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
int x = 0;
int y = 0;
-
+
/*
* mouse at top left of wrapped panel; there is a gap of charHeight
* above the alignment
*/
- MouseEvent evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y,
- 0, 0, 0, false, 0);
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, y, 0, 0, 0, false, 0);
MousePos pos = testee.findMousePosition(evt);
assertEquals(pos.column, 0);
assertEquals(pos.seqIndex, -1); // above sequences
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor at bottom of gap above
* two charHeights including scale panel
*/
y = 2 * charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor over top of first sequence
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor at bottom of first sequence
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor at top of second sequence
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor at bottom of second sequence
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor at bottom of last sequence
* (scale + gap + sequences)
*/
y = charHeight * (2 + alignmentHeight) - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor below sequences, in 3-pixel gap above annotations
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
* cursor still in the gap above annotations, now at the bottom of it
* method reports index of nearest sequence above
*/
y += SeqCanvas.SEQS_ANNOTATION_GAP - 1; // 3-1 = 2
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
-
+
+ AlignmentAnnotation[] annotationRows = av.getAlignment()
+ .getAlignmentAnnotation();
+ for (int n = 0; n < annotationRows.length; n++)
+ {
+ /*
+ * cursor at the top of the n'th annotation
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0,
+ 0, 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
+ assertEquals(pos.annotationIndex, n); // over n'th annotation
+
+ /*
+ * cursor at the bottom of the n'th annotation
+ */
+ y += annotationRows[n].height - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0,
+ 0, 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ SeqCanvas sc = testee.seqCanvas;
+ assertEquals(pos.seqIndex, alignmentHeight - 1,
+ String.format("%s n=%d y=%d %d, %d, %d, %d",
+ annotationRows[n].label, n, y, sc.getWidth(),
+ sc.getHeight(), sc.wrappedRepeatHeightPx,
+ sc.wrappedSpaceAboveAlignment));
+ assertEquals(pos.annotationIndex, n);
+ }
+
/*
- * cursor at the top of the first annotation
+ * cursor in gap between wrapped widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0); // over first annotation
-
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.annotationIndex, -1);
+
/*
- * cursor at the bottom of the first annotation
+ * cursor at bottom of gap between wrapped widths
*/
- y += av.getAlignment().getAlignmentAnnotation()[0].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ y += charHeight - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 0);
-
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.annotationIndex, -1);
+
/*
- * cursor at the top of the second annotation
+ * cursor at top of scale, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.annotationIndex, -1);
+
/*
- * cursor at the bottom of the second annotation
+ * cursor at bottom of scale, second wrapped width
*/
- y += av.getAlignment().getAlignmentAnnotation()[1].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ y += charHeight - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 1);
-
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.annotationIndex, -1);
+
/*
- * cursor at the top of the third annotation
+ * cursor at top of first sequence, second wrapped width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
-
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.annotationIndex, -1);
+ }
+
+ @Test(groups = "Functional")
+ public void testFindMousePosition_wrapped_noAnnotations()
+ {
+ Cache.setPropertyNoSave("SHOW_ANNOTATIONS", "false");
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "true");
+ Cache.setPropertyNoSave("FONT_SIZE", "10");
+ AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
+ "examples/uniref50.fa", DataSourceType.FILE);
+ AlignViewportI av = alignFrame.getViewport();
+ av.setScaleAboveWrapped(false);
+ av.setScaleLeftWrapped(false);
+ av.setScaleRightWrapped(false);
+ alignFrame.alignPanel.updateLayout();
+
+ final int charHeight = av.getCharHeight();
+ final int charWidth = av.getCharWidth();
+ final int alignmentHeight = av.getAlignment().getHeight();
+
+ // sanity checks:
+ assertTrue(charHeight > 0);
+ assertTrue(charWidth > 0);
+ assertTrue(alignFrame.alignPanel.getSeqPanel().getWidth() > 0);
+
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ int x = 0;
+ int y = 0;
+
/*
- * cursor at the bottom of the third annotation
+ * mouse at top left of wrapped panel; there is a gap of charHeight
+ * above the alignment
*/
- y += av.getAlignment().getAlignmentAnnotation()[2].height - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
- pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, alignmentHeight - 1);
- assertEquals(pos.annotationIndex, 2);
-
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, y, 0, 0, 0, false, 0);
+ MousePos pos = testee.findMousePosition(evt);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.seqIndex, -1); // above sequences
+ assertEquals(pos.annotationIndex, -1);
+
/*
- * cursor in gap between wrapped widths
+ * cursor over top of first sequence
*/
- y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ y = charHeight;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
-
+
/*
- * cursor at bottom of gap between wrapped widths
+ * cursor at bottom of last sequence
*/
- y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ y = charHeight * (1 + alignmentHeight) - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
- assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.seqIndex, alignmentHeight - 1);
assertEquals(pos.annotationIndex, -1);
-
+
/*
- * cursor at top of scale, second wrapped width
+ * cursor below sequences, at top of charHeight gap between widths
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
/*
- * cursor at bottom of scale, second wrapped width
+ * cursor below sequences, at top of charHeight gap between widths
*/
y += charHeight - 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, -1);
assertEquals(pos.annotationIndex, -1);
/*
- * cursor at top of first sequence, second wrapped width
+ * cursor at the top of the first sequence, second width
*/
y += 1;
- evt = new MouseEvent(testee, Event.MOUSE_MOVE, 0L, 0, x, y, 0, 0, 0,
- false, 0);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
pos = testee.findMousePosition(evt);
assertEquals(pos.seqIndex, 0);
assertEquals(pos.annotationIndex, -1);
}
+
+ @Test(groups = "Functional")
+ public void testFindColumn_unwrapped()
+ {
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "false");
+ AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
+ "examples/uniref50.fa", DataSourceType.FILE);
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ int x = 0;
+ final int charWidth = alignFrame.getViewport().getCharWidth();
+ assertTrue(charWidth > 0); // sanity check
+ ViewportRanges ranges = alignFrame.getViewport().getRanges();
+ assertEquals(ranges.getStartRes(), 0);
+
+ /*
+ * mouse at top left of unwrapped panel
+ */
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, 0, 0, 0, 0, false, 0);
+ assertEquals(testee.findColumn(evt), 0);
+
+ /*
+ * not quite one charWidth across
+ */
+ x = charWidth - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 0);
+
+ /*
+ * one charWidth across
+ */
+ x = charWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 1);
+
+ /*
+ * two charWidths across
+ */
+ x = 2 * charWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 2);
+
+ /*
+ * limited to last column of seqcanvas
+ */
+ x = 20000;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ SeqCanvas seqCanvas = alignFrame.alignPanel.getSeqPanel().seqCanvas;
+ int w = seqCanvas.getWidth();
+ // limited to number of whole columns, base 0,
+ // and to end of visible range
+ int expected = w / charWidth;
+ expected = Math.min(expected, ranges.getEndRes());
+ assertEquals(testee.findColumn(evt), expected);
+
+ /*
+ * hide columns 5-10 (base 1)
+ */
+ alignFrame.getViewport().hideColumns(4, 9);
+ x = 5 * charWidth + 2;
+ // x is in 6th visible column, absolute column 12, or 11 base 0
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 11);
+ }
+
+ @Test(groups = "Functional")
+ public void testFindColumn_wrapped()
+ {
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "true");
+ AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
+ "examples/uniref50.fa", DataSourceType.FILE);
+ AlignViewport av = alignFrame.getViewport();
+ av.setScaleAboveWrapped(false);
+ av.setScaleLeftWrapped(false);
+ av.setScaleRightWrapped(false);
+ alignFrame.alignPanel.updateLayout();
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ int x = 0;
+ final int charWidth = av.getCharWidth();
+ assertTrue(charWidth > 0); // sanity check
+ assertEquals(av.getRanges().getStartRes(), 0);
+
+ /*
+ * mouse at top left of wrapped panel, no West (left) scale
+ */
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, 0, 0, 0, 0, false, 0);
+ assertEquals(testee.findColumn(evt), 0);
+
+ /*
+ * not quite one charWidth across
+ */
+ x = charWidth - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 0);
+
+ /*
+ * one charWidth across
+ */
+ x = charWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 1);
+
+ /*
+ * x over scale left (before drawn columns) results in -1
+ */
+ av.setScaleLeftWrapped(true);
+ alignFrame.alignPanel.updateLayout();
+ SeqCanvas seqCanvas = testee.seqCanvas;
+ int labelWidth = (int) PA.getValue(seqCanvas, "labelWidthWest");
+ assertTrue(labelWidth > 0);
+ x = labelWidth - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), -1);
+
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), 0);
+
+ /*
+ * x over right edge of last residue (including scale left)
+ */
+ int residuesWide = av.getRanges().getViewportWidth();
+ assertTrue(residuesWide > 0);
+ x = labelWidth + charWidth * residuesWide - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), residuesWide - 1);
+
+ /*
+ * x over scale right (beyond drawn columns) results in -1
+ */
+ av.setScaleRightWrapped(true);
+ alignFrame.alignPanel.updateLayout();
+ labelWidth = (int) PA.getValue(seqCanvas, "labelWidthEast");
+ assertTrue(labelWidth > 0);
+ int residuesWide2 = av.getRanges().getViewportWidth();
+ assertTrue(residuesWide2 > 0);
+ assertTrue(residuesWide2 < residuesWide); // available width reduced
+ x += 1; // just over left edge of scale right
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, 0, 0, 0,
+ 0, false, 0);
+ assertEquals(testee.findColumn(evt), -1);
+
+ // todo add startRes offset, hidden columns
+
+ }
+
@BeforeClass(alwaysRun = true)
public static void setUpBeforeClass() throws Exception
{
Cache.loadProperties("test/jalview/io/testProps.jvprops");
Jalview.main(new String[] { "-nonews" });
}
+
+ /**
+ * waits for Swing event dispatch queue to empty
+ */
+ synchronized void waitForSwing()
+ {
+ try
+ {
+ EventQueue.invokeAndWait(new Runnable()
+ {
+ @Override
+ public void run()
+ {
+ }
+ });
+ } catch (InterruptedException | InvocationTargetException e)
+ {
+ e.printStackTrace();
+ }
+ }
+
+ @Test(groups = "Functional")
+ public void testFindMousePosition_wrapped_scales_longSequence()
+ {
+ Cache.setPropertyNoSave("SHOW_ANNOTATIONS", "false");
+ Cache.setPropertyNoSave("WRAP_ALIGNMENT", "true");
+ Cache.setPropertyNoSave("FONT_SIZE", "14");
+ Cache.setPropertyNoSave("FONT_NAME", "SansSerif");
+ Cache.setPropertyNoSave("FONT_STYLE", "0");
+ // sequence of 50 bases, doubled 10 times, = 51200 bases
+ String dna = "ATGGCCATTGGGCCCAAATTTCCCAAAGGGTTTCCCTGAGGTCAGTCAGA";
+ for (int i = 0; i < 10; i++)
+ {
+ dna += dna;
+ }
+ assertEquals(dna.length(), 51200);
+ AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(dna,
+ DataSourceType.PASTE);
+ SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+ AlignViewport av = alignFrame.getViewport();
+ av.setScaleAboveWrapped(true);
+ av.setScaleLeftWrapped(true);
+ av.setScaleRightWrapped(true);
+ alignFrame.alignPanel.updateLayout();
+
+ try
+ {
+ Thread.sleep(200);
+ } catch (InterruptedException e)
+ {
+ }
+
+ final int charHeight = av.getCharHeight();
+ final int charWidth = av.getCharWidth();
+ assertEquals(charHeight, 17);
+ assertEquals(charWidth, 12);
+
+ FontMetrics fm = testee.getFontMetrics(av.getFont());
+ int labelWidth = fm.stringWidth("00000") + charWidth;
+ assertEquals(labelWidth, 57); // 5 x 9 + charWidth
+ assertEquals(testee.seqCanvas.getLabelWidthWest(), labelWidth);
+
+ int x = 0;
+ int y = 0;
+
+ /*
+ * mouse at top left of wrapped panel; there is a gap of 2 * charHeight
+ * above the alignment
+ */
+ MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0,
+ x, y, 0, 0, 0, false, 0);
+ MousePos pos = testee.findMousePosition(evt);
+ assertEquals(pos.column, -1); // over scale left, not an alignment column
+ assertEquals(pos.seqIndex, -1); // above sequences
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale above first sequence
+ */
+ y += charHeight;
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over scale left of first sequence
+ */
+ y += charHeight;
+ x = 0;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, -1);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * cursor over start of first sequence
+ */
+ x = labelWidth;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 0);
+ assertEquals(pos.annotationIndex, -1);
+
+ /*
+ * move one character right, to bottom pixel of same row
+ */
+ x += charWidth;
+ y += charHeight - 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one pixel - now in the no man's land between rows
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down two char heights less one pixel - still in the no man's land
+ * (scale above + spacer line)
+ */
+ y += (2 * charHeight - 1);
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, -1);
+ assertEquals(pos.column, 1);
+
+ /*
+ * move down one more pixel - now on the next row of the sequence
+ */
+ y += 1;
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ assertEquals(pos.column, 1 + av.getWrappedWidth());
+
+ /*
+ * scroll to near the end of the sequence
+ */
+ SearchResultsI sr = new SearchResults();
+ int scrollTo = dna.length() - 1000;
+ sr.addResult(av.getAlignment().getSequenceAt(0), scrollTo, scrollTo);
+ alignFrame.alignPanel.scrollToPosition(sr);
+
+ /*
+ * place the mouse on the first column of the 6th sequence, and
+ * verify that (computed) findMousePosition matches (actual) ViewportRanges
+ */
+ x = labelWidth;
+ y = 17 * charHeight; // 17 = 6 times two header rows and 5 sequence rows
+ evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0,
+ 0, false, 0);
+ pos = testee.findMousePosition(evt);
+ assertEquals(pos.seqIndex, 0);
+ int expected = av.getRanges().getStartRes() + 5 * av.getWrappedWidth();
+ assertEquals(pos.column, expected);
+ }
}