+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io.vcf;
+import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
import static org.testng.Assert.assertEquals;
-import static org.testng.Assert.fail;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertTrue;
+import jalview.bin.Cache;
+import jalview.bin.Console;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.Mapping;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureAttributes;
+import jalview.datamodel.features.SequenceFeatures;
import jalview.gui.AlignFrame;
import jalview.io.DataSourceType;
import jalview.io.FileLoader;
import jalview.io.gff.Gff3Helper;
-import jalview.io.gff.SequenceOntologyI;
import jalview.util.MapList;
import java.io.File;
import java.io.IOException;
import java.io.PrintWriter;
import java.util.List;
+import java.util.Map;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.BeforeTest;
import org.testng.annotations.Test;
public class VCFLoaderTest
{
- // columns 9717- of gene P30419 from Ensembl (modified)
- private static final String FASTA =
- // forward strand 'gene'
- ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+ private static final float DELTA = 0.00001f;
+
+ // columns 9717- of gene P30419 from Ensembl (much modified)
+ private static final String FASTA = "" +
+ /*
+ * forward strand 'gene' and 'transcript' with two exons
+ */
+ ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+ "CAAGCTGGCGGACGAGAGTGTGACA\n"
- // and a 'made up' mini-transcript with two exons
+ ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
- +
- // 'reverse strand' gene (reverse complement)
- ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
- + "TGTCACACTCTCGTCCGCCAGCTTG\n"
- // and its 'transcript'
- + ">transcript2/1-18\n"
- + "-GTCACACTCT----CGCCAGCT--\n";
+
+ /*
+ * reverse strand gene and transcript (reverse complement alleles!)
+ */
+ + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
+ + "TGTCACACTCTCGTCCGCCAGCTTG\n" + ">transcript2/1-18\n"
+ + "-GTCACACTCT----CGCCAGCT--\n"
+
+ /*
+ * 'gene' on chromosome 5 with two transcripts
+ */
+ + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
+ + "CAAGCTGGCGGACGAGAGTGTGACA\n"
+ + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+ + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
private static final String[] VCF = { "##fileformat=VCFv4.2",
+ // fields other than AF are ignored when parsing as they have no INFO
+ // definition
"##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
- "##reference=GRCh38",
+ "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
+ "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
+ "##reference=Homo_sapiens/GRCh38",
"#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
- // SNP A/T in position 2 of gene sequence (precedes transcript)
- "17\t45051611\t.\tA\tT\t1666.64\tRF\tAC=15;AF=5.08130e-03",
+ // A/T,C variants in position 2 of gene sequence (precedes transcript)
+ // should create 2 variant features with respective AF values
+ // malformed values for AC_Female and AF_AFR should be ignored
+ "17\t45051611\trs384765\tA\tT,C\t1666.64\tRF;XYZ\tAC=15;AF=5.0e-03,4.0e-03;AC_Female=12,3d;AF_AFR=low,2.3e-4",
// SNP G/C in position 4 of gene sequence, position 2 of transcript
- // this is a mixed variant, the insertion G/GA is not transferred
- "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.08130e-03" };
+ // insertion G/GA is transferred to nucleotide but not to peptide
+ "17\t45051613\t.\tG\tGA,C\t1666.65\t.\tAC=15;AF=3.0e-03,2.0e-03",
+ // '.' in INFO field should be ignored
+ "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
+
+ @BeforeClass(alwaysRun = true)
+ public void setUp()
+ {
+ /*
+ * configure to capture all available VCF and VEP (CSQ) fields
+ */
+ Cache.loadProperties("test/jalview/io/testProps.jvprops");
+ Cache.setProperty("VCF_FIELDS", ".*");
+ Cache.setProperty("VEP_FIELDS", ".*");
+ Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
+ Console.initLogger();
+ }
+
+ @BeforeTest(alwaysRun = true)
+ public void setUpBeforeTest()
+ {
+ /*
+ * clear down feature attributes metadata
+ */
+ FeatureAttributes.getInstance().clear();
+ }
@Test(groups = "Functional")
public void testDoLoad() throws IOException
{
AlignmentI al = buildAlignment();
- VCFLoader loader = new VCFLoader(al);
- File f = makeVcf();
+ File f = makeVcfFile();
+ VCFLoader loader = new VCFLoader(f.getPath());
- loader.doLoad(f.getPath(), null);
+ loader.doLoad(al.getSequencesArray(), null);
/*
* verify variant feature(s) added to gene
+ * NB alleles at a locus may not be processed, and features added,
+ * in the order in which they appear in the VCF record as method
+ * VariantContext.getAlternateAlleles() does not guarantee order
+ * - order of assertions here matches what we find (is not important)
*/
List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
.getSequenceFeatures();
- assertEquals(geneFeatures.size(), 2);
+ SequenceFeatures.sortFeatures(geneFeatures, true);
+ assertEquals(geneFeatures.size(), 5);
SequenceFeature sf = geneFeatures.get(0);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
- assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue("AF"), "4.0e-03");
+ assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getValue("POS"), "45051611");
+ assertEquals(sf.getValue("ID"), "rs384765");
+ assertEquals(sf.getValue("QUAL"), "1666.64");
+ assertEquals(sf.getValue("FILTER"), "RF;XYZ");
+ // malformed integer for AC_Female is ignored (JAL-3375)
+ assertNull(sf.getValue("AC_Female"));
sf = geneFeatures.get(1);
assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 2);
+ assertEquals(sf.getEnd(), 2);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
+ DELTA);
+ assertEquals(sf.getValue("AC_Female"), "12");
+ // malformed float for AF_AFR is ignored (JAL-3375)
+ assertNull(sf.getValue("AC_AFR"));
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
+
+ sf = geneFeatures.get(2);
+ assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 4);
assertEquals(sf.getEnd(), 4);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+ DELTA);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+
+ sf = geneFeatures.get(3);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 4);
+ assertEquals(sf.getEnd(), 4);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+ DELTA);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+ assertNull(sf.getValue("ID")); // '.' is ignored
+ assertNull(sf.getValue("FILTER")); // '.' is ignored
+
+ sf = geneFeatures.get(4);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 6);
+ assertEquals(sf.getEnd(), 6);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ // AF=. should not have been captured
+ assertNull(sf.getValue("AF"));
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
/*
*/
List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
.getSequenceFeatures();
- assertEquals(transcriptFeatures.size(), 1);
+ assertEquals(transcriptFeatures.size(), 3);
sf = transcriptFeatures.get(0);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+ DELTA);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+ sf = transcriptFeatures.get(1);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 2);
+ assertEquals(sf.getEnd(), 2);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+ DELTA);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
/*
- * verify variant feature(s) computed and added to protein
+ * verify SNP variant feature(s) computed and added to protein
* first codon AGC varies to ACC giving S/T
*/
- DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
+ List<DBRefEntry> dbRefs = al.getSequenceAt(1).getDBRefs();
SequenceI peptide = null;
for (DBRefEntry dbref : dbRefs)
{
}
}
List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
- assertEquals(proteinFeatures.size(), 1);
- sf = proteinFeatures.get(0);
- assertEquals(sf.getFeatureGroup(), "VCF");
- assertEquals(sf.getBegin(), 1);
- assertEquals(sf.getEnd(), 1);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getDescription(), "p.Ser1Thr");
+
+ /*
+ * JAL-3187 don't precompute protein features, do dynamically instead
+ */
+ assertTrue(proteinFeatures.isEmpty());
}
- private File makeVcf() throws IOException
+ private File makeVcfFile() throws IOException
{
File f = File.createTempFile("Test", ".vcf");
f.deleteOnExit();
* from Ensembl and transcripts computed)
*/
AlignmentI alignment = af.getViewport().getAlignment();
- SequenceI gene1 = alignment.getSequenceAt(0);
+ SequenceI gene1 = alignment.findName("gene1");
int[] to = new int[] { 45051610, 45051634 };
int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
- gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
+ gene1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+ new MapList(from, to, 1, 1));
/*
* map 'transcript1' to chromosome via 'gene1'
* which is chromosome 45051612-45051619,45051624-45051633
*/
to = new int[] { 45051612, 45051619, 45051624, 45051633 };
- SequenceI transcript1 = alignment.getSequenceAt(1);
+ SequenceI transcript1 = alignment.findName("transcript1");
from = new int[] { transcript1.getStart(), transcript1.getEnd() };
- transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
- 1, 1));
+ transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17",
+ new MapList(from, to, 1, 1));
/*
* map gene2 to chromosome reverse strand
*/
- SequenceI gene2 = alignment.getSequenceAt(2);
+ SequenceI gene2 = alignment.findName("gene2");
to = new int[] { 45051634, 45051610 };
from = new int[] { gene2.getStart(), gene2.getEnd() };
- gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1));
+ gene2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+ new MapList(from, to, 1, 1));
/*
* map 'transcript2' to chromosome via 'gene2'
* which is chromosome 45051633-45051624,45051619-45051612
*/
to = new int[] { 45051633, 45051624, 45051619, 45051612 };
- SequenceI transcript2 = alignment.getSequenceAt(3);
+ SequenceI transcript2 = alignment.findName("transcript2");
from = new int[] { transcript2.getStart(), transcript2.getEnd() };
- transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to,
- 1, 1));
+ transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17",
+ new MapList(from, to, 1, 1));
/*
* add a protein product as a DBRef on transcript1
product = new DBRefEntry("", "", "ENSP002", map);
transcript2.addDBRef(product);
+ /*
+ * map gene3 to chromosome
+ */
+ SequenceI gene3 = alignment.findName("gene3");
+ to = new int[] { 45051610, 45051634 };
+ from = new int[] { gene3.getStart(), gene3.getEnd() };
+ gene3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+ new MapList(from, to, 1, 1));
+
+ /*
+ * map 'transcript3' to chromosome
+ */
+ SequenceI transcript3 = alignment.findName("transcript3");
+ to = new int[] { 45051612, 45051619, 45051624, 45051633 };
+ from = new int[] { transcript3.getStart(), transcript3.getEnd() };
+ transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5",
+ new MapList(from, to, 1, 1));
+
+ /*
+ * map 'transcript4' to chromosome
+ */
+ SequenceI transcript4 = alignment.findName("transcript4");
+ to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
+ 45051634 };
+ from = new int[] { transcript4.getStart(), transcript4.getEnd() };
+ transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5",
+ new MapList(from, to, 1, 1));
+
+ /*
+ * add a protein product as a DBRef on transcript3
+ */
+ SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
+ mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
+ map = new Mapping(peptide3, mapList);
+ product = new DBRefEntry("", "", "ENSP003", map);
+ transcript3.addDBRef(product);
+
return alignment;
}
{
AlignmentI al = buildAlignment();
- VCFLoader loader = new VCFLoader(al);
+ File f = makeVcfFile();
- File f = makeVcf();
+ VCFLoader loader = new VCFLoader(f.getPath());
- loader.doLoad(f.getPath(), null);
+ loader.doLoad(al.getSequencesArray(), null);
/*
* verify variant feature(s) added to gene2
- * gene/1-25 maps to chromosome 45051634- reverse strand
- * variants A/T at 45051611 and G/C at 45051613 map to
- * T/A and C/G at gene positions 24 and 22 respectively
+ * gene2/1-25 maps to chromosome 45051634- reverse strand
*/
List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
.getSequenceFeatures();
- assertEquals(geneFeatures.size(), 2);
- SequenceFeature sf = geneFeatures.get(0);
+ SequenceFeatures.sortFeatures(geneFeatures, true);
+ assertEquals(geneFeatures.size(), 5);
+ SequenceFeature sf;
+
+ /*
+ * insertion G/GA at 45051613 maps to an insertion at
+ * the preceding position (21) on reverse strand gene
+ * reference: CAAGC -> GCTTG/21-25
+ * genomic variant: CAAGAC (G/GA)
+ * gene variant: GTCTTG (G/GT at 21)
+ */
+ sf = geneFeatures.get(1);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 21);
+ assertEquals(sf.getEnd(), 21);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+ DELTA);
+
+ /*
+ * variant G/C at 45051613 maps to C/G at gene position 22
+ */
+ sf = geneFeatures.get(2);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 22);
assertEquals(sf.getEnd(), 22);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
- assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+ DELTA);
- sf = geneFeatures.get(1);
+ /*
+ * variant A/C at 45051611 maps to T/G at gene position 24
+ */
+ sf = geneFeatures.get(3);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 24);
assertEquals(sf.getEnd(), 24);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
- assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES));
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
+ DELTA);
/*
- * verify variant feature(s) added to transcript2
- * variant C/G at position 22 of gene overlaps and maps to
- * position 17 of transcript
+ * variant A/T at 45051611 maps to T/A at gene position 24
+ */
+ sf = geneFeatures.get(4);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 24);
+ assertEquals(sf.getEnd(), 24);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
+ DELTA);
+
+ /*
+ * verify 3 variant features added to transcript2
*/
List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
.getSequenceFeatures();
- assertEquals(transcriptFeatures.size(), 1);
- sf = transcriptFeatures.get(0);
+ assertEquals(transcriptFeatures.size(), 3);
+
+ /*
+ * insertion G/GT at position 21 of gene maps to position 16 of transcript
+ */
+ sf = transcriptFeatures.get(1);
+ assertEquals(sf.getFeatureGroup(), "VCF");
+ assertEquals(sf.getBegin(), 16);
+ assertEquals(sf.getEnd(), 16);
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+ DELTA);
+
+ /*
+ * SNP C/G at position 22 of gene maps to position 17 of transcript
+ */
+ sf = transcriptFeatures.get(2);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 17);
assertEquals(sf.getEnd(), 17);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
- assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
+ assertEquals(sf.getType(), SEQUENCE_VARIANT);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+ DELTA);
/*
* verify variant feature(s) computed and added to protein
* last codon GCT varies to GGT giving A/G in the last peptide position
*/
- DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
+ List<DBRefEntry> dbRefs = al.getSequenceAt(3).getDBRefs();
SequenceI peptide = null;
for (DBRefEntry dbref : dbRefs)
{
}
}
List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
- assertEquals(proteinFeatures.size(), 1);
- sf = proteinFeatures.get(0);
- assertEquals(sf.getFeatureGroup(), "VCF");
- assertEquals(sf.getBegin(), 6);
- assertEquals(sf.getEnd(), 6);
- assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
- assertEquals(sf.getDescription(), "p.Ala6Gly");
+
+ /*
+ * JAL-3187 don't precompute protein features, do dynamically instead
+ */
+ assertTrue(proteinFeatures.isEmpty());
}
/**
- * Tests that where variant records have more than one SNP allele, a variant
- * feature is created for each, and the corresponding data values set on it
+ * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
+ * it is added to the variant feature, but restricted where possible to the
+ * consequences for a specific transcript
*
* @throws IOException
*/
@Test(groups = "Functional")
- public void testDoLoad_multipleAlleles() throws IOException
+ public void testDoLoad_vepCsq() throws IOException
{
- fail("todo");
+ AlignmentI al = buildAlignment();
+
+ VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
+
+ /*
+ * VCF data file with variants at gene3 positions
+ * 1 C/A
+ * 5 C/T
+ * 9 CGT/C (deletion)
+ * 13 C/G, C/T
+ * 17 A/AC (insertion), A/G
+ */
+ loader.doLoad(al.getSequencesArray(), null);
+
+ /*
+ * verify variant feature(s) added to gene3
+ */
+ List<SequenceFeature> geneFeatures = al.findName("gene3")
+ .getSequenceFeatures();
+ SequenceFeatures.sortFeatures(geneFeatures, true);
+ assertEquals(geneFeatures.size(), 7);
+ SequenceFeature sf = geneFeatures.get(0);
+ assertEquals(sf.getBegin(), 1);
+ assertEquals(sf.getEnd(), 1);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,A");
+ // gene features include Consequence for all transcripts
+ Map map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+ assertEquals(map.get("PolyPhen"), "Bad");
+
+ sf = geneFeatures.get(1);
+ assertEquals(sf.getBegin(), 5);
+ assertEquals(sf.getEnd(), 5);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,T");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+ assertEquals(map.get("PolyPhen"), "Bad;;"); // %3B%3B decoded
+
+ sf = geneFeatures.get(2);
+ assertEquals(sf.getBegin(), 9);
+ assertEquals(sf.getEnd(), 11); // deletion over 3 positions
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
+ assertEquals(sf.getValue("alleles"), "CGG,C");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+
+ sf = geneFeatures.get(3);
+ assertEquals(sf.getBegin(), 13);
+ assertEquals(sf.getEnd(), 13);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,T");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+
+ sf = geneFeatures.get(4);
+ assertEquals(sf.getBegin(), 13);
+ assertEquals(sf.getEnd(), 13);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,G");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+
+ sf = geneFeatures.get(5);
+ assertEquals(sf.getBegin(), 17);
+ assertEquals(sf.getEnd(), 17);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,G");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+
+ sf = geneFeatures.get(6);
+ assertEquals(sf.getBegin(), 17);
+ assertEquals(sf.getEnd(), 17); // insertion
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,AC");
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+
+ /*
+ * verify variant feature(s) added to transcript3
+ * at columns 5 (1), 17 (2), positions 3, 11
+ * note the deletion at columns 9-11 is not transferred since col 11
+ * has no mapping to transcript 3
+ */
+ List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
+ .getSequenceFeatures();
+ SequenceFeatures.sortFeatures(transcriptFeatures, true);
+ assertEquals(transcriptFeatures.size(), 3);
+ sf = transcriptFeatures.get(0);
+ assertEquals(sf.getBegin(), 3);
+ assertEquals(sf.getEnd(), 3);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,T");
+ // transcript features only have Consequence for that transcripts
+ map = (Map) sf.getValue("CSQ");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+ sf = transcriptFeatures.get(1);
+ assertEquals(sf.getBegin(), 11);
+ assertEquals(sf.getEnd(), 11);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,G");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+ sf = transcriptFeatures.get(2);
+ assertEquals(sf.getBegin(), 11);
+ assertEquals(sf.getEnd(), 11);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,AC");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+ /*
+ * verify variants computed on protein product for transcript3
+ * peptide is SWRECD
+ * codon variants are AGC/AGT position 1 which is synonymous
+ * and GAG/GGG which is E/G in position 4
+ * the insertion variant is not transferred to the peptide
+ */
+ List<DBRefEntry> dbRefs = al.findName("transcript3").getDBRefs();
+ SequenceI peptide = null;
+ for (DBRefEntry dbref : dbRefs)
+ {
+ if (dbref.getMap().getMap().getFromRatio() == 3)
+ {
+ peptide = dbref.getMap().getTo();
+ }
+ }
+ List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
+ /*
+ * JAL-3187 don't precompute protein features, do dynamically instead
+ */
+ assertTrue(proteinFeatures.isEmpty());
+ // SequenceFeatures.sortFeatures(proteinFeatures, true);
+ // assertEquals(proteinFeatures.size(), 2);
+ // sf = proteinFeatures.get(0);
+ // assertEquals(sf.getFeatureGroup(), "VCF");
+ // assertEquals(sf.getBegin(), 1);
+ // assertEquals(sf.getEnd(), 1);
+ // assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
+ // assertEquals(sf.getDescription(), "agC/agT");
+ // sf = proteinFeatures.get(1);
+ // assertEquals(sf.getFeatureGroup(), "VCF");
+ // assertEquals(sf.getBegin(), 4);
+ // assertEquals(sf.getEnd(), 4);
+ // assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+ // assertEquals(sf.getDescription(), "p.Glu4Gly");
+
+ /*
+ * verify variant feature(s) added to transcript4
+ * at columns 13 (2) and 17 (2), positions 7 and 11
+ */
+ transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
+ SequenceFeatures.sortFeatures(transcriptFeatures, true);
+ assertEquals(transcriptFeatures.size(), 4);
+ sf = transcriptFeatures.get(0);
+ assertEquals(sf.getBegin(), 7);
+ assertEquals(sf.getEnd(), 7);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,T");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+ sf = transcriptFeatures.get(1);
+ assertEquals(sf.getBegin(), 7);
+ assertEquals(sf.getEnd(), 7);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
+ assertEquals(sf.getValue("alleles"), "C,G");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+ sf = transcriptFeatures.get(2);
+ assertEquals(sf.getBegin(), 11);
+ assertEquals(sf.getEnd(), 11);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,G");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+ sf = transcriptFeatures.get(3);
+ assertEquals(sf.getBegin(), 11);
+ assertEquals(sf.getEnd(), 11);
+ assertEquals(sf.getScore(), 0f);
+ assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+ assertEquals(sf.getValue("alleles"), "A,AC");
+ assertEquals(map.size(), 9);
+ assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
}
/**
- * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
- * it is added to the variant feature, but restricted where possible to the
- * consequences for a specific transcript
+ * A test that demonstrates loading a contig sequence from an indexed sequence
+ * database which is the reference for a VCF file
*
* @throws IOException
*/
@Test(groups = "Functional")
- public void testDoLoad_vepCsq() throws IOException
+ public void testLoadVCFContig() throws IOException
{
- fail("todo");
+ VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf2.vcf");
+
+ SequenceI seq = loader.loadVCFContig("contig123");
+ assertEquals(seq.getLength(), 15);
+ assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
+ List<SequenceFeature> features = seq.getSequenceFeatures();
+ SequenceFeatures.sortFeatures(features, true);
+ assertEquals(features.size(), 2);
+ SequenceFeature sf = features.get(0);
+ assertEquals(sf.getBegin(), 8);
+ assertEquals(sf.getEnd(), 8);
+ assertEquals(sf.getDescription(), "C,A");
+ sf = features.get(1);
+ assertEquals(sf.getBegin(), 12);
+ assertEquals(sf.getEnd(), 12);
+ assertEquals(sf.getDescription(), "G,T");
+
+ seq = loader.loadVCFContig("contig789");
+ assertEquals(seq.getLength(), 25);
+ assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
+ features = seq.getSequenceFeatures();
+ SequenceFeatures.sortFeatures(features, true);
+ assertEquals(features.size(), 2);
+ sf = features.get(0);
+ assertEquals(sf.getBegin(), 2);
+ assertEquals(sf.getEnd(), 2);
+ assertEquals(sf.getDescription(), "G,T");
+ sf = features.get(1);
+ assertEquals(sf.getBegin(), 21);
+ assertEquals(sf.getEnd(), 21);
+ assertEquals(sf.getDescription(), "G,A");
+
+ seq = loader.loadVCFContig("contig456");
+ assertEquals(seq.getLength(), 20);
+ assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
+ features = seq.getSequenceFeatures();
+ SequenceFeatures.sortFeatures(features, true);
+ assertEquals(features.size(), 1);
+ sf = features.get(0);
+ assertEquals(sf.getBegin(), 15);
+ assertEquals(sf.getEnd(), 15);
+ assertEquals(sf.getDescription(), "T,C");
}
-}
+}
\ No newline at end of file