JAL-653 code tidy / tests for 'realise gff mappings'

[jalview.git] / test / jalview / io / ExonerateGffTest.java

diff --git a/test/jalview/io/ExonerateGffTest.java b/test/jalview/io/ExonerateGffTest.java
index 799eeed..70c0ec2 100644 (file)
--- a/test/jalview/io/ExonerateGffTest.java
+++ b/test/jalview/io/ExonerateGffTest.java
@@ -1,12 +1,15 @@
 package jalview.io;
 
 import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
 import jalview.datamodel.AlignedCodonFrame;
+import jalview.datamodel.Alignment;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.Mapping;
+import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceDummy;
 import jalview.datamodel.SequenceI;
 import jalview.gui.AlignFrame;
@@ -36,12 +39,13 @@ public class ExonerateGffTest
     String proteinSeq = ">prot1/10-16\nYCWRSGA";
     AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(
             proteinSeq, FormatAdapter.PASTE);
+
     /*
-     * exonerate map of residues 11-15 (CWRSG) to bases 10-24 in sequence 'dna1'
-     * starting at position 10 (forward strand)
+     * exonerate GFF output mapping residues 11-15 (CWRSG) 
+     * to bases 24-10 in sequence 'dna1' (reverse strand)
      */
     String exonerateGff = "##gff-version 2\n"
-            + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t+\t.\talignment_id 0 ; Target dna1 ; Align 11 10 5";
+            + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5";
     af.loadJalviewDataFile(exonerateGff, FormatAdapter.PASTE, null, null);
 
     /*
@@ -59,14 +63,26 @@ public class ExonerateGffTest
     assertEquals("dna1", mappedDna.getName());
     Mapping[] mapList = mapping.getProtMappings();
     assertEquals(1, mapList.length);
-    // 11 in protein should map to codon [10, 11, 12] in dna
+    // 11 in protein should map to codon [24, 23, 22] in dna
     int[] mappedRegion = mapList[0].getMap().locateInFrom(11, 11);
-    assertArrayEquals(new int[] { 10, 12 }, mappedRegion);
-    // 15 in protein should map to codon [22, 23, 24] in dna
+    assertArrayEquals(new int[] { 24, 22 }, mappedRegion);
+    // 15 in protein should map to codon [12, 11, 10] in dna
     mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
-    assertArrayEquals(new int[] { 22, 24 }, mappedRegion);
+    assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
 
     // so far so good; TODO: programmatically add mapped sequences
     // and verify the mappings are 'realised'
+    SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
+    AlignmentI al = new Alignment(new SequenceI[] { dna1 });
+    al.setDataset(null);
+
+    /*
+     * Now 'realise' the virtual mapping to the real DNA sequence;
+     * interactively this could be by a drag or fetch of the sequence data
+     */
+    mapping.realiseWith(dna1);
+    // verify the mapping is now from the real, not the dummy sequence
+    assertSame(dna1.getDatasetSequence(),
+            mapping.getDnaForAaSeq(dataset.getSequenceAt(0)));
   }
 }