import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
-import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
+
+import java.awt.Color;
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Iterator;
+import java.util.List;
+
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
import jalview.api.AlignViewportI;
import jalview.commands.EditCommand;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.ColumnSelection;
-import jalview.datamodel.SearchResults;
-import jalview.datamodel.SearchResults.Match;
+import jalview.datamodel.HiddenColumns;
+import jalview.datamodel.SearchResultMatchI;
+import jalview.datamodel.SearchResultsI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceGroup;
import jalview.datamodel.SequenceI;
import jalview.gui.AlignViewport;
-import jalview.io.AppletFormatAdapter;
+import jalview.gui.JvOptionPane;
+import jalview.io.DataSourceType;
+import jalview.io.FileFormat;
+import jalview.io.FileFormatI;
import jalview.io.FormatAdapter;
-import java.awt.Color;
-import java.io.IOException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.List;
-
-import org.testng.annotations.Test;
-
public class MappingUtilsTest
{
+
+ @BeforeClass(alwaysRun = true)
+ public void setUpJvOptionPane()
+ {
+ JvOptionPane.setInteractiveMode(false);
+ JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
+ }
+
private AlignViewportI dnaView;
private AlignViewportI proteinView;
MapList map = new MapList(new int[] { 5, 10 }, new int[] { 12, 13 }, 3,
1);
acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map);
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
/*
* Check protein residue 12 maps to codon 5-7, 13 to codon 8-10
*/
- SearchResults sr = MappingUtils.buildSearchResults(aseq1, 12, acfList);
+ SearchResultsI sr = MappingUtils.buildSearchResults(aseq1, 12, acfList);
assertEquals(1, sr.getResults().size());
- Match m = sr.getResults().get(0);
+ SearchResultMatchI m = sr.getResults().get(0);
assertEquals(seq1.getDatasetSequence(), m.getSequence());
assertEquals(5, m.getStart());
assertEquals(7, m.getEnd());
* Map dna bases [6, 8, 9], [11, 13, 115] to protein residues 8 and 9
*/
AlignedCodonFrame acf = new AlignedCodonFrame();
- MapList map = new MapList(new int[] { 6, 6, 8, 9, 11, 11, 13, 13, 15,
- 15 }, new int[] { 8, 9 }, 3, 1);
+ MapList map = new MapList(
+ new int[]
+ { 6, 6, 8, 9, 11, 11, 13, 13, 15, 15 }, new int[] { 8, 9 }, 3,
+ 1);
acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map);
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
/*
* Check protein residue 8 maps to [6, 8, 9]
*/
- SearchResults sr = MappingUtils.buildSearchResults(aseq1, 8, acfList);
+ SearchResultsI sr = MappingUtils.buildSearchResults(aseq1, 8, acfList);
assertEquals(2, sr.getResults().size());
- Match m = sr.getResults().get(0);
+ SearchResultMatchI m = sr.getResults().get(0);
assertEquals(seq1.getDatasetSequence(), m.getSequence());
assertEquals(6, m.getStart());
assertEquals(6, m.getEnd());
for (int i = 5; i < 18; i++)
{
sr = MappingUtils.buildSearchResults(seq1, i, acfList);
- int residue = (i == 6 || i == 8 || i == 9) ? 8 : (i == 11 || i == 13
- || i == 15 ? 9 : 0);
+ int residue = (i == 6 || i == 8 || i == 9) ? 8
+ : (i == 11 || i == 13 || i == 15 ? 9 : 0);
if (residue == 0)
{
assertEquals(0, sr.getResults().size());
* viewport).
*/
AlignmentI cdna = loadAlignment(">Seq1\nACG\n>Seq2\nTGA\n>Seq3\nTAC\n",
- "FASTA");
+ FileFormat.Fasta);
cdna.setDataset(null);
AlignmentI protein = loadAlignment(">Seq1\nK\n>Seq2\nL\n>Seq3\nQ\n",
- "FASTA");
+ FileFormat.Fasta);
protein.setDataset(null);
AlignedCodonFrame acf = new AlignedCodonFrame();
MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 1 }, 3, 1);
for (int seq = 0; seq < 3; seq++)
{
- acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
- .getSequenceAt(seq).getDatasetSequence(), map);
+ acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+ protein.getSequenceAt(seq).getDatasetSequence(), map);
}
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
AlignViewportI dnaView = new AlignViewport(cdna);
AlignViewportI proteinView = new AlignViewport(protein);
protein.setCodonFrames(acfList);
/*
- * Select Seq1 and Seq3 in the protein (startRes=endRes=0)
+ * Select Seq1 and Seq3 in the protein
*/
SequenceGroup sg = new SequenceGroup();
sg.setColourText(true);
sg.setOutlineColour(Color.LIGHT_GRAY);
sg.addSequence(protein.getSequenceAt(0), false);
sg.addSequence(protein.getSequenceAt(2), false);
+ sg.setEndRes(protein.getWidth() - 1);
/*
* Verify the mapped sequence group in dna
assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0));
assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1));
assertEquals(0, mappedGroup.getStartRes());
- assertEquals(2, mappedGroup.getEndRes());
+ assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon)
/*
* Verify mapping sequence group from dna to protein
* @return
* @throws IOException
*/
- protected AlignmentI loadAlignment(final String data, String format)
+ protected AlignmentI loadAlignment(final String data, FileFormatI format)
throws IOException
{
- AlignmentI a = new FormatAdapter().readFile(data,
- AppletFormatAdapter.PASTE, format);
+ AlignmentI a = new FormatAdapter().readFile(data, DataSourceType.PASTE,
+ format);
a.setDataset(null);
return a;
}
setupMappedAlignments();
ColumnSelection colsel = new ColumnSelection();
+ HiddenColumns hidden = new HiddenColumns();
/*
* Column 0 in protein picks up Seq2/L, Seq3/G which map to cols 0-4 and 0-3
* in dna respectively, overall 0-4
*/
colsel.addElement(0);
- ColumnSelection cs = MappingUtils.mapColumnSelection(colsel,
- proteinView, dnaView);
+ ColumnSelection cs = new ColumnSelection();
+ HiddenColumns hs = new HiddenColumns();
+ MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+ cs, hs);
assertEquals("[0, 1, 2, 3, 4]", cs.getSelected().toString());
/*
* Column 1 in protein picks up Seq1/K which maps to cols 0-3 in dna
*/
+ cs.clear();
colsel.clear();
colsel.addElement(1);
- cs = MappingUtils.mapColumnSelection(colsel, proteinView, dnaView);
+ MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+ cs, hs);
assertEquals("[0, 1, 2, 3]", cs.getSelected().toString());
/*
* Column 2 in protein picks up gaps only - no mapping
*/
+ cs.clear();
colsel.clear();
colsel.addElement(2);
- cs = MappingUtils.mapColumnSelection(colsel, proteinView, dnaView);
+ MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+ cs, hs);
assertEquals("[]", cs.getSelected().toString());
/*
* Column 3 in protein picks up Seq1/P, Seq2/Q, Seq3/S which map to columns
* 6-9, 6-10, 5-8 respectively, overall to 5-10
*/
+ cs.clear();
colsel.clear();
colsel.addElement(3);
- cs = MappingUtils.mapColumnSelection(colsel, proteinView, dnaView);
+ MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+ cs, hs);
assertEquals("[5, 6, 7, 8, 9, 10]", cs.getSelected().toString());
/*
* Combine selection of columns 1 and 3 to get a discontiguous mapped
* selection
*/
+ cs.clear();
colsel.clear();
colsel.addElement(1);
colsel.addElement(3);
- cs = MappingUtils.mapColumnSelection(colsel, proteinView, dnaView);
- assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]", cs.getSelected()
- .toString());
+ MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+ cs, hs);
+ assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]",
+ cs.getSelected().toString());
}
/**
*/
AlignmentI cdna = loadAlignment(">Seq1/10-18\nAC-GctGtC-T\n"
+ ">Seq2/20-27\nTc-GA-G-T-Tc\n" + ">Seq3/30-38\nTtTT-AaCGg-\n",
- "FASTA");
+ FileFormat.Fasta);
cdna.setDataset(null);
AlignmentI protein = loadAlignment(
">Seq1/40-41\n-K-P\n>Seq2/50-51\nL--Q\n>Seq3/60-61\nG--S\n",
- "FASTA");
+ FileFormat.Fasta);
protein.setDataset(null);
// map first dna to first protein seq
AlignedCodonFrame acf = new AlignedCodonFrame();
MapList map = new MapList(new int[] { 10, 12, 15, 15, 17, 18 },
- new int[] { 40, 41 }, 3, 1);
- acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(), protein
- .getSequenceAt(0).getDatasetSequence(), map);
+ new int[]
+ { 40, 41 }, 3, 1);
+ acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(),
+ protein.getSequenceAt(0).getDatasetSequence(), map);
// map second dna to second protein seq
- map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 }, new int[] { 50,
- 51 }, 3, 1);
- acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(), protein
- .getSequenceAt(1).getDatasetSequence(), map);
+ map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 },
+ new int[]
+ { 50, 51 }, 3, 1);
+ acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(),
+ protein.getSequenceAt(1).getDatasetSequence(), map);
// map third dna to third protein seq
- map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 }, new int[] { 60,
- 61 }, 3, 1);
- acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(), protein
- .getSequenceAt(2).getDatasetSequence(), map);
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 },
+ new int[]
+ { 60, 61 }, 3, 1);
+ acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(),
+ protein.getSequenceAt(2).getDatasetSequence(), map);
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
dnaView = new AlignViewport(cdna);
proteinView = new AlignViewport(protein);
setupMappedAlignments();
ColumnSelection colsel = new ColumnSelection();
+ HiddenColumns hidden = new HiddenColumns();
/*
* Column 0 in dna picks up first bases which map to residue 1, columns 0-1
* in protein.
*/
+ ColumnSelection cs = new ColumnSelection();
+ HiddenColumns hs = new HiddenColumns();
colsel.addElement(0);
- ColumnSelection cs = MappingUtils.mapColumnSelection(colsel, dnaView,
- proteinView);
+ MappingUtils.mapColumnSelection(colsel, hidden, dnaView, proteinView,
+ cs, hs);
assertEquals("[0, 1]", cs.getSelected().toString());
/*
colsel.addElement(3);
colsel.addElement(4);
colsel.addElement(5);
- cs = MappingUtils.mapColumnSelection(colsel, dnaView, proteinView);
+ cs.clear();
+ MappingUtils.mapColumnSelection(colsel, hidden, dnaView, proteinView,
+ cs, hs);
assertEquals("[0, 1, 3]", cs.getSelected().toString());
}
public void testMapColumnSelection_null() throws IOException
{
setupMappedAlignments();
- ColumnSelection cs = MappingUtils.mapColumnSelection(null, dnaView,
- proteinView);
+ ColumnSelection cs = new ColumnSelection();
+ HiddenColumns hs = new HiddenColumns();
+ MappingUtils.mapColumnSelection(null, null, dnaView, proteinView, cs,
+ hs);
assertTrue("mapped selection not empty", cs.getSelected().isEmpty());
}
public void testFlattenRanges()
{
assertEquals("[1, 2, 3, 4]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4 })));
- assertEquals(
- "[1, 2, 3, 4]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 2, 3,
- 4 })));
- assertEquals(
- "[1, 2, 3, 4]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 1, 2,
- 2, 3, 3, 4, 4 })));
- assertEquals(
- "[1, 2, 3, 4, 7, 8, 9, 12]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7,
- 9, 12, 12 })));
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 1, 4 })));
+ assertEquals("[1, 2, 3, 4]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 1, 2, 3, 4 })));
+ assertEquals("[1, 2, 3, 4]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 1, 1, 2, 2, 3, 3, 4, 4 })));
+ assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 1, 4, 7, 9, 12, 12 })));
// trailing unpaired start position is ignored:
- assertEquals(
- "[1, 2, 3, 4, 7, 8, 9, 12]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7,
- 9, 12, 12, 15 })));
+ assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 1, 4, 7, 9, 12, 12, 15 })));
}
/**
* viewport).
*/
AlignmentI cdna = loadAlignment(
- ">Seq1\nACGGCA\n>Seq2\nTGACAG\n>Seq3\nTACGTA\n", "FASTA");
+ ">Seq1\nACGGCA\n>Seq2\nTGACAG\n>Seq3\nTACGTA\n",
+ FileFormat.Fasta);
cdna.setDataset(null);
AlignmentI protein = loadAlignment(">Seq1\nKA\n>Seq2\nLQ\n>Seq3\nQV\n",
- "FASTA");
+ FileFormat.Fasta);
protein.setDataset(null);
AlignedCodonFrame acf = new AlignedCodonFrame();
MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1);
for (int seq = 0; seq < 3; seq++)
{
- acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
- .getSequenceAt(seq).getDatasetSequence(), map);
+ acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+ protein.getSequenceAt(seq).getDatasetSequence(), map);
}
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
AlignViewportI dnaView = new AlignViewport(cdna);
AlignViewportI proteinView = new AlignViewport(protein);
*/
AlignmentI cdna = loadAlignment(
">Seq1\nA-CG-GC--AT-CA\n>Seq2\n-TG-AC-AG-T-AT\n>Seq3\n-T--ACG-TAAT-G\n",
- "FASTA");
+ FileFormat.Fasta);
cdna.setDataset(null);
AlignmentI protein = loadAlignment(
- ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", "FASTA");
+ ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n",
+ FileFormat.Fasta);
protein.setDataset(null);
AlignedCodonFrame acf = new AlignedCodonFrame();
MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
for (int seq = 0; seq < 3; seq++)
{
- acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
- .getSequenceAt(seq).getDatasetSequence(), map);
+ acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+ protein.getSequenceAt(seq).getDatasetSequence(), map);
}
- List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
- { acf });
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
AlignViewportI dnaView = new AlignViewport(cdna);
AlignViewportI proteinView = new AlignViewport(protein);
AlignedCodonFrame acf3 = new AlignedCodonFrame();
acf3.addMap(seq3.getDatasetSequence(), seq1.getDatasetSequence(), map);
- List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ List<AlignedCodonFrame> mappings = new ArrayList<>();
mappings.add(acf1);
mappings.add(acf2);
mappings.add(acf3);
/*
* Seq1 has three mappings
*/
- List<AlignedCodonFrame> result = MappingUtils.findMappingsForSequence(
- seq1, mappings);
+ List<AlignedCodonFrame> result = MappingUtils
+ .findMappingsForSequence(seq1, mappings);
assertEquals(3, result.size());
assertTrue(result.contains(acf1));
assertTrue(result.contains(acf2));
assertEquals(0, result.size());
}
+ /**
+ * just like the one above, but this time, we provide a set of sequences to
+ * subselect the mapping search
+ */
+ @Test(groups = { "Functional" })
+ public void testFindMappingsForSequenceAndOthers()
+ {
+ SequenceI seq1 = new Sequence("Seq1", "ABC");
+ SequenceI seq2 = new Sequence("Seq2", "ABC");
+ SequenceI seq3 = new Sequence("Seq3", "ABC");
+ SequenceI seq4 = new Sequence("Seq4", "ABC");
+ seq1.createDatasetSequence();
+ seq2.createDatasetSequence();
+ seq3.createDatasetSequence();
+ seq4.createDatasetSequence();
+
+ /*
+ * Create mappings from seq1 to seq2, seq2 to seq1, seq3 to seq1, seq3 to seq4
+ */
+ AlignedCodonFrame acf1 = new AlignedCodonFrame();
+ MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 3 }, 1, 1);
+ acf1.addMap(seq1.getDatasetSequence(), seq2.getDatasetSequence(), map);
+ AlignedCodonFrame acf2 = new AlignedCodonFrame();
+ acf2.addMap(seq2.getDatasetSequence(), seq1.getDatasetSequence(), map);
+ AlignedCodonFrame acf3 = new AlignedCodonFrame();
+ acf3.addMap(seq3.getDatasetSequence(), seq1.getDatasetSequence(), map);
+ AlignedCodonFrame acf4 = new AlignedCodonFrame();
+ acf4.addMap(seq3.getDatasetSequence(), seq4.getDatasetSequence(), map);
+
+ List<AlignedCodonFrame> mappings = new ArrayList<>();
+ mappings.add(acf1);
+ mappings.add(acf2);
+ mappings.add(acf3);
+ mappings.add(acf4);
+
+ /*
+ * test for null args
+ */
+ List<AlignedCodonFrame> result = MappingUtils
+ .findMappingsForSequenceAndOthers(null, mappings,
+ Arrays.asList(new SequenceI[]
+ { seq1, seq2 }));
+ assertTrue(result.isEmpty());
+
+ result = MappingUtils.findMappingsForSequenceAndOthers(seq1, null,
+ Arrays.asList(new SequenceI[]
+ { seq1, seq2 }));
+ assertTrue(result.isEmpty());
+
+ /*
+ * Seq1 has three mappings, but filter argument will only accept
+ * those to seq2
+ */
+ result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings,
+ Arrays.asList(new SequenceI[]
+ { seq1, seq2, seq1.getDatasetSequence() }));
+ assertEquals(2, result.size());
+ assertTrue(result.contains(acf1));
+ assertTrue(result.contains(acf2));
+ assertFalse("Did not expect to find mapping acf3 - subselect failed",
+ result.contains(acf3));
+ assertFalse(
+ "Did not expect to find mapping acf4 - doesn't involve sequence",
+ result.contains(acf4));
+
+ /*
+ * and verify the no filter case
+ */
+ result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings,
+ null);
+ assertEquals(3, result.size());
+ assertTrue(result.contains(acf1));
+ assertTrue(result.contains(acf2));
+ assertTrue(result.contains(acf3));
+ }
+
@Test(groups = { "Functional" })
public void testMapEditCommand()
{
dna.createDatasetSequence();
protein.createDatasetSequence();
AlignedCodonFrame acf = new AlignedCodonFrame();
- MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3, 1);
+ MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3,
+ 1);
acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
- List<AlignedCodonFrame> mappings = new ArrayList<AlignedCodonFrame>();
+ List<AlignedCodonFrame> mappings = new ArrayList<>();
mappings.add(acf);
AlignmentI prot = new Alignment(new SequenceI[] { protein });
*/
EditCommand ec = new EditCommand();
final Edit edit = ec.new Edit(Action.INSERT_GAP,
- new SequenceI[] { protein }, 4, 2, '-');
+ new SequenceI[]
+ { protein }, 4, 2, '-');
ec.appendEdit(edit, prot, true, null);
/*
public void testFlattenRanges_reverseStrand()
{
assertEquals("[4, 3, 2, 1]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 1 })));
- assertEquals(
- "[4, 3, 2, 1]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 3, 2,
- 1 })));
- assertEquals(
- "[4, 3, 2, 1]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 4, 3,
- 3, 2, 2, 1, 1 })));
- assertEquals(
- "[12, 9, 8, 7, 4, 3, 2, 1]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12,
- 9, 7, 4, 1 })));
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 1 })));
+ assertEquals("[4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 3, 2, 1 })));
+ assertEquals("[4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 4, 3, 3, 2, 2, 1, 1 })));
+ assertEquals("[12, 9, 8, 7, 4, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 12, 12, 9, 7, 4, 1 })));
// forwards and backwards anyone?
- assertEquals(
- "[4, 5, 6, 3, 2, 1]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 6, 3,
- 1 })));
+ assertEquals("[4, 5, 6, 3, 2, 1]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 4, 6, 3, 1 })));
// backwards and forwards
- assertEquals(
- "[3, 2, 1, 4, 5, 6]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 3, 1, 4,
- 6 })));
+ assertEquals("[3, 2, 1, 4, 5, 6]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 3, 1, 4, 6 })));
// trailing unpaired start position is ignored:
- assertEquals(
- "[12, 9, 8, 7, 4, 3, 2]",
- Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12,
- 9, 7, 4, 2, 1 })));
+ assertEquals("[12, 9, 8, 7, 4, 3, 2]",
+ Arrays.toString(MappingUtils.flattenRanges(new int[]
+ { 12, 12, 9, 7, 4, 2, 1 })));
}
/**
public void testMapColumnSelection_hiddenColumns() throws IOException
{
setupMappedAlignments();
-
+
ColumnSelection proteinSelection = new ColumnSelection();
+ HiddenColumns hiddenCols = new HiddenColumns();
/*
* Column 0 in protein picks up Seq2/L, Seq3/G which map to cols 0-4 and 0-3
* in dna respectively, overall 0-4
*/
- proteinSelection.hideColumns(0);
- ColumnSelection dnaSelection = MappingUtils.mapColumnSelection(proteinSelection,
- proteinView, dnaView);
+ proteinSelection.hideSelectedColumns(0, hiddenCols);
+ ColumnSelection dnaSelection = new ColumnSelection();
+ HiddenColumns dnaHidden = new HiddenColumns();
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
assertEquals("[]", dnaSelection.getSelected().toString());
- List<int[]> hidden = dnaSelection.getHiddenColumns();
- assertEquals(1, hidden.size());
- assertEquals("[0, 4]", Arrays.toString(hidden.get(0)));
+ Iterator<int[]> regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 4]", Arrays.toString(regions.next()));
/*
* Column 1 in protein picks up Seq1/K which maps to cols 0-3 in dna
*/
- proteinSelection.revealAllHiddenColumns();
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
// the unhidden columns are now marked selected!
assertEquals("[0]", proteinSelection.getSelected().toString());
// deselect these or hideColumns will be expanded to include 0
proteinSelection.clear();
- proteinSelection.hideColumns(1);
- dnaSelection = MappingUtils.mapColumnSelection(proteinSelection, proteinView, dnaView);
- hidden = dnaSelection.getHiddenColumns();
- assertEquals(1, hidden.size());
- assertEquals("[0, 3]", Arrays.toString(hidden.get(0)));
+ proteinSelection.hideSelectedColumns(1, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 3]", Arrays.toString(regions.next()));
/*
* Column 2 in protein picks up gaps only - no mapping
*/
- proteinSelection.revealAllHiddenColumns();
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
proteinSelection.clear();
- proteinSelection.hideColumns(2);
- dnaSelection = MappingUtils.mapColumnSelection(proteinSelection, proteinView, dnaView);
- assertTrue(dnaSelection.getHiddenColumns().isEmpty());
+ proteinSelection.hideSelectedColumns(2, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ assertEquals(0, dnaHidden.getNumberOfRegions());
/*
* Column 3 in protein picks up Seq1/P, Seq2/Q, Seq3/S which map to columns
* 6-9, 6-10, 5-8 respectively, overall to 5-10
*/
- proteinSelection.revealAllHiddenColumns();
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
proteinSelection.clear();
- proteinSelection.hideColumns(3); // 5-10 hidden in dna
+ proteinSelection.hideSelectedColumns(3, hiddenCols); // 5-10 hidden in dna
proteinSelection.addElement(1); // 0-3 selected in dna
- dnaSelection = MappingUtils.mapColumnSelection(proteinSelection, proteinView, dnaView);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
assertEquals("[0, 1, 2, 3]", dnaSelection.getSelected().toString());
- hidden = dnaSelection.getHiddenColumns();
- assertEquals(1, hidden.size());
- assertEquals("[5, 10]", Arrays.toString(hidden.get(0)));
+ regions = dnaHidden.iterator();
+ assertEquals(1, dnaHidden.getNumberOfRegions());
+ assertEquals("[5, 10]", Arrays.toString(regions.next()));
/*
* Combine hiding columns 1 and 3 to get discontiguous hidden columns
*/
- proteinSelection.revealAllHiddenColumns();
+ dnaSelection = new ColumnSelection();
+ dnaHidden = new HiddenColumns();
+ hiddenCols.revealAllHiddenColumns(proteinSelection);
proteinSelection.clear();
- proteinSelection.hideColumns(1);
- proteinSelection.hideColumns(3);
- dnaSelection = MappingUtils.mapColumnSelection(proteinSelection, proteinView, dnaView);
- hidden = dnaSelection.getHiddenColumns();
- assertEquals(2, hidden.size());
- assertEquals("[0, 3]", Arrays.toString(hidden.get(0)));
- assertEquals("[5, 10]", Arrays.toString(hidden.get(1)));
- }
-
- /**
- * Tests for the method that removes the trailing stop codon from a mapping
- * range i.e. the last 3 positions (whether split or not)
- */
- @Test(groups = { "Functional" })
- public void testUnmapStopCodon()
- {
- List<int[]> ranges = new ArrayList<int[]>();
-
- // simple case, forward strand:
- ranges.add(new int[] { 1, 3 });
- ranges.add(new int[] { 9, 14 });
- MappingUtils.unmapStopCodon(ranges, 9);
- assertEquals(2, ranges.size());
- assertArrayEquals(new int[] { 1, 3 }, ranges.get(0));
- assertArrayEquals(new int[] { 9, 11 }, ranges.get(1));
-
- // split stop codon, forward strand:
- ranges.clear();
- ranges.add(new int[] { 1, 8 });
- ranges.add(new int[] { 10, 10 });
- MappingUtils.unmapStopCodon(ranges, 9);
- assertEquals(1, ranges.size());
- assertArrayEquals(new int[] { 1, 6 }, ranges.get(0));
-
- // very split stop codon, forward strand:
- ranges.clear();
- ranges.add(new int[] { 1, 1 });
- ranges.add(new int[] { 3, 4 });
- ranges.add(new int[] { 6, 6 });
- ranges.add(new int[] { 8, 8 });
- ranges.add(new int[] { 10, 10 });
- MappingUtils.unmapStopCodon(ranges, 6);
- assertEquals(2, ranges.size());
- assertArrayEquals(new int[] { 1, 1 }, ranges.get(0));
- assertArrayEquals(new int[] { 3, 4 }, ranges.get(1));
-
- // simple case, reverse strand:
- ranges.clear();
- ranges.add(new int[] { 12, 10 });
- ranges.add(new int[] { 6, 1 });
- MappingUtils.unmapStopCodon(ranges, 9);
- assertEquals(2, ranges.size());
- assertArrayEquals(new int[] { 12, 10 }, ranges.get(0));
- assertArrayEquals(new int[] { 6, 4 }, ranges.get(1));
-
- // split stop codon, reverse strand:
- ranges.clear();
- ranges.add(new int[] { 12, 6 });
- ranges.add(new int[] { 4, 3 });
- MappingUtils.unmapStopCodon(ranges, 9);
- assertEquals(1, ranges.size());
- assertArrayEquals(new int[] { 12, 7 }, ranges.get(0));
+ proteinSelection.hideSelectedColumns(1, hiddenCols);
+ proteinSelection.hideSelectedColumns(3, hiddenCols);
+ MappingUtils.mapColumnSelection(proteinSelection, hiddenCols,
+ proteinView, dnaView, dnaSelection, dnaHidden);
+ regions = dnaHidden.iterator();
+ assertEquals(2, dnaHidden.getNumberOfRegions());
+ assertEquals("[0, 3]", Arrays.toString(regions.next()));
+ assertEquals("[5, 10]", Arrays.toString(regions.next()));
}
@Test(groups = { "Functional" })
public void testGetLength()
{
assertEquals(0, MappingUtils.getLength(null));
- List<int[]> ranges = new ArrayList<int[]>();
+
+ /*
+ * [start, end] ranges
+ */
+ List<int[]> ranges = new ArrayList<>();
assertEquals(0, MappingUtils.getLength(ranges));
ranges.add(new int[] { 1, 1 });
assertEquals(1, MappingUtils.getLength(ranges));
assertEquals(10, MappingUtils.getLength(ranges));
ranges.add(new int[] { 20, 10 });
assertEquals(21, MappingUtils.getLength(ranges));
+
+ /*
+ * [start, end, start, end...] ranges
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 5, 8, 4 });
+ ranges.add(new int[] { 8, 2 });
+ ranges.add(new int[] { 12, 12 });
+ assertEquals(18, MappingUtils.getLength(ranges));
}
@Test(groups = { "Functional" })
public void testContains()
{
assertFalse(MappingUtils.contains(null, 1));
- List<int[]> ranges = new ArrayList<int[]>();
+ List<int[]> ranges = new ArrayList<>();
assertFalse(MappingUtils.contains(ranges, 1));
ranges.add(new int[] { 1, 4 });
assertFalse(MappingUtils.contains(ranges, -45));
}
+ /**
+ * Test the method that drops positions from the start of a mapped range
+ */
+ @Test(groups = "Functional")
+ public void testRemoveStartPositions()
+ {
+ int[] ranges = new int[] { 1, 10 };
+ int[] adjusted = MappingUtils.removeStartPositions(0, ranges);
+ assertEquals("[1, 10]", Arrays.toString(adjusted));
+
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[2, 10]", Arrays.toString(adjusted));
+ assertEquals("[1, 10]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[3, 10]", Arrays.toString(adjusted));
+ assertEquals("[2, 10]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 3, 10, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[3, 3, 10, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 3, 10, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 8, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 8, 12 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 4, 4, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[4, 4, 9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 2, 4, 4, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[9, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges));
+
+ ranges = new int[] { 2, 3, 9, 12 };
+ adjusted = MappingUtils.removeStartPositions(3, ranges);
+ assertEquals("[10, 12]", Arrays.toString(adjusted));
+ assertEquals("[2, 3, 9, 12]", Arrays.toString(ranges));
+ }
+
+ /**
+ * Test the method that drops positions from the start of a mapped range, on
+ * the reverse strand
+ */
+ @Test(groups = "Functional")
+ public void testRemoveStartPositions_reverseStrand()
+ {
+ int[] ranges = new int[] { 10, 1 };
+ int[] adjusted = MappingUtils.removeStartPositions(0, ranges);
+ assertEquals("[10, 1]", Arrays.toString(adjusted));
+ assertEquals("[10, 1]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[9, 1]", Arrays.toString(adjusted));
+ assertEquals("[10, 1]", Arrays.toString(ranges));
+
+ ranges = adjusted;
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 1]", Arrays.toString(adjusted));
+ assertEquals("[9, 1]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 11, 9, 6 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[11, 11, 9, 6]", Arrays.toString(adjusted));
+ assertEquals("[12, 11, 9, 6]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[7, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 10, 10, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(1, ranges);
+ assertEquals("[10, 10, 8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 12, 10, 10, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(2, ranges);
+ assertEquals("[8, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges));
+
+ ranges = new int[] { 12, 11, 8, 4 };
+ adjusted = MappingUtils.removeStartPositions(3, ranges);
+ assertEquals("[7, 4]", Arrays.toString(adjusted));
+ assertEquals("[12, 11, 8, 4]", Arrays.toString(ranges));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testRangeContains()
+ {
+ /*
+ * both forward ranges
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 2, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 9 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 4, 5 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 0, 9 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { -10, -9 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 11, 12 }));
+
+ /*
+ * forward range, reverse query
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 9, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 2 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 5, 5 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 11, 1 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 10, 0 }));
+
+ /*
+ * reverse range, forward query
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 1, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 1, 9 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 2, 10 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 6, 6 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 6, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 11, 20 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { -3, -2 }));
+
+ /*
+ * both reverse
+ */
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 9, 1 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 2 }));
+ assertTrue(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 3, 3 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 11, 1 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 10, 0 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { 12, 11 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 10, 1 }, new int[] { -5, -8 }));
+
+ /*
+ * bad arguments
+ */
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10, 12 }, new int[] { 1, 10 }));
+ assertFalse(
+ MappingUtils.rangeContains(new int[]
+ { 1, 10 }, new int[] { 1 }));
+ assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null));
+ assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 }));
+ }
+
+ @Test(groups = "Functional")
+ public void testRemoveEndPositions()
+ {
+ List<int[]> ranges = new ArrayList<>();
+
+ /*
+ * case 1: truncate last range
+ */
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 30 });
+ MappingUtils.removeEndPositions(5, ranges);
+ assertEquals(2, ranges.size());
+ assertEquals(25, ranges.get(1)[1]);
+
+ /*
+ * case 2: remove last range
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 22 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(10, ranges.get(0)[1]);
+
+ /*
+ * case 3: truncate penultimate range
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 21 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(9, ranges.get(0)[1]);
+
+ /*
+ * case 4: remove last two ranges
+ */
+ ranges.clear();
+ ranges.add(new int[] { 1, 10 });
+ ranges.add(new int[] { 20, 20 });
+ ranges.add(new int[] { 30, 30 });
+ MappingUtils.removeEndPositions(3, ranges);
+ assertEquals(1, ranges.size());
+ assertEquals(9, ranges.get(0)[1]);
+ }
+
+ /**
+ * Test mapping a sequence group where sequences in and outside the group
+ * share a dataset sequence (e.g. alternative CDS for the same gene)
+ * <p>
+ * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapSequenceGroup_sharedDataset() throws IOException
+ {
+ /*
+ * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+ * viewport). CDS sequences share the same 'gene' dataset sequence.
+ */
+ SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+ SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+ SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+ SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+ cds1.setDatasetSequence(dna);
+ cds2.setDatasetSequence(dna);
+ cds3.setDatasetSequence(dna);
+
+ SequenceI pep1 = new Sequence("pep1", "KF");
+ SequenceI pep2 = new Sequence("pep2", "FG");
+ SequenceI pep3 = new Sequence("pep3", "GP");
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+
+ /*
+ * add mappings from coding positions of dna to respective peptides
+ */
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna, pep1,
+ new MapList(new int[]
+ { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep2,
+ new MapList(new int[]
+ { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep3,
+ new MapList(new int[]
+ { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+
+ AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+ AlignmentI protein = new Alignment(
+ new SequenceI[]
+ { pep1, pep2, pep3 });
+ AlignViewportI cdnaView = new AlignViewport(cdna);
+ AlignViewportI peptideView = new AlignViewport(protein);
+ protein.setCodonFrames(acfList);
+
+ /*
+ * Select pep1 and pep3 in the protein alignment
+ */
+ SequenceGroup sg = new SequenceGroup();
+ sg.setColourText(true);
+ sg.setIdColour(Color.GREEN);
+ sg.setOutlineColour(Color.LIGHT_GRAY);
+ sg.addSequence(pep1, false);
+ sg.addSequence(pep3, false);
+ sg.setEndRes(protein.getWidth() - 1);
+
+ /*
+ * Verify the mapped sequence group in dna is cds1 and cds3
+ */
+ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+ peptideView, cdnaView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(cds1, mappedGroup.getSequences().get(0));
+ assertSame(cds3, mappedGroup.getSequences().get(1));
+ // columns 1-6 selected (0-5 base zero)
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(5, mappedGroup.getEndRes());
+
+ /*
+ * Select mapping sequence group from dna to protein
+ */
+ sg.clear();
+ sg.addSequence(cds2, false);
+ sg.addSequence(cds1, false);
+ sg.setStartRes(0);
+ sg.setEndRes(cdna.getWidth() - 1);
+ mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+ assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(1, mappedGroup.getEndRes()); // two columns
+ }
}