+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io.gff;
import static org.testng.AssertJUnit.assertEquals;
import jalview.datamodel.SequenceDummy;
import jalview.datamodel.SequenceI;
import jalview.gui.AlignFrame;
+import jalview.gui.JvOptionPane;
+import jalview.io.DataSourceType;
import jalview.io.FileLoader;
-import jalview.io.FormatAdapter;
import java.util.List;
+import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
/**
*/
public class GffTests
{
+
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
/**
* Test the case where we load a protein ('query') sequence, then exonerateGff
* describing its mapping to cDNA, and then a DNA sequence including the
public void testResolveExonerateGff()
{
String proteinSeq = ">prot1/10-16\nYCWRSGA";
- AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(
- proteinSeq, FormatAdapter.PASTE);
+ AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(proteinSeq,
+ DataSourceType.PASTE);
/*
* exonerate GFF output mapping residues 11-15 (CWRSG)
*/
String exonerateGff = "##gff-version 2\n"
+ "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5";
- af.loadJalviewDataFile(exonerateGff, FormatAdapter.PASTE, null, null);
+ af.loadJalviewDataFile(exonerateGff, DataSourceType.PASTE, null, null);
/*
* check we have a mapping from prot1 to SequenceDummy 'dna1'
mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
- // so far so good; TODO: programmatically add mapped sequences
- // and verify the mappings are 'realised'
SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
AlignmentI al = new Alignment(new SequenceI[] { dna1 });
al.setDataset(null);