protein.setCodonFrames(acfList);
/*
- * Select Seq1 and Seq3 in the protein (startRes=endRes=0)
+ * Select Seq1 and Seq3 in the protein
*/
SequenceGroup sg = new SequenceGroup();
sg.setColourText(true);
sg.setOutlineColour(Color.LIGHT_GRAY);
sg.addSequence(protein.getSequenceAt(0), false);
sg.addSequence(protein.getSequenceAt(2), false);
+ sg.setEndRes(protein.getWidth() - 1);
/*
* Verify the mapped sequence group in dna
assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0));
assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1));
assertEquals(0, mappedGroup.getStartRes());
- assertEquals(2, mappedGroup.getEndRes());
+ assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon)
/*
* Verify mapping sequence group from dna to protein
overlap = MappingUtils.findOverlap(ranges, 13, 15);
assertNull(overlap);
}
+
+ /**
+ * Test mapping a sequence group where sequences in and outside the group
+ * share a dataset sequence (e.g. alternative CDS for the same gene)
+ * <p>
+ * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapSequenceGroup_sharedDataset() throws IOException
+ {
+ /*
+ * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+ * viewport). CDS sequences share the same 'gene' dataset sequence.
+ */
+ SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+ SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+ SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+ SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+ cds1.setDatasetSequence(dna);
+ cds2.setDatasetSequence(dna);
+ cds3.setDatasetSequence(dna);
+
+ SequenceI pep1 = new Sequence("pep1", "KF");
+ SequenceI pep2 = new Sequence("pep2", "FG");
+ SequenceI pep3 = new Sequence("pep3", "GP");
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+
+ /*
+ * add mappings from coding positions of dna to respective peptides
+ */
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna, pep1,
+ new MapList(new int[]
+ { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep2,
+ new MapList(new int[]
+ { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep3,
+ new MapList(new int[]
+ { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+
+ AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+ AlignmentI protein = new Alignment(
+ new SequenceI[]
+ { pep1, pep2, pep3 });
+ AlignViewportI cdnaView = new AlignViewport(cdna);
+ AlignViewportI peptideView = new AlignViewport(protein);
+ protein.setCodonFrames(acfList);
+
+ /*
+ * Select pep1 and pep3 in the protein alignment
+ */
+ SequenceGroup sg = new SequenceGroup();
+ sg.setColourText(true);
+ sg.setIdColour(Color.GREEN);
+ sg.setOutlineColour(Color.LIGHT_GRAY);
+ sg.addSequence(pep1, false);
+ sg.addSequence(pep3, false);
+ sg.setEndRes(protein.getWidth() - 1);
+
+ /*
+ * Verify the mapped sequence group in dna is cds1 and cds3
+ */
+ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+ peptideView, cdnaView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(cds1, mappedGroup.getSequences().get(0));
+ assertSame(cds3, mappedGroup.getSequences().get(1));
+ // columns 1-6 selected (0-5 base zero)
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(5, mappedGroup.getEndRes());
+
+ /*
+ * Select mapping sequence group from dna to protein
+ */
+ sg.clear();
+ sg.addSequence(cds2, false);
+ sg.addSequence(cds1, false);
+ sg.setStartRes(0);
+ sg.setEndRes(cdna.getWidth() - 1);
+ mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+ assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(1, mappedGroup.getEndRes()); // two columns
+ }
}