<?xml version="1.0" encoding="UTF-8"?>
<classpath>
<classpathentry kind="src" path="src"/>
+ <classpathentry kind="src" path="utils"/>
<classpathentry kind="con" path="org.eclipse.jdt.launching.JRE_CONTAINER"/>
<classpathentry kind="lib" path="lib/activation.jar"/>
<classpathentry kind="lib" path="lib/axis.jar" sourcepath="D:/axis-1_2RC2-src/axis-1_2RC2"/>
<classpathentry kind="lib" path="lib/commons-codec-1.3.jar"/>
<classpathentry kind="con" path="org.eclipse.jdt.USER_LIBRARY/plugin.jar"/>
<!-- <classpathentry exported="true" kind="var" path="GROOVY_ECLIPSE_HOME/groovy-all-1.0.jar"/> -->
+ <classpathentry kind="con" path="org.eclipse.jdt.USER_LIBRARY/plugin.java"/>
+ <classpathentry kind="lib" path="lib/VARNAv3-9.jar"/>
<classpathentry kind="output" path="classes"/>
</classpath>
<stringAttribute key="org.eclipse.jdt.launching.PROJECT_ATTR" value="jalview"/>
<stringAttribute key="org.eclipse.jdt.launching.SOURCE_PATH_PROVIDER" value="org.eclipse.ant.ui.AntClasspathProvider"/>
<stringAttribute key="org.eclipse.ui.externaltools.ATTR_ANT_TARGETS" value="buildindices,"/>
+<booleanAttribute key="org.eclipse.ui.externaltools.ATTR_BUILDER_ENABLED" value="false"/>
<stringAttribute key="org.eclipse.ui.externaltools.ATTR_LAUNCH_CONFIGURATION_BUILD_SCOPE" value="${none}"/>
<stringAttribute key="org.eclipse.ui.externaltools.ATTR_LOCATION" value="${build_project}/build.xml"/>
<stringAttribute key="org.eclipse.ui.externaltools.ATTR_RUN_BUILD_KINDS" value="full,incremental,"/>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+-->
+<title>Jalview RNA Support</title>
+<body>
+<h1>
+Jalview RNA Support
+</h1>
+<p>
+Jalview RNA support has been added in part during a
+<a href="http://socghop.appspot.com/gsoc/program/home/google/gsoc2010">Google Summer of Code Project</a>.
+More information about this project can be found at the
+<a href="https://www.nescent.org/wg_phyloinformatics/PhyloSoC:Extending_Jalview_to_Support_RNA_Alignment_Annotation_and_Secondary_Structure_Visualization">
+NESCent wiki page</a> and the project <a href="http://jalview-rnasupport.blogspot.com/">blog</a>.
+</p>
+<h2>What was added</h2>
+<p>
+<ul>
+<li>Recognition of ".stk" and ".sto" extensions for Stockholm file format.</li>
+<li>Purine/Pyrimidine colour scheme.</li>
+<li>Colouring by RNA helices. Helices are determined from the secondary structure line written in WUSS format in Stockholm files.</li>
+<li>Ability to fetch sequences from RFAM.</li>
+<li>Visualization of RNA secondary structure in WUSS format (from input file) and RNA helices in the
+annotation panel.</li>
+</ul>
+</p>
+<h2>TODO</h2>
+<h3>Secondary Structure Visualization/Annotation</h3>
+<ul>
+<li>Detection of pseudoknots and tetraloops </li>
+<li>Update colouring of RNA helices in annotation panel when "By RNA helices" colouring is selected</li>
+<li>Editing of secondary structure line</li>
+<li>Update helix colouring when secondary structure changes.</li>
+<li>Support per sequence in RNA secondary structure annotation</li>
+<li>Enable RNA secondary structure annotation to be imported/exported through Jalview annotation files</li>
+</ul>
+
+<h3>Colour schemes</h3>
+<ul>
+<li>Coloring scheme for pseudoknots</li>
+<li>Covariation colour scheme similar to RFAM's</li>
+<li>Coloring schemes from other MSA viewers, like 4Sale and Assemble</li>
+<li>Highlight positions in alignments that break base pairing specified in the secondary structure line</li>
+</ul>
+<h3>Embed VARNA, An RNA Secondary Structure Viewer</h3>
+<ul>
+<li>The homepage for VARNA can be found <a href="http://varna.lri.fr/">here</a>.</li>
+<li>Hook VARNA into Jalview</li>
+<li>Ability to port RNA secondary structure (e.g. from Stockholm files) into VARNA</li>
+<li>Mouse over and selections get highlighted in the linked views</li>
+</ul>
+<h3>Miscellaneous</h3>
+<ul>
+<li>Add changes done to the main gui to the applet gui</li>
+<li>Add export of Stockholm file format</li>
+</ul>
+</p>
+</body>
+</html>
+
<mapID target="viewingpdbs" url="html/features/viewingpdbs.html"/>
<mapID target="pdbmcviewer" url="html/features/pdbviewer.html"/>
<mapID target="pdbjmol" url="html/features/jmol.html"/>
+ <mapID target="varna" url="html/features/varna.html"/>
<mapID target="preferences" url="html/features/preferences.html"/>
<mapID target="commandline" url="html/features/commandline.html"/>
<mapID target="clarguments" url="html/features/clarguments.html"/>
<mapID target="colours.abovepid" url="html/colourSchemes/abovePID.html"/>
<mapID target="colours.conservation" url="html/colourSchemes/conservation.html"/>
<mapID target="colours.annotation" url="html/colourSchemes/annotationColouring.html"/>
+ <mapID target="colours.purinepyrimidine" url="html/colourSchemes/purinepyrimidine.html"/>
+ <mapID target="colours.rnahelices" url="html/colourSchemes/rnahelicesColouring.html"/>
<mapID target="calcs.alquality" url="html/calculations/quality.html"/>
<mapID target="calcs.alconserv" url="html/calculations/conservation.html"/>
+ <mapID target="calcs.alstrconsensus" url="html/calculations/structureconsensus.html"/>
<mapID target="calcs.consensus" url="html/calculations/consensus.html"/>
+ <mapID target="nucleicAcids" url="html/na/index.html"/>
+
<mapID target="menus" url="html/menus/index.html"/>
<mapID target="desktopMenu" url="html/menus/desktopMenu.html"/>
<mapID target="alMenu" url="html/menus/alignmentMenu.html"/>
<toc version="1.0">
<tocitem text="Jalview Documentation" target="home" expand="true" >
<tocitem text="What's new" target="new" expand="true">
- <tocitem text="Enhanced Jmol/Jalview interaction" target="pdbjmol"/>
- <tocitem text="Multi-Harmony Alignment Analysis" target="shmrws"/>
- <tocitem text="Jalview News Reader" target="newsreader"/>
- <tocitem text="Sort alignments associated with tree" target="treeviewer"/>
- <tocitem text="Default Annotation preferences" target="colours.annotation"/>
- <tocitem text="Jaba Web Services" target="jabaws"/>
+ <tocitem text="Viewing RNA structure" target="varna" />
+ <tocitem text="RNA Structure Consensus" target="calcs.alstrconsensus"/>
+ <tocitem text="RNA Helices coloring" target="colours.rnahelices"/>
</tocitem>
<tocitem text="Editing Alignments" target ="edit"/>
<tocitem text="Cursor Mode" target="cursor"/>
<tocitem text="Multiple Views" target="multipleviews"/>
<tocitem text="Viewing Trees" target="treeviewer" expand="false"/>
<tocitem text="Fetching Sequences" target="seqfetch"/>
+ <tocitem text="Nucleic Acid Support" target="nucleicAcids" expand="false">
+ <tocitem text="Viewing RNA structure" target="varna" />
+ <tocitem text="RNA Structure Consensus" target="calcs.alstrconsensus"/>
+ <tocitem text="RNA Helices coloring" target="colours.rnahelices"/>
+ </tocitem>
<tocitem text="Sequence Features" target="seqfeatures" expand="false">
<tocitem text="Sequence Feature Settings" target="seqfeatures.settings"/>
<tocitem text="Sequence Features File" target="features.fileformat"/>
<tocitem text="Turn propensity" target="colours.turn"/>
<tocitem text="Buried index" target="colours.buried"/>
<tocitem text="Nucleotide colours" target="colours.nucleotide"/>
+ <tocitem text="Purine/Pyrimidine colours" target="colours.purinepyrimidine"/>
<tocitem text="Blosum62" target="colours.blosum"/>
<tocitem text="by Percentage Identity" target="colours.pid"/>
<tocitem text="User Defined" target="colours.user"/>
<tocitem text="Above Percentage Identity" target="colours.abovepid"/>
<tocitem text="By conservation" target="colours.conservation"/>
<tocitem text="By Annotation" target="colours.annotation"/>
+ <tocitem text="By RNA Helices" target="colours.rnahelices"/>
</tocitem>
<tocitem text="Calculations" target="calculations" expand="false">
<tocitem text="Sorting alignments" target="sorting"/>
<tocitem text="Remove Redundancy" target="redundancy"/>
</tocitem>
<tocitem text="Alignment Annotations" target ="alannotation" expand="false">
- <tocitem text="Conservation" target="calcs.alconserv"/>
+ <tocitem text="Conservation" target="calcs.alconserv"/>
<tocitem text="Quality" target="calcs.alquality"/>
<tocitem text="Consensus" target="calcs.consensus"/>
+ <tocitem text="RNA Structure Consensus" target="calcs.alstrconsensus"/>
<tocitem text="Annotations File Format" target="annotations.fileformat"/>
</tocitem>
<tocitem text="Viewing PDB Files" target="viewingpdbs" expand="false">
<tocitem text="Jmol Viewer" target="pdbjmol"/>
<tocitem text="Simple PDB Viewer" target="pdbmcviewer"/>
</tocitem>
+ <tocitem text="Viewing RNA structures" target="varna" expand="false"> </tocitem>
<tocitem text="VAMSAS Data Exchange" target="vamsas">
<!-- what can Jalview share with other apps -->
<!-- what other apps exist -->
<p>Select the <strong>"Copy Consensus Sequence"</strong> entry from
the consensus annotation label to copy the alignment's consensus sequence to the
clipboard.
+
+<p><strong>Sequence logo</strong></p>
+By clicking on the label you can also activate the sequence logo. It
+indicates the relative amount of residues per column which can be
+estimated by it's size in the logo. The tooltip of a column gives the
+exact numbers for all occuring residues.
</p>
</body>
</html>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6.1)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+-->
+<head><title>Alignment RNA Structure Consensus Annotation</title></head>
+<body><p><strong>Alignment RNA Structure Consensus Annotation</strong></p>
+
+<p>The RNA structure consensus displayed below the alignment is the
+percentage of valid base pairs per column. It is calculated in
+relation to a secondary structure and just paired columns are
+calculated. The canonical Watson-Crick base pairings (A-T/U, G-C) and
+the wobble base pair (G-T/U) are regarded as valid pairings.<br>
+The amount of valid base pairs is indicated by the profile in the
+Alignment Annotation row.<br>
+By default this calculation includes gaps in columns. You can choose
+to ignore gaps in the calculation by right clicking on the label
+"StrConsensus" to the left of the structure consensus bar
+chart.<br>
+
+<p><strong>Structure logo</strong></p>
+By clicking on the label you can also activate the structure logo. It is very
+similar to a sequence logo but counts the numbers of base pairs. There
+are two residues per column, the actual column and the interacting
+base. The opening bracket is always the one on the left side.<br>
+Like sequence logos the relative amount of a specific base pair can be
+estimated by it's size in the logo. The tool tip of a column gives the
+exact numbers for all occurring valid base pairs.
+</p>
+</body>
+</html>
<p>The default colour schemes are summarised in the table below:
<div align="center">
<p> </p>
+<p><strong>Protein Colour Schemes</strong></p>
<table border="1">
<tr>
<td>
</td>
</tr>
</table>
+<p> </p>
+<p><strong>Nucleotide Colour Schemes</strong></p>
+<table border="1">
+ <tr>
+ <td>
+ <table border="1">
+ <tr>
+ <td nowrap></td>
+ <td>A</td> <!--Adenine-->
+ <td>C</td> <!--Cytosine-->
+ <td>G</td> <!--Guanine-->
+ <td>T</td> <!--Thymine-->
+ <td>U</td> <!--Uracil-->
+ <td>I</td> <!--Inosine-->
+ <td>X</td> <!--Xanthine-->
+ <td>R</td> <!--Unknown Purine-->
+ <td>Y</td> <!--Unknown Pyrimidine-->
+ <td>N</td> <!--Unknown-->
+ <td>W</td> <!--Weak nucleotide (A or T)-->
+ <td>S</td> <!--Strong nucleotide (G or C)-->
+ <td>M</td> <!--Amino (A or C)-->
+ <td>K</td> <!--Keto (G or T)-->
+ <td>B</td> <!--Not A (G or C or T)-->
+ <td>H</td> <!--Not G (A or C or T)-->
+ <td>D</td> <!--Not C (A or G or T)-->
+ <td>V</td> <!--Not T (A or G or C-->
+ </tr>
+ <tr>
+ <td height="24">Nucleotide</td>
+ <td bgcolor="#64F73F"></td>
+ <td bgcolor="#FFB340"></td>
+ <td bgcolor="#EB413C"></td>
+ <td bgcolor="#3C88EE"></td>
+ <td bgcolor="#3C88EE"></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ </tr>
+ <tr>
+ <td height="24">Purine/Pyrimidine</td>
+ <td bgcolor="#FF83FA"></td>
+ <td bgcolor="#40E0D0"></td>
+ <td bgcolor="#FF83FA"></td>
+ <td bgcolor="#40E0D0"></td>
+ <td bgcolor="#40E0D0"></td>
+ <td></td>
+ <td></td>
+ <td bgcolor="#FF83FA"></td>
+ <td bgcolor="#40E0D0"></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ <td></td>
+ </tr>
+ </table>
+ </td>
+ </tr>
+</table>
+
+
</div>
<p align="center"> </p>
</body>
<td bgcolor="#FFB340">C</td>
<td bgcolor="#EB413C">G</td>
<td bgcolor="#3C88EE">T</td>
+ <td bgcolor="#3C88EE">U</td>
</tr>
</table>
</div>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+-->
+<head><title>Purine/Pyrimidine Colour Scheme</title>
+<style type="text/css">
+<!--
+td {
+ text-align: center;
+}
+-->
+</style>
+</head>
+
+<body>
+<p><em>Purine/Pyrimidine Colours</em></p>
+<div align="center">
+ <table width="200" border="1">
+ <tr>
+ <td bgcolor="#FF83FA">Purines <BR> A, G, R</td>
+ <td bgcolor="#40E0D0">Pyrimidines <BR> C, U, T, Y</td>
+ </tr>
+ </table>
+</div>
+</body>
+</html>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+-->
+<head><title>RNA Helices Colouring</title></head>
+
+<body>
+<p><strong> RNA Helices Colouring </strong></p>
+<p>An RNA alignment loaded from a Stockholm file can be coloured
+ based on its helices. The helices are determined from the
+ secondary structure line in the Stockholm file (#GC SS_cons)
+ written in WUSS notation
+ that specifies base pairing. See <a href="http://en.wikipedia.org/wiki/Stockholm_format">
+ Wikipedia</a> or <a href="http://jalview-rnasupport.blogspot.com/2010/06/parsing-wuss-notation-of-rna-secondary.html">
+ Jalview RNA Support Blog</a> for more information about Stockholm files and WUSS notation.</p>
+Select "Colour" <strong>→</strong> "
+ By RNA Helices" to colour the alignment by RNA helices. <br>
+ <br>
+<p><em>Features</em></p>
+<ul>
+<li>Colours are generated randomly for the number of helices present.
+Reselect the "By RNA Helices" option to generate another set of random colors. </li>
+<li>Sequence logo is in <a href="purinepyrimidine.html">
+Purine/Pyrimidine colour scheme</a>. </li>
+<li>Line above the "Secondary Structure" line in annotation panel is WUSS notation present
+in the input file.</li>
+</ul>
+
+
+
+ <div align="center">
+ <img src="rnahelicescoloring.png" width="600" height="140"> </div>
+
+
+</body>
+</html>
<p><strong>The Jmol PDB Viewer</strong></p>\r
<p>Since Jalview 2.3, <a href="http://jmol.sourceforge.net/">Jmol</a>\r
has been integrated into Jalview for interactively viewing structures\r
-opened by selecting the <strong>"Sequence→View PDB\r
+opened by selecting the <strong>"Structure→View PDB\r
entry:"</strong> option in the <a href="../menus/popupMenu.html">sequence\r
id pop-up menu</a> (if you can't see this, then you need to <a\r
href="viewingpdbs.html">associate a PDB structure</a> with the\r
</head>
<body>
<p><strong>Sequence Fetcher</strong></p>
-<p>Jalview can retrieve sequences from certain databases using
-either the WSDBFetch service provided by the European Bioinformatics
-Institute, and, since Jalview 2.4, DAS servers capable of the <em>sequence</em>
-command (configured in <a href="dassettings.html">DAS settings</a>).</p>
-<img src="seqfetcher.gif" align="center"
- alt="The Jalview Sequence Fetcher Dialog Box">
-<p>The Sequence Fetcher dialog box can be opened via the
-"File" menu on the main desktop in order to retrieve sequences
-as a new alignment, or opened via the "File" menu of an
-existing alignment to import additional sequences. Please note, there
-will be a short delay when the sequence fetcher is first opened, whilst
-Jalview compiles the list of available sequence datasources from the
-currently defined DAS server registry.</strong></p>
-<p>First, select the database you want to retrieve sequences from.
-Then, enter one or more accession ids (as a semi-colon separated list),
-or press the "Example" button to paste the example accession
-for the currently selected database into the retrieval box. Finally,
-press "OK" to initiate the retrieval.</p>
-<p><em>Fetching Individual PDB Chains</em><br>
-If you are retrieving sequences from the PDB, you can retrieve specific
-chains by appending a colon and the chain id to the PDB id. For example
-:<br>
-<pre> 1GAQ:A</pre>
-</p>
-<p><em>Retrieving parts of large sequence records</em><br>
-When retrieving from DAS sequence sources, coordinate range arguments
-can be passed to the server using the standard DAS sequence command
-format:<pre>
- <AccessionId>:<start>,<end></pre> If you know a source
-understands this type of query format, then you should untick the
-checkbox for 'replace commas with semi-colons' so the range query can be
-passed to the server; otherwise, the query will be split into two (e.g
-'Mito:1' and '85779' rather than 'Mito:1,85779'). In most cases,
-however, a source that supports range queries will include a range
-qualification in its example query, and Jalview will then automatically
-disable the 'replace commas with semi-colons' option.<br>
-<em>The option to disable the comma to semi-colon translation was
-added in Jalview 2.6</em></p>
-<p>If you use the WSDBFetch sequence fetcher services (EMBL,
-Uniprot, PDB and PFAM) in work for publication, please cite:</p>
-<p>Pillai S., Silventoinen V., Kallio K., Senger M., Sobhany S.,
-Tate J., Velankar S., Golovin A., Henrick K., Rice P., Stoehr P., Lopez
-R. <br>
-SOAP-based services provided by the European Bioinformatics Institute.<br>
-Nucleic Acids Res. 33(1):W25-W28 (2005) <br>
-<br>
+<p>Jalview can retrieve sequences from certain databases using either the
+WSDBFetch service provided by the European Bioinformatics Institute, and, since Jalview 2.4, DAS servers capable of the <em>sequence</em> command (configured in <a href="dassettings.html">DAS settings</a>).</p>
+<img src="seqfetcher.gif" align="center" alt="The Jalview Sequence Fetcher Dialog Box">
+<p>The Sequence Fetcher dialog box can be opened via the "File"
+ menu on the main desktop in order to retrieve sequences as a new
+ alignment, or opened via the "File" menu of an existing alignment
+ to import additional sequences. Please note, there will be a short delay when the sequence fetcher is first opened,
+ whilst Jalview compiles the list of available sequence datasources from the
+ currently defined DAS server registry.</strong>
</p>
+<p>First, select the database you want to retrieve sequences from. Then, enter
+ one or more accession ids (as a semi-colon separated list), or press the
+ "Example" button to paste the example accession for the currently selected database into the retrieval box.
+ Finally, press "OK" to initiate the retrieval.</p>
+<p>
+ If you are retrieving sequences from the PDB, you can retrieve
+ specific chains by appending a colon and the chain id to the PDB
+ id. For example :<br><pre> 1GAQ:A</pre><br>When retrieving from DAS sequence sources,
+ coordinate range arguments can be passed to the server using the standard DAS
+ sequence command format (<strong>:<start>,<end></strong>)</p>
+<p>If you use the WSDBFetch sequence fetcher services (EMBL, Uniprot, PDB, PFAM, and RFAM)
+ in work for publication, please cite:</p>
+<p>Pillai S., Silventoinen V., Kallio K., Senger M., Sobhany S., Tate J., Velankar
+ S., Golovin A., Henrick K., Rice P., Stoehr P., Lopez R. <br>
+ SOAP-based services provided by the European Bioinformatics Institute.<br>
+ Nucleic Acids Res. 33(1):W25-W28 (2005) <br>
+ <br>
+ </p>
</body>
</html>
--- /dev/null
+<html>\r
+<!--\r
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6.1)\r
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle\r
+ * \r
+ * This file is part of Jalview.\r
+ * \r
+ * Jalview is free software: you can redistribute it and/or\r
+ * modify it under the terms of the GNU General Public License \r
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.\r
+ * \r
+ * Jalview is distributed in the hope that it will be useful, but \r
+ * WITHOUT ANY WARRANTY; without even the implied warranty \r
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR \r
+ * PURPOSE. See the GNU General Public License for more details.\r
+ * \r
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.\r
+-->\r
+<head>\r
+<title>The VARNA RNA Viewer</title>\r
+</head>\r
+<body>\r
+<p><strong>The VARNA RNA Viewer</strong></p>\r
+<p>Since Jalview\r
+2.7.1, <a href="http://varna.lri.fr/index.html">VARNA</a> has been\r
+integrated into Jalview for interactively viewing structures opened by\r
+selecting the <strong>"Structure→View\r
+Structure:"</strong> option in\r
+the <a href="../menus/popupMenu.html">sequence id pop-up menu</a> (if\r
+you can't see this, then no RNA structure is associated with your\r
+sequence or alignment. In the pop-up menu all structures that\r
+are associated with this sequence and all sequences that are\r
+associated with the alignment are available.\r
+\r
+<p><strong>Different structures</strong></p>\r
+<ul>\r
+ <li>\r
+ <b>Alignment structures</b>:\r
+ Structures associated with the alignment are marked by having "consensus" attached to their name. VARNA contains two different entries for consensus structures.\r
+ <ul>\r
+ <li>Consensus structure: the individual sequence folded into the consensus structure</li>\r
+ <li>Trimmed consensus structure: the individual sequence\r
+ folded into the the gap-free consensus structure. That means all\r
+ columns that contained gaps in the individual sequence were\r
+ removed. If this breaks a base-pair the pairing is removed also.\r
+ This can be considered as an approximation for the individual structure.\r
+ </ul>\r
+ </li>\r
+ <li>\r
+ <b>Individual structures</b>:\r
+ this is a structure associated with the individual sequence and therefore not related to the alignment \r
+ </li>\r
+\r
+<p><strong>Controls</strong><br>\r
+<ul>\r
+<li>Rotate view - Left Click and drag</li>\r
+<li>Zoom in - Press '+'</li>\r
+<li>Zoom out - Press '-'</li>\r
+<li>Choose a different structure - Left click on structure in the left hand panel</li>\r
+<li>Highlighting bases - Move mouse over columns in the Jalview alignment panel</li>\r
+</ul>\r
+\r
+<p><strong>Functionality provided by VARNA</strong></p>\r
+<p>VARNA's own functions are accessed by right-clicking in the\r
+structure display area. That will open the VARNA pop-up menu,\r
+which provides access to a number of features like different draw algorithm, color highlighting or annotations. \r
+</p>\r
+<p><strong>More Information</strong></p>\r
+<p>VARNA is a very powerful RNA viewer on its own. Only the\r
+essentials have been described here - the interested reader is\r
+referred to <a href="http://varna.lri.fr/usermanual.html">VARNA's own\r
+comprehensive online documentation</a>.</p>\r
+</body>\r
+</html>\r
</tr><tr><td width="17%">PFAM</td>
<td width="60%">SequenceName THISISASEQENCE</td>
<td width="23%">.pfam</td>
+</tr><tr>
+<td width="17%">Stockholm</td>
+<td width="60%"># STOCKHOLM VersionNumber<br>
+<em>...</em><br>//</td>
+<td width="23%">.stk, .sto</td>
</tr>
</table>
<p>The file extensions are used to associate jalview alignment icons
<li><strong>File</strong>
<ul>
<li><strong>Fetch Sequence</strong><br> <em>Shows a
- dialog window in which you can select known ids from Uniprot,
- EMBL, EMBLCDS or PDB database using Web Services provided by the
+ dialog window in which you can retrieve known ids from Uniprot,
+ EMBL, EMBLCDS, PFAM, Rfam, or PDB database using Web Services provided by the
European Bioinformatics Institute. See <a
href="../features/seqfetch.html">Sequence Fetcher</a> </em>.</li>
<li><strong>Add Sequences</strong><em><br> Add
</ul></li>
</ul>
+ </li>
+
+ </ul>
</li>
<li><strong>Colour</strong>
<li>Colour Scheme options: <strong>None, ClustalX,
Blosum62 Score, Percentage Identity, Zappo, Taylor,
Hydrophobicity, Helix Propensity, Strand Propensity, Turn
- Propensity, Buried Index, Nucleotide, User Defined<br> </strong> <em>See
+ Propensity, Buried Index, Nucleotide, Purine/Pyrimidine, User Defined<br> </strong> <em>See
<a href="../colourSchemes/index.html">colours</a> for a
description of all colour schemes.</em><br></li>
<li><strong>By Conservation<br> </strong><em>See <a
the alignment on a per-column value from a specified annotation.
See <a href="../colourSchemes/annotationColouring.html">Annotation
Colouring</a>.</em><br></li>
+ <li><strong>By RNA Helices</strong><br>
+ <em>Colours the helices of an RNA alignment loaded from a Stockholm file. See
+ <a href="../colourSchemes/rnahelicesColouring.html">RNA Helices
+ Colouring</a>.</em><br>
+ </li>
</ul></li>
<li><strong>Calculate</strong>
<ul>
</em></li>
<li>Colour Scheme options: <strong>None, ClustalX, Blosum62 Score, Percentage
Identity, Zappo, Taylor, Hydrophobicity, Helix Propensity, Strand Propensity,
- Turn Propensity, Buried Index, Nucleotide, User Defined<br>
+ Turn Propensity, Buried Index, Nucleotide, Purine/Pyrimidine, User Defined<br>
</strong> <em>See <a href="../colourSchemes/index.html">colours</a> for
a description of all colour schemes.</em><br>
</li>
<em>Colours the alignment on a per-column value from a specified annotation.
See <a href="../colourSchemes/annotationColouring.html">Annotation Colouring</a>.</em><br>
</li>
+ <li><strong>By RNA Helices</strong><br>
+ <em>Colours the helices of an RNA alignment loaded from a Stockholm file. See
+ <a href="../colourSchemes/rnahelicesColouring.html">RNA Helices
+ Colouring</a>.</em><br>
+ </li>
</ul>
</body>
</html>
<ul>
<li><strong>Fetch Sequence</strong><br>
<em>Shows a dialog window in which you can select known ids from
- Uniprot, EMBL, EMBLCDS or PDB database using Web Services provided by
+ Uniprot, EMBL, EMBLCDS, PDB, PFAM, or RFAM databases using Web Services provided by
the European Bioinformatics Institute. See <a
href="../features/seqfetch.html">Sequence Fetcher</a></em>.</li>
<li><strong>Add Sequences</strong><em><br>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+-->
+<head>
+<title>Nucleic Acid Support</title>
+<style type="text/css">
+<!--
+td {
+ font-family: "Courier New", Courier, mono;
+ font-style: normal;
+ font-size: medium;
+}
+-->
+</style>
+</head>
+<body>
+<p><strong>Nucleic Acid Support</strong></p>
+<p><em>Colour Schemes</em></p>
+<p>Jalview has color schemes for nucleic acid based sequences, ability to
+fetch sequences from RFAM and RNA secondary structure coloring</p>
+<p>Information on the <a href="../colourSchemes/nucleotide.html">Nucleotide
+colour scheme</a> and <a href="../colourSchemes/purinepyrimidine.html">
+Purine/Pyrimidine colour scheme</a> are available
+under the Colour Menu. See <a href="../colourSchemes/index.html">Colour
+Schemes</a>.</p>
+<p><em>RNA Support</em></p>
+<p>Sequences can be <a href="../features/seqfetch.html">fetched</a> from the
+RFAM database by accession number or ID.</p>
+<p>If an RNA alignment is loaded from a Stockholm file with secondary
+structure information in WUSS notation, the alignment can be coloured by
+the helices in the secondary structure. Helices are determined by the base-pairing
+in the secondary structure line. See <a href="../colourSchemes/rnahelicesColouring.html">
+RNA Helices Colouring</a>. Below is an example of this type of coloring</p>
+<p>Annotation panel shows the presence of RNA helices and WUSS notation from
+input file specifying secondary structure.<p>
+<div align="center">
+ <img src="../colourschemes/rnahelicescoloring.png" width="600" height="140"> </div>
+
+
+</div>
+<p align="center"> </p>
+</body>
+</html>
<strong>What's new ?</strong>
</p>
<p>
- The Jalview 2.7 release features new web services, and important
- improvements to the way in which Jalview handles alignments and
- associated PDB structures, as well as numerous minor improvements and
- bug fixes. Version 2.7 of the JalviewLite applet also features a
- significantly enhanced Javascript API enabling it to be more easily
- integrated with javascript based web applications. <br /> For full
- details see the <a href="releases.html#Jalview2.7">Jalview 2.7
+ The Jalview 2.7.1 release features (tbc)
+ <br /> For full
+ details see the <a href="releases.html#Jalview2.7.1">Jalview 2.7.1
release history</a>.
</p>
<p>
- <strong>Highlights in Jalview Desktop Version 2.7</strong>
+ <strong>Highlights in Jalview Desktop Version 2.7.1</strong>
</p>
<ul>
- <li>New <a href="features/viewingpdbs.html">structure viewer
- options</a>:
- <ul>
- <li>Colour and superimpose 3D structures of complexes and
- multi-domain chains using several different alignments</li>
- <li>Drag and drop to associate PDB files with sequences that
- have the same name</li>
- <li>Open and superimpose all associated structures for the
- current selection</li>
- </ul>
- <li>New web services for <a href="webServices/shmr.html">alignment
- analysis</a></li>
- <li>Improved graphical user interface for <a
- href="http://www.compbio.dundee.ac.uk/jabaws">JABAWS</a>services.
- </li>
- <li>Sort associated alignment views option in tree viewer</li>
- <li>Default colours for <a
- href="colourSchemes/annotationColouring.html">shading alignment
- by quantitative annotation</a>.
- </li>
- <li><a href="webServices/newsreader.html">Jalview Desktop RSS
- reader</a> - following important updates at <a
- href="http://www.jalview.org/feeds/desktop/rss">http://www.jalview.org/feeds/desktop/rss</a>
+
+ <li>New Purine/Pyrimidine colour scheme</li>
+ <li>Colouring of RNA secondary structure by helices. See <a href="na/index.html">Nucleic Acid Support</a></li>
+ <li>Embedded <a href="http://www.varna.fr/">VARNA</a> RNA secondary structure viewer.
</ul>
<p>
<strong>Issues Resolved (a select list - see the <a
- href="releases.html#Jalview2.7">release history</a> for full details)
+ href="releases.html#Jalview2.7.1">release history</a> for full details)
</strong>
</p>
<p>
<strong>Issues in the Jalview Desktop</strong>
<ul>
- <li>Problems viewing associated structures for sequences
- retrieved from UNIPROT</li>
- <li>Problems viewing Jalview projects from older versions in
- version 2.6</li>
- <li>Preservation of hidden annotation rows and tree bootstrap
- values in projects</li>
- <li>Newly added JABAWS servers not always visible in web services
- menu</li>
</ul>
<strong>Issues specific to the JalviewLite Applet</strong>
<ul>
- <li>Layout problems when lots of annotation rows are displayed</li>
- <li><= shown as = in annotation row tooltip</li>
- <li>export features raises exception when no features exist</li>
- <li>relative URLs not handled properly when used in parameters
- and annotation files</li>
</ul>
<strong>Issues affecting both applet and application</strong>
<ul>
- <li>sequence numbering not preserved in MSF alignment output</li>
- <li>sequence associated secondary structure not correctly parsed
- in interleaved stockholm</li>
- <li>sequences containing lowercase letters are not properly
- associated with their pdb files</li>
- <li>Jalview PDB file reader does not extract sequence from deoxy
- nucleotide chains correctly</li>
- <li>Sequence length given in alignment properties window is off
- by 1</li>
</ul>
</body>
</html>
public Conservation(String name, Hashtable propHash, int threshold,
Vector sequences, int start, int end)
{
-
this.name = name;
this.propHash = propHash;
this.threshold = threshold;
--- /dev/null
+/* Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+
+/* Author: Lauren Michelle Lui
+ * Methods are based on RALEE methods http://personalpages.manchester.ac.uk/staff/sam.griffiths-jones/software/ralee/
+ * */
+
+package jalview.analysis;
+
+import java.util.ArrayList;
+import java.util.Hashtable;
+import java.util.Vector;
+
+import jalview.datamodel.SequenceFeature;
+
+public class Rna
+{
+ static Hashtable<Integer, Integer> pairHash = new Hashtable();
+ /**
+ * Based off of RALEE code ralee-get-base-pairs. Keeps track of open bracket
+ * positions in "stack" vector. When a close bracket is reached, pair this
+ * with the last element in the "stack" vector and store in "pairs" vector.
+ * Remove last element in the "stack" vector. Continue in this manner until
+ * the whole string is processed.
+ *
+ * @param line
+ * Secondary structure line of an RNA Stockholm file
+ * @return Array of SequenceFeature; type = RNA helix, begin is open base
+ * pair, end is close base pair
+ */
+ public static SequenceFeature[] GetBasePairs(String line)
+ {
+
+ Vector stack = new Vector();
+ Vector pairs = new Vector();
+
+ int i = 0;
+ while (i < line.length())
+ {
+ char base = line.charAt(i);
+
+ if ((base == '<') || (base == '(') || (base == '{') || (base == '['))
+ {
+ stack.addElement(i);
+ }
+ else if ((base == '>') || (base == ')') || (base == '}')
+ || (base == ']'))
+ {
+
+ Object temp = stack.lastElement();
+ stack.remove(stack.size() - 1);
+ pairs.addElement(temp);
+ pairs.addElement(i);
+ }
+
+ i++;
+ }
+
+ int numpairs = pairs.size() / 2;
+ SequenceFeature[] outPairs = new SequenceFeature[numpairs];
+
+ // Convert pairs to array
+ for (int p = 0; p < pairs.size(); p += 2)
+ {
+ int begin = Integer.parseInt(pairs.elementAt(p).toString());
+ int end = Integer.parseInt(pairs.elementAt(p + 1).toString());
+
+ outPairs[p / 2] = new SequenceFeature("RNA helix", "", "", begin,
+ end, "");
+ //pairHash.put(begin, end);
+
+ }
+
+ return outPairs;
+ }
+
+
+ /**
+ * Function to get the end position corresponding to a given start position
+ * @param indice - start position of a base pair
+ * @return - end position of a base pair
+ */
+ /*makes no sense at the moment :(
+ public int findEnd(int indice){
+ //TODO: Probably extend this to find the start to a given end?
+ //could be done by putting everything twice to the hash
+ ArrayList<Integer> pair = new ArrayList<Integer>();
+ return pairHash.get(indice);
+ }*/
+
+
+ /**
+ * Figures out which helix each position belongs to and stores the helix
+ * number in the 'featureGroup' member of a SequenceFeature Based off of RALEE
+ * code ralee-helix-map.
+ *
+ * @param pairs
+ * Array of SequenceFeature (output from Rna.GetBasePairs)
+ */
+ public static void HelixMap(SequenceFeature[] pairs)
+ {
+
+ int helix = 0; // Number of helices/current helix
+ int lastopen = 0; // Position of last open bracket reviewed
+ int lastclose = 9999999; // Position of last close bracket reviewed
+ int i = pairs.length; // Number of pairs
+
+ int open; // Position of an open bracket under review
+ int close; // Position of a close bracket under review
+ int j; // Counter
+
+ Hashtable helices = new Hashtable(); // Keep track of helix number for each
+ // position
+
+ // Go through each base pair and assign positions a helix
+ for (i = 0; i < pairs.length; i++)
+ {
+
+ open = pairs[i].getBegin();
+ close = pairs[i].getEnd();
+
+ // System.out.println("open " + open + " close " + close);
+ // System.out.println("lastclose " + lastclose + " lastopen " + lastopen);
+
+ // we're moving from right to left based on closing pair
+ /*
+ * catch things like <<..>>..<<..>> |
+ */
+ if (open > lastclose)
+ {
+ helix++;
+ }
+
+ /*
+ * catch things like <<..<<..>>..<<..>>>> |
+ */
+ j = pairs.length - 1;
+ while (j >= 0)
+ {
+ int popen = pairs[j].getBegin();
+
+ // System.out.println("j " + j + " popen " + popen + " lastopen "
+ // +lastopen + " open " + open);
+ if ((popen < lastopen) && (popen > open))
+ {
+ if (helices.containsValue(popen)
+ && (((Integer) helices.get(popen)) == helix))
+ {
+ continue;
+ }
+ else
+ {
+ helix++;
+ break;
+ }
+ }
+
+ j -= 1;
+ }
+
+ // Put positions and helix information into the hashtable
+ helices.put(open, helix);
+ helices.put(close, helix);
+
+ // Record helix as featuregroup
+ pairs[i].setFeatureGroup(Integer.toString(helix));
+
+ lastopen = open;
+ lastclose = close;
+
+ }
+ }
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.analysis;
+
+import java.util.*;
+
+import jalview.datamodel.*;
+
+/**
+ * Takes in a vector or array of sequences and column start and column end and
+ * returns a new Hashtable[] of size maxSeqLength, if Hashtable not supplied.
+ * This class is used extensively in calculating alignment colourschemes that
+ * depend on the amount of conservation in each alignment column.
+ *
+ * @author $author$
+ * @version $Revision$
+ */
+public class StructureFrequency
+{
+ // No need to store 1000s of strings which are not
+ // visible to the user.
+ public static final String MAXCOUNT = "C";
+
+ public static final String MAXRESIDUE = "R";
+
+ public static final String PID_GAPS = "G";
+
+ public static final String PID_NOGAPS = "N";
+
+ public static final String PROFILE = "P";
+
+ public static final String PAIRPROFILE = "B";
+
+ /**
+ * Returns the 3' position of a base pair
+ *
+ * @param pairs
+ * Secondary structure annotation
+ * @param indice
+ * 5' position of a base pair
+ * @return 3' position of a base pair
+ */
+ public static int findPair(SequenceFeature[] pairs, int indice)
+ {
+ for (int i = 0; i < pairs.length; i++)
+ {
+ if (pairs[i].getBegin() == indice)
+ {
+ return pairs[i].getEnd();
+ }
+ }
+ return -1;
+ }
+
+ /**
+ * Method to calculate a 'base pair consensus row', very similar to nucleotide
+ * consensus but takes into account a given structure
+ *
+ * @param sequences
+ * @param start
+ * @param end
+ * @param result
+ * @param profile
+ * @param rnaStruc
+ */
+ public static final void calculate(SequenceI[] sequences, int start,
+ int end, Hashtable[] result, boolean profile,
+ AlignmentAnnotation rnaStruc)
+ {
+ Hashtable residueHash;
+ String maxResidue;
+ char[] seq, struc = rnaStruc.getRNAStruc().toCharArray();
+ SequenceFeature[] rna = rnaStruc._rnasecstr;
+ char c, s, cEnd;
+ int count, nonGap = 0, i, bpEnd = -1, j, jSize = sequences.length;
+ int[] values;
+ int[][] pairs;
+ float percentage;
+
+ for (i = start; i < end; i++) // foreach column
+ {
+ residueHash = new Hashtable();
+ maxResidue = "-";
+ values = new int[255];
+ pairs = new int[255][255];
+ bpEnd = -1;
+ if (i < struc.length)
+ {
+ s = struc[i];
+ }
+ else
+ {
+ s = '-';
+ }
+ if (s == '.' || s == ' ')
+ {
+ s = '-';
+ }
+
+ if (s != '(')
+ {
+ if (s == '-')
+ {
+ values['-']++;
+ }
+ }
+ else
+ {
+ for (j = 0; j < jSize; j++) // foreach row
+ {
+ if (sequences[j] == null)
+ {
+ System.err
+ .println("WARNING: Consensus skipping null sequence - possible race condition.");
+ continue;
+ }
+ seq = sequences[j].getSequence();
+
+ if (seq.length > i)
+ {
+ c = seq[i];
+
+ // standard representation for gaps in sequence and structure
+ if (c == '.' || c == ' ')
+ {
+ c = '-';
+ }
+
+ if (c == '-')
+ {
+ values['-']++;
+ continue;
+ }
+ bpEnd = findPair(rna, i);
+ cEnd = seq[bpEnd];
+ if (checkBpType(c, cEnd))
+ {
+ values['(']++; // H means it's a helix (structured)
+ }
+ pairs[c][cEnd]++;
+
+ maxResidue = "(";
+ }
+ }
+ // nonGap++;
+ }
+ // UPDATE this for new values
+ if (profile)
+ {
+ residueHash.put(PROFILE, new int[][]
+ { values, new int[]
+ { jSize, (jSize - values['-']) } });
+
+ residueHash.put(PAIRPROFILE, pairs);
+ }
+
+ count = values['('];
+
+ residueHash.put(MAXCOUNT, new Integer(count));
+ residueHash.put(MAXRESIDUE, maxResidue);
+
+ percentage = ((float) count * 100) / (float) jSize;
+ residueHash.put(PID_GAPS, new Float(percentage));
+
+ // percentage = ((float) count * 100) / (float) nongap;
+ // residueHash.put(PID_NOGAPS, new Float(percentage));
+ if (result[i] == null)
+ {
+ result[i] = residueHash;
+ }
+ if (bpEnd > 0)
+ {
+ values[')'] = values['('];
+ values['('] = 0;
+
+ residueHash = new Hashtable();
+ maxResidue = ")";
+
+ if (profile)
+ {
+ residueHash.put(PROFILE, new int[][]
+ { values, new int[]
+ { jSize, (jSize - values['-']) } });
+
+ residueHash.put(PAIRPROFILE, pairs);
+ }
+
+ residueHash.put(MAXCOUNT, new Integer(count));
+ residueHash.put(MAXRESIDUE, maxResidue);
+
+ percentage = ((float) count * 100) / (float) jSize;
+ residueHash.put(PID_GAPS, new Float(percentage));
+
+ result[bpEnd] = residueHash;
+ }
+ }
+ }
+
+ /**
+ * Method to check if a base-pair is a canonical or a wobble bp
+ *
+ * @param up
+ * 5' base
+ * @param down
+ * 3' base
+ * @return True if it is a canonical/wobble bp
+ */
+ public static boolean checkBpType(char up, char down)
+ {
+ if (up > 'Z')
+ {
+ up -= 32;
+ }
+ if (down > 'Z')
+ {
+ down -= 32;
+ }
+
+ switch (up)
+ {
+ case 'A':
+ switch (down)
+ {
+ case 'T':
+ return true;
+ case 'U':
+ return true;
+ }
+ break;
+ case 'C':
+ switch (down)
+ {
+ case 'G':
+ return true;
+ }
+ break;
+ case 'T':
+ switch (down)
+ {
+ case 'A':
+ return true;
+ case 'G':
+ return true;
+ }
+ break;
+ case 'G':
+ switch (down)
+ {
+ case 'C':
+ return true;
+ case 'T':
+ return true;
+ case 'U':
+ return true;
+ }
+ break;
+ case 'U':
+ switch (down)
+ {
+ case 'A':
+ return true;
+ case 'G':
+ return true;
+ }
+ break;
+ }
+ return false;
+ }
+
+ /**
+ * Compute all or part of the annotation row from the given consensus
+ * hashtable
+ *
+ * @param consensus
+ * - pre-allocated annotation row
+ * @param hconsensus
+ * @param iStart
+ * @param width
+ * @param ignoreGapsInConsensusCalculation
+ * @param includeAllConsSymbols
+ */
+ public static void completeConsensus(AlignmentAnnotation consensus,
+ Hashtable[] hconsensus, int iStart, int width,
+ boolean ignoreGapsInConsensusCalculation,
+ boolean includeAllConsSymbols)
+ {
+ float tval, value;
+ if (consensus == null || consensus.annotations == null
+ || consensus.annotations.length < width)
+ {
+ // called with a bad alignment annotation row - wait for it to be
+ // initialised properly
+ return;
+ }
+ for (int i = iStart; i < width; i++)
+ {
+ if (i >= hconsensus.length)
+ {
+ // happens if sequences calculated over were shorter than alignment
+ // width
+ consensus.annotations[i] = null;
+ continue;
+ }
+ value = 0;
+ if (ignoreGapsInConsensusCalculation)
+ {
+ value = ((Float) hconsensus[i].get(StructureFrequency.PID_NOGAPS))
+ .floatValue();
+ }
+ else
+ {
+ value = ((Float) hconsensus[i].get(StructureFrequency.PID_GAPS))
+ .floatValue();
+ }
+
+ String maxRes = hconsensus[i].get(StructureFrequency.MAXRESIDUE)
+ .toString();
+ String mouseOver = hconsensus[i].get(StructureFrequency.MAXRESIDUE)
+ + " ";
+ if (maxRes.length() > 1)
+ {
+ mouseOver = "[" + maxRes + "] ";
+ maxRes = "+";
+ }
+ int[][] profile = (int[][]) hconsensus[i]
+ .get(StructureFrequency.PROFILE);
+ int[][] pairs = (int[][]) hconsensus[i]
+ .get(StructureFrequency.PAIRPROFILE);
+
+ if (pairs != null && includeAllConsSymbols) // Just responsible for the
+ // tooltip
+ // TODO Update tooltips for Structure row
+ {
+ mouseOver = "";
+
+ /* TODO It's not sure what is the purpose of the alphabet and wheter it is useful for structure?
+ *
+ * if (alphabet != null) { for (int c = 0; c < alphabet.length; c++) {
+ * tval = ((float) profile[0][alphabet[c]]) 100f / (float)
+ * profile[1][ignoreGapsInConsensusCalculation ? 1 : 0]; mouseOver +=
+ * ((c == 0) ? "" : "; ") + alphabet[c] + " " + ((int) tval) + "%"; } }
+ * else {
+ */
+ Object[] ca = new Object[625];
+ float[] vl = new float[625];
+ int x = 0;
+ for (int c = 65; c < 90; c++)
+ {
+ for (int d = 65; d < 90; d++)
+ {
+ ca[x] = new int[]
+ { c, d };
+ vl[x] = (float) pairs[c][d];
+ x++;
+ }
+ }
+ jalview.util.QuickSort.sort(vl, ca);
+ int p = 0;
+
+ for (int c = 624; c > 0; c--)
+ {
+ if (vl[c] > 0)
+ {
+ tval = ((float) vl[c] * 100f / (float) profile[1][ignoreGapsInConsensusCalculation ? 1
+ : 0]);
+ mouseOver += ((p == 0) ? "" : "; ") + (char) ((int[]) ca[c])[0]
+ + (char) ((int[]) ca[c])[1] + " " + ((int) tval) + "%";
+ p++;
+
+ }
+ }
+
+ // }
+ }
+ else
+ {
+ mouseOver += ((int) value + "%");
+ }
+ consensus.annotations[i] = new Annotation(maxRes, mouseOver, ' ',
+ value);
+ }
+ }
+
+ /**
+ * get the sorted base-pair profile for the given position of the consensus
+ *
+ * @param hconsensus
+ * @return profile of the given column
+ */
+ public static int[] extractProfile(Hashtable hconsensus,
+ boolean ignoreGapsInConsensusCalculation)
+ {
+ int[] rtnval = new int[51]; // 2*(5*5)+1
+ int[][] profile = (int[][]) hconsensus.get(StructureFrequency.PROFILE);
+ int[][] pairs = (int[][]) hconsensus
+ .get(StructureFrequency.PAIRPROFILE);
+
+ if (profile == null)
+ return null;
+
+ // TODO fix the object length, also do it in completeConsensus
+ Object[] ca = new Object[625];
+ float[] vl = new float[625];
+ int x = 0;
+ for (int c = 65; c < 90; c++)
+ {
+ for (int d = 65; d < 90; d++)
+ {
+ ca[x] = new int[]
+ { c, d };
+ vl[x] = (float) pairs[c][d];
+ x++;
+ }
+ }
+ jalview.util.QuickSort.sort(vl, ca);
+
+ rtnval[0] = 1;
+ for (int c = 624; c > 0; c--)
+ {
+ if (vl[c] > 0)
+ {
+ rtnval[rtnval[0]++] = ((int[]) ca[c])[0];
+ rtnval[rtnval[0]++] = ((int[]) ca[c])[1];
+ rtnval[rtnval[0]++] = (int) ((float) vl[c] * 100f / (float) profile[1][ignoreGapsInConsensusCalculation ? 1
+ : 0]);
+ }
+ }
+
+ return rtnval;
+ }
+
+ public static void main(String args[])
+ {
+ // Short test to see if checkBpType works
+ ArrayList<String> test = new ArrayList<String>();
+ test.add("A");
+ test.add("c");
+ test.add("g");
+ test.add("T");
+ test.add("U");
+ for (String i : test)
+ {
+ for (String j : test)
+ {
+ System.out.println(i + "-" + j + ": "
+ + StructureFrequency.checkBpType(i.charAt(0), j.charAt(0)));
+ }
+ }
+ }
+}
MenuItem turn = new MenuItem("Turn Propensity");
MenuItem buried = new MenuItem("Buried Index");
+
+ MenuItem purinepyrimidine = new MenuItem("Purine/Pyrimidine");
MenuItem user = new MenuItem("User Defined Colours");
strand.addActionListener(this);
turn.addActionListener(this);
buried.addActionListener(this);
+ purinepyrimidine.addActionListener(this);
user.addActionListener(this);
jmolHelp.addActionListener(this);
coloursMenu.add(strand);
coloursMenu.add(turn);
coloursMenu.add(buried);
+ coloursMenu.add(purinepyrimidine);
coloursMenu.add(user);
coloursMenu.add(jmolColour);
helpMenu.add(jmolHelp);
setEnabled(buried);
jmb.setJalviewColourScheme(new BuriedColourScheme());
}
+ else if(evt.getSource() == purinepyrimidine)
+ {
+ jmb.setJalviewColourScheme(new PurinePyrimidineColourScheme());
+ }
else if (evt.getSource() == user)
{
setEnabled(user);
public static final int PASTE = 3;
public static final int REPLACE = 4;
+
+ public static final int INSERT_NUC=5;
Edit[] edits;
case REPLACE:
replace(edits[e]);
break;
+ //TODO:add deleteNuc for UNDO
+// case INSERT_NUC:
+// insertNuc(edits[e]);
+// break;
}
}
}
case REPLACE:
replace(edits[e]);
break;
- }
+ }
}
}
{
command.seqs[s].insertCharAt(command.position, command.number,
command.gapChar);
+// System.out.println("pos: "+command.position+" number: "+command.number);
}
adjustAnnotations(command, true, false, null);
}
+//
+// final void insertNuc(Edit command)
+// {
+//
+// for (int s = 0; s < command.seqs.length; s++)
+// {
+// System.out.println("pos: "+command.position+" number: "+command.number);
+// command.seqs[s].insertCharAt(command.position, command.number,'A');
+// }
+//
+// adjustAnnotations(command, true, false, null);
+// }
final void deleteGap(Edit command)
{
public static final int PROTEIN = 0;
public static final int NUCLEOTIDE = 1;
+
+ public boolean hasRNAStructure = false;
/** DOCUMENT ME!! */
public AlignmentAnnotation[] annotations;
*/
public void addAnnotation(AlignmentAnnotation aa, int pos)
{
+ if(aa.getRNAStruc()!= null){
+ hasRNAStructure=true;
+ }
+
int aSize = 1;
if (annotations != null)
{
return false;
}
}
+
+ public boolean hasRNAStructure(){
+ //TODO can it happen that structure is removed from alignment?
+ return hasRNAStructure;
+ }
public void setDataset(Alignment data)
{
*/
package jalview.datamodel;
+import jalview.analysis.Rna;
+
import java.util.Enumeration;
import java.util.Hashtable;
public boolean autoCalculated = false;
public String annotationId;
-
+
public SequenceI sequenceRef;
/** DOCUMENT ME!! */
/** DOCUMENT ME!! */
public Annotation[] annotations;
+ /**
+ * RNA secondary structure contact positions
+ */
+ public SequenceFeature[] _rnasecstr = null;
+
+ public String rnaStructure;
+
+ /**
+ * Updates the _rnasecstr field Determines the positions that base pair and
+ * the positions of helices based on secondary structure from a Stockholm file
+ *
+ * @param RNAannot
+ */
+ private void _updateRnaSecStr(String RNAannot)
+ {
+ _rnasecstr = Rna.GetBasePairs(RNAannot);
+ Rna.HelixMap(_rnasecstr);
+
+ setRNAStruc(RNAannot);
+
+ if (_rnasecstr != null && _rnasecstr.length > 0)
+ {
+ // show all the RNA secondary structure annotation symbols.
+ showAllColLabels = true;
+ scaleColLabel = true;
+ }
+ // System.out.println("featuregroup " + _rnasecstr[0].getFeatureGroup());
+ }
+
public java.util.Hashtable sequenceMapping;
/** DOCUMENT ME!! */
validateRangeAndDisplay();
}
+ /**
+ * Checks if annotation labels represent secondary structures
+ *
+ */
void areLabelsSecondaryStructure()
{
boolean nonSSLabel = false;
+ boolean isrna = false;
+ StringBuffer rnastring = new StringBuffer();
+
char firstChar = 0;
for (int i = 0; i < annotations.length; i++)
{
{
hasIcons |= true;
}
+ else
+ // Check for RNA secondary structure
+ {
+ if (annotations[i].secondaryStructure == 'S')
+ {
+ hasIcons |= true;
+ isrna |= true;
+ }
+ }
+
+ // System.out.println("displaychar " + annotations[i].displayCharacter);
- if (annotations[i].displayCharacter == null)
+ if (annotations[i].displayCharacter == null
+ || annotations[i].displayCharacter.length() == 0)
{
+ rnastring.append('.');
continue;
}
if (annotations[i].displayCharacter.length() == 1)
firstChar != ' '
&& firstChar != 'H'
&& firstChar != 'E'
+ && firstChar != 'S'
&& firstChar != '-'
&& firstChar < jalview.schemes.ResidueProperties.aaIndex.length)
{
}
}
}
+ else
+ {
+ rnastring.append(annotations[i].displayCharacter.charAt(1));
+ }
if (annotations[i].displayCharacter.length() > 0)
{
}
}
+ else
+ {
+ if (isrna)
+ {
+ _updateRnaSecStr(rnastring.toString());
+ }
+ }
annotationId = this.hashCode() + "";
}
- /**
+ public void setRNAStruc(String string) {
+ rnaStructure=string;
+}
+
+ public String getRNAStruc(){
+ return rnaStructure;
+ }
+
+/**
* Creates a new AlignmentAnnotation object.
*
* @param label
* checks graphMin and graphMax, secondary structure symbols, sets graphType
* appropriately, sets null labels to the empty string if appropriate.
*/
- private void validateRangeAndDisplay()
+ public void validateRangeAndDisplay()
{
if (annotations == null)
/**
* Deletes a specific AlignmentAnnotation from the alignment, and removes its
- * reference from any SequenceI or SequenceGroup object's annotation if and only if aa is
- * contained within the alignment's annotation vector. Otherwise, it will do
- * nothing.
+ * reference from any SequenceI or SequenceGroup object's annotation if and
+ * only if aa is contained within the alignment's annotation vector.
+ * Otherwise, it will do nothing.
*
* @param aa
* the annotation to delete
public boolean deleteAnnotation(AlignmentAnnotation aa);
/**
- * Deletes a specific AlignmentAnnotation from the alignment, and optionally removes any
- * reference from any SequenceI or SequenceGroup object's annotation if and only if aa is
- * contained within the alignment's annotation vector. Otherwise, it will do
- * nothing.
+ * Deletes a specific AlignmentAnnotation from the alignment, and optionally
+ * removes any reference from any SequenceI or SequenceGroup object's
+ * annotation if and only if aa is contained within the alignment's annotation
+ * vector. Otherwise, it will do nothing.
*
* @param aa
* the annotation to delete
* @param unhook
- * flag indicating if any references should be removed from annotation - use this if you intend to add the annotation back into the alignment
+ * flag indicating if any references should be removed from
+ * annotation - use this if you intend to add the annotation back
+ * into the alignment
* @return true if annotation was deleted from this alignment.
*/
public boolean deleteAnnotation(AlignmentAnnotation aa, boolean unhook);
public boolean isNucleotide();
/**
+ * Test if alignment contains RNA structure
+ *
+ * @return true if RNA structure AligmnentAnnotation was added to alignment
+ */
+ public boolean hasRNAStructure();
+
+ /**
* Set alignment to be a nucleotide sequence
*
*/
public String description = ""; // currently used as mouse over
/** DOCUMENT ME!! */
- public char secondaryStructure = ' '; // recognises H and E
+ public char secondaryStructure = ' '; // recognises H, E and S(?)
/** DOCUMENT ME!! */
public float value;
* PFAM ID\r
*/\r
public static String PFAM = "PFAM";\r
+ \r
+ /**\r
+ * RFAM ID\r
+ */\r
+ public static String RFAM = "RFAM";\r
\r
/**\r
* GeneDB ID\r
{ PDB };\r
\r
public static final String[] DOMAINDBS =\r
- { PFAM };\r
+ { PFAM, RFAM };\r
\r
/**\r
* set of unique DBRefSource property constants. These could be used to\r
public static final Object DNACODINGSEQDB = "XONCODING";\r
\r
/**\r
- * DB returns several sequences associated with a protein domain\r
+ * DB returns several sequences associated with a protein/nucleotide domain\r
*/\r
public static final Object DOMAINDB = "DOMAIN";\r
\r
public Hashtable otherDetails;
public java.util.Vector links;
-
+
// Feature group can be set from a features file
// as a group of features between STARTGROUP and ENDGROUP markers
public String featureGroup;
}
}
}
-
+
public SequenceFeature(String type, String desc, String status,
int begin, int end, String featureGroup)
{
--- /dev/null
+/*\r
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)\r
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle\r
+ * \r
+ * This file is part of Jalview.\r
+ * \r
+ * Jalview is free software: you can redistribute it and/or\r
+ * modify it under the terms of the GNU General Public License \r
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.\r
+ * \r
+ * Jalview is distributed in the hope that it will be useful, but \r
+ * WITHOUT ANY WARRANTY; without even the implied warranty \r
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR \r
+ * PURPOSE. See the GNU General Public License for more details.\r
+ * \r
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.\r
+ */\r
+package jalview.ext.varna;\r
+\r
+import java.io.File;\r
+\r
+import java.net.URL;\r
+import java.util.*;\r
+import java.applet.Applet;\r
+import java.awt.*;\r
+import java.awt.event.*;\r
+\r
+import javax.swing.JPanel;\r
+\r
+import jalview.api.AlignmentViewPanel;\r
+import jalview.api.FeatureRenderer;\r
+import jalview.api.SequenceRenderer;\r
+import jalview.api.SequenceStructureBinding;\r
+import jalview.api.StructureSelectionManagerProvider;\r
+import jalview.datamodel.*;\r
+import jalview.structure.*;\r
+import jalview.io.*;\r
+\r
+import org.jmol.api.*;\r
+import org.jmol.adapter.smarter.SmarterJmolAdapter;\r
+\r
+import org.jmol.popup.*;\r
+import org.jmol.viewer.JmolConstants;\r
+import org.jmol.viewer.Viewer;\r
+\r
+import jalview.schemes.*;\r
+\r
+import fr.orsay.lri.varna.applications.*;\r
+\r
+\r
+public abstract class JalviewVarnaBinding implements StructureListener, SequenceStructureBinding,\r
+ ComponentListener, StructureSelectionManagerProvider\r
+\r
+{\r
+ \r
+}\r
--- /dev/null
+/**\r
+ * \r
+ */\r
+package jalview.ext.varna;\r
+\r
+import jalview.api.FeatureRenderer;\r
+import jalview.api.SequenceRenderer;\r
+import jalview.datamodel.AlignmentI;\r
+import jalview.datamodel.SequenceI;\r
+import jalview.structure.StructureMapping;\r
+import jalview.structure.StructureSelectionManager;\r
+import jalview.util.Comparison;\r
+\r
+import java.awt.Color;\r
+import java.util.ArrayList;\r
+\r
+/**\r
+ * Routines for generating Jmol commands for Jalview/Jmol binding\r
+ * another cruisecontrol test.\r
+ * \r
+ * @author JimP\r
+ *\r
+ */\r
+public class VarnaCommands\r
+{\r
+\r
+ /**\r
+ * Jmol utility which constructs the commands to colour chains by the given alignment\r
+ * \r
+ */\r
+ public static String[] getColourBySequenceCommand(StructureSelectionManager ssm, String[] files, SequenceI[][] sequence, SequenceRenderer sr, FeatureRenderer fr, AlignmentI alignment)\r
+ {\r
+ ArrayList<String> str = new ArrayList<String>();\r
+ StringBuffer command = new StringBuffer();\r
+ \r
+ for (int pdbfnum = 0; pdbfnum < files.length; pdbfnum++)\r
+ {\r
+ StructureMapping[] mapping = ssm.getMapping(files[pdbfnum]);\r
+ \r
+ if (mapping == null || mapping.length < 1)\r
+ continue;\r
+ \r
+ int lastPos = -1;\r
+ for (int s = 0; s < sequence[pdbfnum].length; s++)\r
+ {\r
+ for (int sp, m = 0; m < mapping.length; m++)\r
+ {\r
+ if (mapping[m].getSequence() == sequence[pdbfnum][s]\r
+ && (sp = alignment.findIndex(sequence[pdbfnum][s])) > -1)\r
+ {\r
+ SequenceI asp = alignment.getSequenceAt(sp);\r
+ for (int r = 0; r < asp.getLength(); r++)\r
+ {\r
+ // no mapping to gaps in sequence\r
+ if (jalview.util.Comparison.isGap(asp.getCharAt(r)))\r
+ {\r
+ continue;\r
+ }\r
+ int pos = mapping[m].getPDBResNum(asp.findPosition(r));\r
+ \r
+ if (pos < 1 || pos == lastPos)\r
+ continue;\r
+ \r
+ lastPos = pos;\r
+ \r
+ Color col = sr.getResidueBoxColour(sequence[pdbfnum][s], r);\r
+ \r
+ if (fr != null)\r
+ col = fr.findFeatureColour(col, sequence[pdbfnum][s], r);\r
+ String newSelcom = (mapping[m].getChain() != " " ? ":"\r
+ + mapping[m].getChain() : "")\r
+ + "/"\r
+ + (pdbfnum + 1)\r
+ + ".1"\r
+ + ";color["\r
+ + col.getRed()\r
+ + ","\r
+ + col.getGreen()\r
+ + ","\r
+ + col.getBlue() + "]";\r
+ if (command.length()>newSelcom.length() && command.substring(command.length()-newSelcom.length()).equals(newSelcom))\r
+ {\r
+ command = VarnaCommands.condenseCommand(command, pos);\r
+ continue;\r
+ }\r
+ // TODO: deal with case when buffer is too large for Jmol to parse\r
+ // - execute command and flush\r
+ \r
+ command.append(";");\r
+ if (command.length()>51200)\r
+ {\r
+ // add another chunk\r
+ str.add(command.toString());\r
+ command.setLength(0);\r
+ }\r
+ command.append("select " + pos);\r
+ command.append(newSelcom);\r
+ }\r
+ break;\r
+ }\r
+ }\r
+ }\r
+ }\r
+ {\r
+ // add final chunk\r
+ str.add(command.toString());\r
+ command.setLength(0);\r
+ }\r
+ return str.toArray(new String[str.size()]);\r
+ }\r
+\r
+ public static StringBuffer condenseCommand(StringBuffer command, int pos)\r
+ {\r
+ \r
+ // work back to last 'select'\r
+ int p=command.length(),q=p;\r
+ do {\r
+ p-=6;\r
+ if (p<1) { p=0; };\r
+ } while ((q=command.indexOf("select",p))==-1 && p>0);\r
+ \r
+ StringBuffer sb = new StringBuffer(command.substring(0,q+7));\r
+ \r
+ command = command.delete(0,q+7);\r
+ \r
+ String start;\r
+ \r
+ if (command.indexOf("-") > -1)\r
+ {\r
+ start = command.substring(0, command.indexOf("-"));\r
+ }\r
+ else\r
+ {\r
+ start = command.substring(0, command.indexOf(":"));\r
+ }\r
+ \r
+ sb.append(start + "-" + pos + command.substring(command.indexOf(":")));\r
+ \r
+ return sb;\r
+ }\r
+\r
+}\r
import jalview.schemes.HydrophobicColourScheme;
import jalview.schemes.NucleotideColourScheme;
import jalview.schemes.PIDColourScheme;
+import jalview.schemes.PurinePyrimidineColourScheme;
import jalview.schemes.ResidueProperties;
import jalview.schemes.StrandColourScheme;
import jalview.schemes.TaylorColourScheme;
|| evt.isShiftDown() || evt.isAltDown());
}
break;
-
+
+ //case KeyEvent.VK_A:
+ // if (viewport.cursorMode)
+ // {
+ // alignPanel.seqPanel.insertNucAtCursor(false,"A");
+ // //System.out.println("A");
+ // }
+ // break;
+ /*
+ case KeyEvent.VK_CLOSE_BRACKET:
+ if (viewport.cursorMode)
+ {
+ System.out.println("closing bracket");
+ }
+ break;
+ */
case KeyEvent.VK_DELETE:
case KeyEvent.VK_BACK_SPACE:
if (!viewport.cursorMode)
}
ap.av.updateConservation(ap);
ap.av.updateConsensus(ap);
+ ap.av.updateStrucConsensus(ap);
}
}
changeColour(new NucleotideColourScheme());
}
+ public void purinePyrimidineColour_actionPerformed(ActionEvent e)
+ {
+ changeColour(new PurinePyrimidineColourScheme());
+ }
+ /*
+ public void covariationColour_actionPerformed(ActionEvent e)
+ {
+ changeColour(new CovariationColourScheme(viewport.alignment.getAlignmentAnnotation()[0]));
+ }
+ */
public void annotationColour_actionPerformed(ActionEvent e)
{
new AnnotationColourChooser(viewport, alignPanel);
}
+
+ public void rnahelicesColour_actionPerformed(ActionEvent e)
+ {
+ new RNAHelicesColourChooser(viewport, alignPanel);
+ }
/**
* DOCUMENT ME!
/** DOCUMENT ME!! */
public Hashtable[] hconsensus;
+ public Hashtable[] hStrucConsensus;
+
AlignmentAnnotation consensus;
+ AlignmentAnnotation strucConsensus;
+
AlignmentAnnotation conservation;
AlignmentAnnotation quality;
boolean autoCalculateConsensus = true;
+ boolean autoCalculateStrucConsensus = true;
+
/** DOCUMENT ME!! */
public int ConsPercGaps = 25; // JBPNote : This should be a scalable property!
consensus.hasText = true;
consensus.autoCalculated = true;
+ if (alignment.isNucleotide() && alignment.hasRNAStructure())
+ {
+ strucConsensus = new AlignmentAnnotation("StrucConsensus", "PID",
+ new Annotation[1], 0f, 100f, AlignmentAnnotation.BAR_GRAPH);
+ strucConsensus.hasText = true;
+ strucConsensus.autoCalculated = true;
+ }
+
if (Cache.getDefault("SHOW_IDENTITY", true))
{
alignment.addAnnotation(consensus);
+ // TODO: Make own if for structure
+ if (alignment.isNucleotide() && alignment.hasRNAStructure())
+ {
+ alignment.addAnnotation(strucConsensus);
+ }
}
+
}
if (jalview.bin.Cache.getProperty("DEFAULT_COLOUR") != null)
ConsensusThread consensusThread;
+ StrucConsensusThread strucConsensusThread;
+
boolean consUpdateNeeded = false;
static boolean UPDATING_CONSENSUS = false;
+ static boolean UPDATING_STRUC_CONSENSUS = false;
+
static boolean UPDATING_CONSERVATION = false;
boolean updatingConsensus = false;
+ boolean updatingStrucConsensus = false;
+
boolean updatingConservation = false;
/**
consensus.annotations = new Annotation[aWidth];
hconsensus = new Hashtable[aWidth];
- AAFrequency.calculate(alignment.getSequencesArray(), 0,
- alignment.getWidth(), hconsensus, true);
+ AAFrequency.calculate(alignment.getSequencesArray(), 0, alignment
+ .getWidth(), hconsensus, true);
updateAnnotation(true);
-
if (globalColourScheme != null)
{
globalColourScheme.setConsensus(hconsensus);
}
}
+ // --------START Structure Conservation
+ public void updateStrucConsensus(final AlignmentPanel ap)
+ {
+ // see note in mantis : issue number 8585
+ if (strucConsensus == null || !autoCalculateStrucConsensus)
+ {
+ return;
+ }
+ strucConsensusThread = new StrucConsensusThread(ap);
+ strucConsensusThread.start();
+ }
+
+ class StrucConsensusThread extends Thread
+ {
+ AlignmentPanel ap;
+
+ public StrucConsensusThread(AlignmentPanel ap)
+ {
+ this.ap = ap;
+ }
+
+ public void run()
+ {
+ updatingStrucConsensus = true;
+ while (UPDATING_STRUC_CONSENSUS)
+ {
+ try
+ {
+ if (ap != null)
+ {
+ ap.paintAlignment(false);
+ }
+
+ Thread.sleep(200);
+ } catch (Exception ex)
+ {
+ ex.printStackTrace();
+ }
+ }
+
+ UPDATING_STRUC_CONSENSUS = true;
+
+ try
+ {
+ int aWidth = (alignment != null) ? alignment.getWidth() : -1; // null
+ // pointer
+ // possibility
+ // here.
+ if (aWidth <= 0)
+ {
+ updatingStrucConsensus = false;
+ UPDATING_STRUC_CONSENSUS = false;
+ return;
+ }
+
+ strucConsensus.annotations = null;
+ strucConsensus.annotations = new Annotation[aWidth];
+
+ hStrucConsensus = new Hashtable[aWidth];
+
+ AlignmentAnnotation[] aa = ap.av.getAlignment()
+ .getAlignmentAnnotation();
+ AlignmentAnnotation rnaStruc = null;
+ for (int i = 0; i < aa.length; i++)
+ {
+ if (aa[i].getRNAStruc() != null)
+ {
+ rnaStruc = aa[i];
+ break;
+ }
+ }
+
+ AlignmentAnnotation rna = ap.av.getAlignment()
+ .getAlignmentAnnotation()[0];
+ StructureFrequency.calculate(alignment.getSequencesArray(), 0,
+ alignment.getWidth(), hStrucConsensus, true, rnaStruc);
+ // TODO AlignmentAnnotation rnaStruc!!!
+ updateAnnotation(true);
+ if (globalColourScheme != null)
+ {
+ globalColourScheme.setConsensus(hStrucConsensus);
+ }
+
+ } catch (OutOfMemoryError error)
+ {
+ alignment.deleteAnnotation(strucConsensus);
+
+ strucConsensus = null;
+ hStrucConsensus = null;
+ new OOMWarning("calculating structure consensus", error);
+ }
+ UPDATING_STRUC_CONSENSUS = false;
+ updatingStrucConsensus = false;
+
+ if (ap != null)
+ {
+ ap.paintAlignment(true);
+ }
+ }
+
+ /**
+ * update the consensus annotation from the sequence profile data using
+ * current visualization settings.
+ */
+ public void updateAnnotation()
+ {
+ updateAnnotation(false);
+ }
+
+ protected void updateAnnotation(boolean immediate)
+ {
+ // TODO: make calls thread-safe, so if another thread calls this method,
+ // it will either return or wait until one calculation is finished.
+ if (immediate
+ || (!updatingStrucConsensus && strucConsensus != null && hStrucConsensus != null))
+ {
+ StructureFrequency.completeConsensus(strucConsensus,
+ hStrucConsensus, 0, hStrucConsensus.length, false,
+ showSequenceLogo);
+ }
+ }
+ }
+
+ // --------END Structure Conservation
+
/**
* get the consensus sequence as displayed under the PID consensus annotation
* row.
/**
* Set the selection group for this window.
*
- * @param sg - group holding references to sequences in this alignment view
- *
+ * @param sg
+ * - group holding references to sequences in this alignment view
+ *
*/
public void setSelectionGroup(SequenceGroup sg)
{
/**
* GUI state
+ *
* @return true if conservation based shading is enabled
*/
public boolean getConservationSelected()
/**
* GUI state
+ *
* @param b
* enable conservation based shading
*/
/**
* GUI state
+ *
* @return true if percent identity threshold is applied to shading
*/
public boolean getAbovePIDThreshold()
* GUI state
*
*
- * @param b indicate if percent identity threshold is applied to shading
+ * @param b
+ * indicate if percent identity threshold is applied to shading
*/
public void setAbovePIDThreshold(boolean b)
{
{
if (alignment != null && alignment.getCodonFrames() != null)
{
- StructureSelectionManager.getStructureSelectionManager(Desktop.instance)
- .removeMappings(alignment.getCodonFrames());
+ StructureSelectionManager.getStructureSelectionManager(
+ Desktop.instance).removeMappings(alignment.getCodonFrames());
}
this.alignment = align;
if (alignment.getCodonFrames() != null)
{
- StructureSelectionManager.getStructureSelectionManager(Desktop.instance).addMappings(
- alignment.getCodonFrames());
+ StructureSelectionManager.getStructureSelectionManager(
+ Desktop.instance).addMappings(alignment.getCodonFrames());
}
}
public jalview.datamodel.CigarArray getViewAsCigars(
boolean selectedRegionOnly)
{
- return new jalview.datamodel.CigarArray(alignment, (hasHiddenColumns ? colSel : null), (selectedRegionOnly ? selectionGroup : null));
+ return new jalview.datamodel.CigarArray(alignment,
+ (hasHiddenColumns ? colSel : null),
+ (selectedRegionOnly ? selectionGroup : null));
}
/**
* boolean true to just return the selected view
* @return AlignmentView
*/
- public jalview.datamodel.AlignmentView getAlignmentView(boolean selectedOnly)
+ public jalview.datamodel.AlignmentView getAlignmentView(
+ boolean selectedOnly)
{
return getAlignmentView(selectedOnly, false);
}
-
+
/**
* return a compact representation of the current alignment selection to pass
* to an analysis function
* @param selectedOnly
* boolean true to just return the selected view
* @param markGroups
- * boolean true to annotate the alignment view with groups on the alignment (and intersecting with selected region if selectedOnly is true)
+ * boolean true to annotate the alignment view with groups on the
+ * alignment (and intersecting with selected region if selectedOnly
+ * is true)
* @return AlignmentView
*/
- public jalview.datamodel.AlignmentView getAlignmentView(boolean selectedOnly, boolean markGroups)
+ public jalview.datamodel.AlignmentView getAlignmentView(
+ boolean selectedOnly, boolean markGroups)
{
- return new AlignmentView(alignment, colSel, selectionGroup, hasHiddenColumns, selectedOnly, markGroups);
+ return new AlignmentView(alignment, colSel, selectionGroup,
+ hasHiddenColumns, selectedOnly, markGroups);
}
/**
{
updateConsensus(ap);
}
+ if (autoCalculateStrucConsensus)
+ {
+ updateStrucConsensus(ap);
+ }
// Reset endRes of groups if beyond alignment width
int alWidth = alignment.getWidth();
{
Alignment al = (Alignment) alignment;
Conservation c = new Conservation("All",
- ResidueProperties.propHash, 3, al.getSequences(), 0,
- al.getWidth() - 1);
+ ResidueProperties.propHash, 3, al.getSequences(), 0, al
+ .getWidth() - 1);
c.calculate();
c.verdict(false, ConsPercGaps);
SequenceGroup sg = (SequenceGroup) alignment.getGroups().elementAt(s);
if (sg.cs != null && sg.cs instanceof ClustalxColourScheme)
{
- ((ClustalxColourScheme) sg.cs).resetClustalX(
- sg.getSequences(hiddenRepSequences), sg.getWidth());
+ ((ClustalxColourScheme) sg.cs).resetClustalX(sg
+ .getSequences(hiddenRepSequences), sg.getWidth());
}
sg.recalcConservation();
}
/**
* checks current SelectionGroup against record of last hash value, and
* updates record.
- * @param b update the record of last hash value
+ *
+ * @param b
+ * update the record of last hash value
*
* @return true if SelectionGroup changed since last call (when b is true)
*/
boolean isSelectionGroupChanged(boolean b)
{
- int hc = (selectionGroup == null || selectionGroup.getSize()==0) ? -1 : selectionGroup.hashCode();
- if (hc!=-1 && hc != sgrouphash)
+ int hc = (selectionGroup == null || selectionGroup.getSize() == 0) ? -1
+ : selectionGroup.hashCode();
+ if (hc != -1 && hc != sgrouphash)
{
- if (b) {sgrouphash = hc;}
+ if (b)
+ {
+ sgrouphash = hc;
+ }
return true;
}
return false;
}
/**
- * checks current colsel against record of last hash value, and optionally updates
- * record.
-
- * @param b update the record of last hash value
+ * checks current colsel against record of last hash value, and optionally
+ * updates record.
+ *
+ * @param b
+ * update the record of last hash value
* @return true if colsel changed since last call (when b is true)
*/
boolean isColSelChanged(boolean b)
{
- int hc = (colSel == null || colSel.size()==0) ? -1 : colSel.hashCode();
- if (hc!=-1 && hc != colselhash)
+ int hc = (colSel == null || colSel.size() == 0) ? -1 : colSel
+ .hashCode();
+ if (hc != -1 && hc != colselhash)
{
- if (b) {colselhash = hc;}
+ if (b)
+ {
+ colselhash = hc;
+ }
return true;
}
return false;
{
consensusThread.updateAnnotation();
}
+ if (strucConsensusThread != null)
+ {
+ strucConsensusThread.updateAnnotation();
+ }
}
this.showSequenceLogo = showSequenceLogo;
}
public StructureSelectionManager getStructureSelectionManager()
{
- return StructureSelectionManager.getStructureSelectionManager(Desktop.instance);
+ return StructureSelectionManager
+ .getStructureSelectionManager(Desktop.instance);
}
/**
*
* @param pdbEntries
- * @return a series of SequenceI arrays, one for each PDBEntry, listing which sequence in the alignment holds a reference to it
+ * @return a series of SequenceI arrays, one for each PDBEntry, listing which
+ * sequence in the alignment holds a reference to it
*/
public SequenceI[][] collateForPDB(PDBEntry[] pdbEntries)
{
ArrayList<SequenceI[]> seqvectors = new ArrayList<SequenceI[]>();
- for (PDBEntry pdb: pdbEntries) {
- ArrayList<SequenceI> seqs = new ArrayList<SequenceI>();
- for (int i = 0; i < alignment.getHeight(); i++)
- {
- Vector pdbs = alignment.getSequenceAt(i)
- .getDatasetSequence().getPDBId();
- if (pdbs == null)
- continue;
- SequenceI sq;
- for (int p = 0; p < pdbs.size(); p++)
+ for (PDBEntry pdb : pdbEntries)
+ {
+ ArrayList<SequenceI> seqs = new ArrayList<SequenceI>();
+ for (int i = 0; i < alignment.getHeight(); i++)
{
- PDBEntry p1 = (PDBEntry) pdbs.elementAt(p);
- if (p1.getId().equals(pdb.getId()))
+ Vector pdbs = alignment.getSequenceAt(i).getDatasetSequence()
+ .getPDBId();
+ if (pdbs == null)
+ continue;
+ SequenceI sq;
+ for (int p = 0; p < pdbs.size(); p++)
{
- if (!seqs.contains(sq=alignment.getSequenceAt(i)))
- seqs.add(sq);
+ PDBEntry p1 = (PDBEntry) pdbs.elementAt(p);
+ if (p1.getId().equals(pdb.getId()))
+ {
+ if (!seqs.contains(sq = alignment.getSequenceAt(i)))
+ seqs.add(sq);
- continue;
+ continue;
+ }
}
}
- }
- seqvectors.add(seqs.toArray(new SequenceI[seqs.size()]));
+ seqvectors.add(seqs.toArray(new SequenceI[seqs.size()]));
}
return seqvectors.toArray(new SequenceI[seqvectors.size()][]);
}
import javax.swing.*;
+import com.stevesoft.pat.Regex;
+
import jalview.analysis.AAFrequency;
+import jalview.analysis.StructureFrequency;
import jalview.datamodel.*;
import jalview.schemes.ColourSchemeI;
final String SHEET = "Sheet";
+ /**
+ * For RNA secondary structure "stems" aka helices
+ */
+ final String STEM = "RNA Helix";
+
final String LABEL = "Label";
final String REMOVE = "Remove Annotation";
final Color SHEET_COLOUR = Color.green.darker().darker();
+ final Color STEM_COLOUR = Color.blue.darker();
+
/** DOCUMENT ME!! */
AlignViewport av;
boolean MAC = false;
+ // for editing cursor
+ int cursorX = 0;
+
+ int cursorY = 0;
+
/**
* Creates a new AnnotationPanel object.
*
*/
public int adjustPanelHeight()
{
- int height=calcPanelHeight();
+ int height = calcPanelHeight();
this.setPreferredSize(new Dimension(1, height));
if (ap != null)
{
}
/**
- * calculate the height for visible annotation, revalidating bounds where necessary
- * ABSTRACT GUI METHOD
+ * calculate the height for visible annotation, revalidating bounds where
+ * necessary ABSTRACT GUI METHOD
+ *
* @return total height of annotation
*/
public int calcPanelHeight()
symbol = "\u03B2";
}
+ // Added by LML to color stems
+ else if (evt.getActionCommand().equals(STEM))
+ {
+ type = 'S';
+ symbol = "\u03C3";
+ }
+
if (!aa[activeRow].hasIcons)
{
aa[activeRow].hasIcons = true;
continue;
String tlabel = null;
if (anot[index] != null)
- {
+ { // LML added stem code
if (label2.equals(HELIX) || label2.equals(SHEET)
- || label2.equals(LABEL))
+ || label2.equals(STEM) || label2.equals(LABEL))
{
tlabel = anot[index].description;
if (tlabel == null || tlabel.length() < 1)
{
- if (label2.equals(HELIX) || label2.equals(SHEET))
+ if (label2.equals(HELIX) || label2.equals(SHEET)
+ || label2.equals(STEM))
{
tlabel = "" + anot[index].secondaryStructure;
}
}
JPopupMenu pop = new JPopupMenu("Structure type");
- JMenuItem item = new JMenuItem(HELIX);
- item.addActionListener(this);
- pop.add(item);
- item = new JMenuItem(SHEET);
- item.addActionListener(this);
- pop.add(item);
+ JMenuItem item;
+ /*
+ * Just display the needed structure options
+ */
+ if (av.alignment.isNucleotide() == true)
+ {
+ item = new JMenuItem(STEM);
+ item.addActionListener(this);
+ pop.add(item);
+ }
+ else
+ {
+ item = new JMenuItem(HELIX);
+ item.addActionListener(this);
+ pop.add(item);
+ item = new JMenuItem(SHEET);
+ item.addActionListener(this);
+ pop.add(item);
+ }
item = new JMenuItem(LABEL);
item.addActionListener(this);
pop.add(item);
*/
public void mouseClicked(MouseEvent evt)
{
+ if (activeRow != -1)
+ {
+ AlignmentAnnotation[] aa = av.alignment.getAlignmentAnnotation();
+ AlignmentAnnotation anot = aa[activeRow];
+
+ if (anot.description.equals("secondary structure"))
+ {
+ // System.out.println(anot.description+" "+anot.getRNAStruc());
+ }
+ }
+ }
+
+ // TODO mouseClicked-content and drawCursor are quite experimental!
+ public void drawCursor(Graphics graphics, SequenceI seq, int res, int x1,
+ int y1)
+ {
+ int pady = av.charHeight / 5;
+ int charOffset = 0;
+ graphics.setColor(Color.black);
+ graphics.fillRect(x1, y1, av.charWidth, av.charHeight);
+
+ if (av.validCharWidth)
+ {
+ graphics.setColor(Color.white);
+
+ char s = seq.getCharAt(res);
+
+ charOffset = (av.charWidth - fm.charWidth(s)) / 2;
+ graphics.drawString(String.valueOf(s), charOffset + x1,
+ (y1 + av.charHeight) - pady);
+ }
+
}
/**
boolean[] graphGroupDrawn = new boolean[aa.length];
int charOffset = 0; // offset for a label
float fmWidth, fmScaling = 1f; // scaling for a label to fit it into a
- // column.
+ // column.
Font ofont = g.getFont();
// \u03B2 \u03B1
for (int i = 0; i < aa.length; i++)
scaleColLabel = row.scaleColLabel;
lastSS = ' ';
lastSSX = 0;
-
if (row.graph > 0)
{
if (row.graphGroup > -1 && graphGroupDrawn[row.graphGroup])
continue;
}
- x = 0;
+ // first pass sets up state for drawing continuation from left-hand column
+ // of startRes
+ x = (startRes == 0) ? 0 : -1;
while (x < endRes - startRes)
{
if (av.hasHiddenColumns)
{
validRes = true;
}
-
- if (activeRow == i)
+ if (x > -1)
{
- g.setColor(Color.red);
-
- if (av.getColumnSelection() != null)
+ if (activeRow == i)
{
- for (int n = 0; n < av.getColumnSelection().size(); n++)
- {
- int v = av.getColumnSelection().columnAt(n);
+ g.setColor(Color.red);
- if (v == column)
+ if (av.getColumnSelection() != null)
+ {
+ for (int n = 0; n < av.getColumnSelection().size(); n++)
{
- g.fillRect(x * av.charWidth, y, av.charWidth, av.charHeight);
+ int v = av.getColumnSelection().columnAt(n);
+
+ if (v == column)
+ {
+ g.fillRect(x * av.charWidth, y, av.charWidth,
+ av.charHeight);
+ }
}
}
}
- }
- if (av.validCharWidth && validRes
- && row.annotations[column].displayCharacter != null
- && (row.annotations[column].displayCharacter.length() > 0))
- {
-
- if (centreColLabels || scaleColLabel)
+ if (av.validCharWidth
+ && validRes
+ && row.annotations[column].displayCharacter != null
+ && (row.annotations[column].displayCharacter.length() > 0))
{
- fmWidth = (float) fm.charsWidth(
- row.annotations[column].displayCharacter.toCharArray(),
- 0, row.annotations[column].displayCharacter.length());
- if (scaleColLabel)
+ if (centreColLabels || scaleColLabel)
{
- // justify the label and scale to fit in column
- if (fmWidth > av.charWidth)
+ fmWidth = (float) fm.charsWidth(
+ row.annotations[column].displayCharacter
+ .toCharArray(), 0,
+ row.annotations[column].displayCharacter.length());
+
+ if (scaleColLabel)
{
- // scale only if the current font isn't already small enough
- fmScaling = av.charWidth;
- fmScaling /= fmWidth;
- g.setFont(ofont.deriveFont(AffineTransform
- .getScaleInstance(fmScaling, 1.0)));
- // and update the label's width to reflect the scaling.
- fmWidth = av.charWidth;
+ // justify the label and scale to fit in column
+ if (fmWidth > av.charWidth)
+ {
+ // scale only if the current font isn't already small enough
+ fmScaling = av.charWidth;
+ fmScaling /= fmWidth;
+ g.setFont(ofont.deriveFont(AffineTransform
+ .getScaleInstance(fmScaling, 1.0)));
+ // and update the label's width to reflect the scaling.
+ fmWidth = av.charWidth;
+ }
}
}
- }
- else
- {
- fmWidth = (float) fm
- .charWidth(row.annotations[column].displayCharacter
- .charAt(0));
- }
- charOffset = (int) ((av.charWidth - fmWidth) / 2f);
+ else
+ {
+ fmWidth = (float) fm
+ .charWidth(row.annotations[column].displayCharacter
+ .charAt(0));
+ }
+ charOffset = (int) ((av.charWidth - fmWidth) / 2f);
- if (row.annotations[column].colour == null)
- g.setColor(Color.black);
- else
- g.setColor(row.annotations[column].colour);
+ if (row.annotations[column].colour == null)
+ g.setColor(Color.black);
+ else
+ g.setColor(row.annotations[column].colour);
- if (column == 0 || row.graph > 0)
- {
- g.drawString(row.annotations[column].displayCharacter,
- (x * av.charWidth) + charOffset, y + iconOffset);
- }
- else if (row.annotations[column - 1] == null
- || (labelAllCols
- || !row.annotations[column].displayCharacter
- .equals(row.annotations[column - 1].displayCharacter) || (row.annotations[column].displayCharacter
- .length() < 2 && row.annotations[column].secondaryStructure == ' ')))
- {
- g.drawString(row.annotations[column].displayCharacter, x
- * av.charWidth + charOffset, y + iconOffset);
+ if (column == 0 || row.graph > 0)
+ {
+ g.drawString(row.annotations[column].displayCharacter,
+ (x * av.charWidth) + charOffset, y + iconOffset);
+ }
+ else if (row.annotations[column - 1] == null
+ || (labelAllCols
+ || !row.annotations[column].displayCharacter
+ .equals(row.annotations[column - 1].displayCharacter) || (row.annotations[column].displayCharacter
+ .length() < 2 && row.annotations[column].secondaryStructure == ' ')))
+ {
+ g.drawString(row.annotations[column].displayCharacter, x
+ * av.charWidth + charOffset, y + iconOffset);
+ }
+ g.setFont(ofont);
}
- g.setFont(ofont);
}
-
if (row.hasIcons)
{
- if (!validRes
- || (row.annotations[column].secondaryStructure != lastSS))
+ char ss = validRes ? row.annotations[column].secondaryStructure
+ : ' ';
+ if (ss == 'S')
+ {
+ // distinguish between forward/backward base-pairing
+ if (row.annotations[column].displayCharacter.indexOf(')') > -1)
+ {
+ ss = 's';
+ }
+ }
+ if (!validRes || (ss != lastSS))
{
- switch (lastSS)
+ if (x > -1)
{
- case 'H':
- g.setColor(HELIX_COLOUR);
- if (MAC)
+ switch (lastSS)
{
- // Off by 1 offset when drawing rects and ovals
- // to offscreen image on the MAC
- g.fillRoundRect(lastSSX, y + 4 + iconOffset,
- (x * av.charWidth) - lastSSX, 7, 8, 8);
+ case 'H':
+ drawHelixAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
break;
- }
-
- int sCol = (lastSSX / av.charWidth) + startRes;
- int x1 = lastSSX;
- int x2 = (x * av.charWidth);
-
- if (sCol == 0
- || row.annotations[sCol - 1] == null
- || row.annotations[sCol - 1].secondaryStructure != 'H')
- {
- g.fillArc(lastSSX, y + 4 + iconOffset, av.charWidth, 8, 90,
- 180);
- x1 += av.charWidth / 2;
- }
- if (!validRes || row.annotations[column] == null
- || row.annotations[column].secondaryStructure != 'H')
- {
- g.fillArc((x * av.charWidth) - av.charWidth, y + 4
- + iconOffset, av.charWidth, 8, 270, 180);
- x2 -= av.charWidth / 2;
- }
-
- g.fillRect(x1, y + 4 + iconOffset, x2 - x1, 8);
- break;
-
- case 'E':
- g.setColor(SHEET_COLOUR);
- g.fillRect(lastSSX, y + 4 + iconOffset, (x * av.charWidth)
- - lastSSX - 4, 7);
- g.fillPolygon(new int[]
- { (x * av.charWidth) - 4, (x * av.charWidth) - 4,
- (x * av.charWidth) }, new int[]
- { y + iconOffset, y + 14 + iconOffset, y + 8 + iconOffset },
- 3);
+ case 'E':
+ drawSheetAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
+ break;
- break;
+ case 'S': // Stem case for RNA secondary structure
+ case 's': // and opposite direction
+ drawStemAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
+ break;
- default:
- g.setColor(Color.gray);
- g.fillRect(lastSSX, y + 6 + iconOffset, (x * av.charWidth)
- - lastSSX, 2);
+ default:
+ g.setColor(Color.gray);
+ g.fillRect(lastSSX, y + 6 + iconOffset, (x * av.charWidth)
+ - lastSSX, 2);
- break;
+ break;
+ }
}
-
if (validRes)
{
- lastSS = row.annotations[column].secondaryStructure;
+ lastSS = ss;
}
else
{
lastSS = ' ';
}
-
- lastSSX = (x * av.charWidth);
+ if (x > -1)
+ {
+ lastSSX = (x * av.charWidth);
+ }
}
}
-
column++;
x++;
}
-
if (column >= row.annotations.length)
{
column = row.annotations.length - 1;
switch (lastSS)
{
case 'H':
- g.setColor(HELIX_COLOUR);
- if (MAC)
- {
- // Off by 1 offset when drawing rects and ovals
- // to offscreen image on the MAC
- g.fillRoundRect(lastSSX, y + 4 + iconOffset, (x * av.charWidth)
- - lastSSX, 7, 8, 8);
- break;
- }
-
- int sCol = (lastSSX / av.charWidth) + startRes;
- int x1 = lastSSX;
- int x2 = (x * av.charWidth);
-
- if (sCol == 0 || row.annotations[sCol - 1] == null
- || row.annotations[sCol - 1].secondaryStructure != 'H')
- {
- g.fillArc(lastSSX, y + 4 + iconOffset, av.charWidth, 8, 90, 180);
- x1 += av.charWidth / 2;
- }
-
- if (row.annotations[column] == null
- || row.annotations[column].secondaryStructure != 'H')
- {
- g.fillArc((x * av.charWidth) - av.charWidth,
- y + 4 + iconOffset, av.charWidth, 8, 270, 180);
- x2 -= av.charWidth / 2;
- }
-
- g.fillRect(x1, y + 4 + iconOffset, x2 - x1, 8);
-
+ drawHelixAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
break;
case 'E':
- g.setColor(SHEET_COLOUR);
-
- if (!validEnd || row.annotations[endRes] == null
- || row.annotations[endRes].secondaryStructure != 'E')
- {
- g.fillRect(lastSSX, y + 4 + iconOffset, (x * av.charWidth)
- - lastSSX - 4, 7);
- g.fillPolygon(new int[]
- { (x * av.charWidth) - 4, (x * av.charWidth) - 4,
- (x * av.charWidth) }, new int[]
- { y + iconOffset, y + 14 + iconOffset, y + 7 + iconOffset }, 3);
- }
- else
- {
- g.fillRect(lastSSX, y + 4 + iconOffset, (x + 1) * av.charWidth
- - lastSSX, 7);
- }
+ drawSheetAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
+ break;
+ case 's':
+ case 'S': // Stem case for RNA secondary structure
+ drawStemAnnot(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
break;
-
default:
- g.setColor(Color.gray);
- g.fillRect(lastSSX, y + 6 + iconOffset, (x * av.charWidth)
- - lastSSX, 2);
-
+ drawGlyphLine(g, row, lastSSX, x, y, iconOffset, startRes,
+ column, validRes, validEnd);
break;
}
}
}
}
+ private void drawStemAnnot(Graphics g, AlignmentAnnotation row,
+ int lastSSX, int x, int y, int iconOffset, int startRes,
+ int column, boolean validRes, boolean validEnd)
+ {
+ g.setColor(STEM_COLOUR);
+ int sCol = (lastSSX / av.charWidth) + startRes;
+ int x1 = lastSSX;
+ int x2 = (x * av.charWidth);
+ Regex closeparen = new Regex("(\\))");
+
+ String dc = column == 0 ? ""
+ : row.annotations[column - 1].displayCharacter;
+
+ boolean diffupstream = sCol == 0 || row.annotations[sCol - 1] == null
+ || !dc.equals(row.annotations[sCol - 1].displayCharacter);
+ boolean diffdownstream = !validRes || !validEnd
+ || row.annotations[column] == null
+ || !dc.equals(row.annotations[column].displayCharacter);
+ // System.out.println("Column "+column+" diff up: "+diffupstream+" down:"+diffdownstream);
+ // If a closing base pair half of the stem, display a backward arrow
+ if (column > 0 && closeparen.search(dc))
+ {
+ if (diffupstream)
+ // if (validRes && column>1 && row.annotations[column-2]!=null &&
+ // dc.equals(row.annotations[column-2].displayCharacter))
+ {
+ g.fillPolygon(new int[]
+ { lastSSX + 5, lastSSX + 5, lastSSX }, new int[]
+ { y + iconOffset, y + 14 + iconOffset, y + 8 + iconOffset }, 3);
+ x1 += 5;
+ }
+ if (diffdownstream)
+ {
+ x2 -= 1;
+ }
+ }
+ else
+ {
+ // display a forward arrow
+ if (diffdownstream)
+ {
+ g.fillPolygon(new int[]
+ { x2 - 5, x2 - 5, x2 }, new int[]
+ { y + iconOffset, y + 14 + iconOffset, y + 8 + iconOffset }, 3);
+ x2 -= 5;
+ }
+ if (diffupstream)
+ {
+ x1 += 1;
+ }
+ }
+ // draw arrow body
+ g.fillRect(x1, y + 4 + iconOffset, x2 - x1, 7);
+ }
+
+ private void drawGlyphLine(Graphics g, AlignmentAnnotation row,
+ int lastSSX, int x, int y, int iconOffset, int startRes,
+ int column, boolean validRes, boolean validEnd)
+ {
+ g.setColor(Color.gray);
+ g
+ .fillRect(lastSSX, y + 6 + iconOffset, (x * av.charWidth)
+ - lastSSX, 2);
+ }
+
+ private void drawSheetAnnot(Graphics g, AlignmentAnnotation row,
+ int lastSSX, int x, int y, int iconOffset, int startRes,
+ int column, boolean validRes, boolean validEnd)
+ {
+ g.setColor(SHEET_COLOUR);
+
+ if (!validEnd || !validRes || row.annotations[column] == null
+ || row.annotations[column].secondaryStructure != 'E')
+ {
+ g.fillRect(lastSSX, y + 4 + iconOffset, (x * av.charWidth) - lastSSX
+ - 4, 7);
+ g.fillPolygon(
+ new int[]
+ { (x * av.charWidth) - 4, (x * av.charWidth) - 4,
+ (x * av.charWidth) }, new int[]
+ { y + iconOffset, y + 14 + iconOffset, y + 7 + iconOffset },
+ 3);
+ }
+ else
+ {
+ g.fillRect(lastSSX, y + 4 + iconOffset, (x + 1) * av.charWidth
+ - lastSSX, 7);
+ }
+
+ }
+
+ private void drawHelixAnnot(Graphics g, AlignmentAnnotation row,
+ int lastSSX, int x, int y, int iconOffset, int startRes,
+ int column, boolean validRes, boolean validEnd)
+ {
+ g.setColor(HELIX_COLOUR);
+
+ int sCol = (lastSSX / av.charWidth) + startRes;
+ int x1 = lastSSX;
+ int x2 = (x * av.charWidth);
+
+ if (MAC)
+ {
+ int ofs = av.charWidth / 2;
+ // Off by 1 offset when drawing rects and ovals
+ // to offscreen image on the MAC
+ g.fillRoundRect(lastSSX, y + 4 + iconOffset, x2 - x1, 8, 8, 8);
+ if (sCol == 0 || row.annotations[sCol - 1] == null
+ || row.annotations[sCol - 1].secondaryStructure != 'H')
+ {
+ }
+ else
+ {
+ // g.setColor(Color.orange);
+ g.fillRoundRect(lastSSX, y + 4 + iconOffset, x2 - x1 - ofs + 1, 8,
+ 0, 0);
+ }
+ if (!validRes || row.annotations[column] == null
+ || row.annotations[column].secondaryStructure != 'H')
+ {
+
+ }
+ else
+ {
+ // g.setColor(Color.magenta);
+ g.fillRoundRect(lastSSX + ofs, y + 4 + iconOffset, x2 - x1 - ofs
+ + 1, 8, 0, 0);
+
+ }
+
+ return;
+ }
+
+ if (sCol == 0 || row.annotations[sCol - 1] == null
+ || row.annotations[sCol - 1].secondaryStructure != 'H')
+ {
+ g.fillArc(lastSSX, y + 4 + iconOffset, av.charWidth, 8, 90, 180);
+ x1 += av.charWidth / 2;
+ }
+
+ if (!validRes || row.annotations[column] == null
+ || row.annotations[column].secondaryStructure != 'H')
+ {
+ g.fillArc((x * av.charWidth) - av.charWidth, y + 4 + iconOffset,
+ av.charWidth, 8, 270, 180);
+ x2 -= av.charWidth / 2;
+ }
+
+ g.fillRect(x1, y + 4 + iconOffset, x2 - x1, 8);
+ }
+
public void drawLineGraph(Graphics g, AlignmentAnnotation aa, int sRes,
int eRes, int y, float min, float max, int graphHeight)
{
// draw profile if available
if (renderProfile && aa.annotations[column].value != 0)
{
+
int profl[] = getProfileFor(aa, column);
- int ht = y1, htn = y2 - y1;// aa.graphHeight;
- float wdth;
- double ht2 = 0;
- char[] dc = new char[1];
- LineMetrics lm;
- for (int c = 1; profl != null && c < profl[0];)
+ // just try to draw the logo if profl is not null
+ if (profl != null)
{
- dc[0] = (char) profl[c++];
- wdth = av.charWidth;
- wdth /= (float) fm.charsWidth(dc, 0, 1);
- if (c > 2)
+ int ht = y1, htn = y2 - y1;// aa.graphHeight;
+ float wdth;
+ double ht2 = 0;
+ char[] dc;
+
+ /**
+ * profl.length == 51 indicates that the profile of a secondary
+ * structure conservation row was accesed.
+ * Therefore dc gets length 2, to have space for a basepair instead of
+ * just a single nucleotide
+ */
+ if (profl.length == 51)
+ {
+ dc = new char[2];
+ }
+ else
{
- ht += (int) ht2;
+ dc = new char[1];
}
+
+ LineMetrics lm;
+ for (int c = 1; profl != null && c < profl[0];)
{
- // if (aa.annotations[column].value==0) {
- // g.setFont(ofont.deriveFont(AffineTransform.getScaleInstance(wdth,
- // (ht2=(aa.graphHeight*0.1/av.charHeight)))));
- // ht = y2-(int)ht2;
- // } else {
- g.setFont(ofont.deriveFont(AffineTransform.getScaleInstance(
- wdth, (ht2 = (htn * ((double) profl[c++]) / 100.0))
- / av.charHeight)));
- lm = g.getFontMetrics().getLineMetrics(dc, 0, 1, g);
- // htn -=ht2;
- // }
- g.setColor(profcolour.findColour(dc[0])); // (av.globalColourScheme!=null)
- // ? );// try to get a
- // colourscheme for the
- // group(aa.groupRef.cs==null)
- // ? av.textColour2 :
- // cs.findColour(dc));
- g.drawChars(dc, 0, 1, x * av.charWidth,
- (int) (ht + lm.getHeight()));
- // ht+=g.getFontMetrics().getAscent()-g.getFontMetrics().getDescent();
+ dc[0] = (char) profl[c++];
+
+ if (aa.label.startsWith("StrucConsensus"))
+ {
+ dc[1] = (char) profl[c++];
+ }
+
+ wdth = av.charWidth;
+ wdth /= (float) fm.charsWidth(dc, 0, dc.length);
+
+ if (c > 2)
+ {
+ ht += (int) ht2;
+ }
+ {
+ // if (aa.annotations[column].value==0) {
+ // g.setFont(ofont.deriveFont(AffineTransform.getScaleInstance(wdth,
+ // (ht2=(aa.graphHeight*0.1/av.charHeight)))));
+ // ht = y2-(int)ht2;
+ // } else {
+ g.setFont(ofont.deriveFont(AffineTransform.getScaleInstance(
+ wdth, (ht2 = (htn * ((double) profl[c++]) / 100.0))
+ / av.charHeight)));
+ lm = g.getFontMetrics().getLineMetrics(dc, 0, 1, g);
+ // htn -=ht2;
+ // }
+ g.setColor(profcolour.findColour(dc[0])); // (av.globalColourScheme!=null)
+ // ? );// try to get a
+ // colourscheme for the
+ // group(aa.groupRef.cs==null)
+ // ? av.textColour2 :
+ // cs.findColour(dc));
+ // System.out.println(dc[0]);
+
+ g.drawChars(dc, 0, dc.length, x * av.charWidth,
+ (int) (ht + lm.getHeight()));
+
+ // ht+=g.getFontMetrics().getAscent()-g.getFontMetrics().getDescent();
+ }
}
+ g.setFont(ofont);
}
- g.setFont(ofont);
}
x++;
}
&& aa.groupRef.isShowSequenceLogo())
{
return AAFrequency.extractProfile(
- aa.groupRef.consensusData[column],
- aa.groupRef.getIgnoreGapsConsensus());
+ aa.groupRef.consensusData[column], aa.groupRef
+ .getIgnoreGapsConsensus());
}
// TODO extend annotation row to enable dynamic and static profile data to
// be stored
if (aa.groupRef == null && aa.sequenceRef == null
&& av.isShowSequenceLogo())
{
- return AAFrequency.extractProfile(av.hconsensus[column],
- av.getIgnoreGapsConsensus());
+ return AAFrequency.extractProfile(av.hconsensus[column], av
+ .getIgnoreGapsConsensus());
+ }
+ }
+ else
+ {
+ if (aa.autoCalculated && aa.label.startsWith("StrucConsensus"))
+ {
+ if (aa.groupRef != null && aa.groupRef.consensusData != null
+ && aa.groupRef.isShowSequenceLogo())
+ {
+ //TODO check what happens for group selections
+ return StructureFrequency.extractProfile(
+ aa.groupRef.consensusData[column], aa.groupRef
+ .getIgnoreGapsConsensus());
+ }
+ // TODO extend annotation row to enable dynamic and static profile data
+ // to
+ // be stored
+ if (aa.groupRef == null && aa.sequenceRef == null
+ && av.isShowSequenceLogo())
+ {
+ return StructureFrequency.extractProfile(av.hStrucConsensus[column],
+ av.getIgnoreGapsConsensus());
+ }
}
}
return null;
buriedColour.setSelected(true);
jmb.setJalviewColourScheme(new BuriedColourScheme());
}
-
+
+ public void purinePyrimidineColour_actionPerformed(ActionEvent actionEvent)
+ {
+ setJalviewColourScheme(new PurinePyrimidineColourScheme());
+ }
+
public void userColour_actionPerformed(ActionEvent actionEvent)
{
userColour.setSelected(true);
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.gui;
+
+import java.util.*;
+import java.util.regex.Matcher;
+import java.util.regex.Pattern;
+import java.awt.*;
+
+import javax.swing.*;
+import javax.swing.event.*;
+
+import java.awt.event.*;
+import java.io.*;
+
+import jalview.api.SequenceStructureBinding;
+import jalview.bin.Cache;
+import jalview.datamodel.*;
+import jalview.gui.ViewSelectionMenu.ViewSetProvider;
+import jalview.structure.*;
+import jalview.io.*;
+import jalview.schemes.*;
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.annotations.HighlightRegionAnnotation;
+import fr.orsay.lri.varna.models.rna.ModeleBaseNucleotide;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+
+public class AppVarna extends JInternalFrame implements InterfaceVARNAListener,SecondaryStructureListener// implements Runnable,SequenceStructureBinding, ViewSetProvider
+
+{
+ AppVarnaBinding vab;
+
+ VARNAPanel varnaPanel;
+
+ public String name;
+
+ public StructureSelectionManager ssm;
+
+ /*public AppVarna(){
+ vab = new AppVarnaBinding();
+ initVarna();
+ }*/
+
+
+
+ public AppVarna(String seq,String struc,String name,AlignmentPanel ap){
+ ArrayList<RNA> rnaList = new ArrayList<RNA>();
+ RNA rna1 = new RNA(name);
+ try {
+ rna1.setRNA(seq,replaceOddGaps(struc));
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ rnaList.add(trimRNA(rna1));
+ rnaList.add(rna1);
+ rna1.setName("consenus_"+rna1.getName());
+
+
+ vab = new AppVarnaBinding(rnaList);
+ //vab = new AppVarnaBinding(seq,struc);
+ //System.out.println("Hallo: "+name);
+ this.name=name;
+ initVarna();
+ ssm = ap.getStructureSelectionManager();
+ ssm.addStructureViewerListener(this);
+ }
+
+ public void initVarna(){
+ //vab.setFinishedInit(false);
+ varnaPanel=vab.get_varnaPanel();
+ setBackground(Color.white);
+ JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,vab.getListPanel(),varnaPanel);
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(split, BorderLayout.CENTER);
+ //getContentPane().add(vab.getTools(), BorderLayout.NORTH);
+ varnaPanel.addVARNAListener(this);
+ jalview.gui.Desktop.addInternalFrame(this,"VARNA -"+name,getBounds().width, getBounds().height);
+ this.pack();
+ showPanel(true);
+ }
+
+ public String replaceOddGaps(String oldStr){
+ String patternStr = "[^([{<>}])]";
+ String replacementStr = ".";
+ Pattern pattern = Pattern.compile(patternStr);
+ Matcher matcher = pattern.matcher(oldStr);
+ String newStr=matcher.replaceAll(replacementStr);
+ return newStr;
+ }
+
+ public RNA trimRNA(RNA rna){
+ RNA rnaTrim = new RNA("trim_"+rna.getName());
+ try {
+ rnaTrim.setRNA(rna.getSeq(),replaceOddGaps(rna.getStructDBN()));
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+
+ StringBuffer seq=new StringBuffer(rnaTrim.getSeq());
+ StringBuffer struc=new StringBuffer(rnaTrim.getStructDBN());
+ for(int i=0;i<rnaTrim.getSeq().length();i++){
+ //TODO: Jalview utility for gap detection java.utils.isGap()
+ //TODO: Switch to jalview rna datamodel
+ if(seq.substring(i, i+1).compareTo("-")==0 || seq.substring(i, i+1).compareTo(".")==0){
+ if(!rnaTrim.findPair(i).isEmpty()){
+ int m=rnaTrim.findPair(i).get(1);
+ int l=rnaTrim.findPair(i).get(0);
+
+ struc.replace(m, m+1, "*");
+ struc.replace(l, l+1, "*");
+ }else{
+ struc.replace(i, i+1, "*");
+ }
+ }
+ }
+
+ String newSeq=rnaTrim.getSeq().replace("-", "");
+ rnaTrim.getSeq().replace(".", "");
+ String newStruc=struc.toString().replace("*", "");
+
+ try {
+ rnaTrim.setRNA(newSeq,newStruc);
+ } catch (ExceptionUnmatchedClosingParentheses e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e) {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
+
+ return rnaTrim;
+ }
+
+ public void showPanel(boolean show){
+ this.setVisible(show);
+ }
+
+ private boolean _started = false;
+
+ public void run(){
+ _started = true;
+
+ try
+ {
+ initVarna();
+ } catch (OutOfMemoryError oomerror)
+ {
+ new OOMWarning("When trying to open the Varna viewer!", oomerror);
+ } catch (Exception ex)
+ {
+ Cache.log.error("Couldn't open Varna viewer!", ex);
+ }
+ }
+
+@Override
+public void onUINewStructure(VARNAConfig v, RNA r) {
+ // TODO Auto-generated method stub
+
+}
+
+@Override
+public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+}
+/**
+ * If a mouseOver event from the AlignmentPanel
+ * is noticed the currently selected RNA in the
+ * VARNA window is highlighted at the specific position.
+ * To be able to remove it before the next highlight
+ * it is saved in _lastHighlight
+ */
+private HighlightRegionAnnotation _lastHighlight;
+@Override
+public void mouseOverSequence(SequenceI sequence, int index) {
+ // TODO Auto-generated method stub
+ RNA rna=vab.getSelectedRNA();
+ rna.removeHighlightRegion(_lastHighlight);
+
+ HighlightRegionAnnotation highlight = new HighlightRegionAnnotation(rna.getBasesBetween(index,index));
+ rna.addHighlightRegion(highlight);
+ _lastHighlight=highlight;
+ vab.updateSelectedRNA(rna);
+}
+
+@Override
+public void mouseOverStructure(int atomIndex, String strInfo) {
+ // TODO Auto-generated method stub
+
+}
+
+@Override
+public void onStructureRedrawn()
+{
+ // TODO Auto-generated method stub
+
+}
+
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.gui;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Component;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.datatransfer.DataFlavor;
+import java.awt.datatransfer.Transferable;
+import java.awt.dnd.DnDConstants;
+import java.awt.dnd.DropTarget;
+import java.awt.dnd.DropTargetDragEvent;
+import java.awt.dnd.DropTargetDropEvent;
+import java.awt.dnd.DropTargetEvent;
+import java.awt.dnd.DropTargetListener;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.ComponentEvent;
+import java.awt.event.MouseEvent;
+import java.awt.event.MouseListener;
+import java.io.File;
+import java.text.DateFormat;
+import java.util.ArrayList;
+import java.util.Date;
+import java.util.List;
+
+import javax.swing.DefaultListModel;
+import javax.swing.DefaultListSelectionModel;
+import javax.swing.Icon;
+import javax.swing.JButton;
+import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JList;
+import javax.swing.JOptionPane;
+import javax.swing.JPanel;
+import javax.swing.JScrollPane;
+import javax.swing.JSplitPane;
+import javax.swing.JTextField;
+import javax.swing.ListModel;
+import javax.swing.ListSelectionModel;
+import javax.swing.UIManager;
+import javax.swing.UnsupportedLookAndFeelException;
+import javax.swing.event.ListSelectionEvent;
+import javax.swing.event.ListSelectionListener;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.components.ReorderableJList;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
+import fr.orsay.lri.varna.models.FullBackup;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding implements DropTargetListener, InterfaceVARNAListener, MouseListener {
+
+ /**
+ *
+ */
+ //private static final long serialVersionUID = -790155708306987257L;
+
+ private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
+ private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+ private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
+ public VARNAPanel vp;
+
+ protected JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _strPanel = new JPanel();
+ private JLabel _info = new JLabel();
+ private JTextField _str = new JTextField();
+ private JTextField _seq = new JTextField();
+ private JLabel _strLabel = new JLabel(" Str:");
+ private JLabel _seqLabel = new JLabel(" Seq:");
+ private JButton _createButton = new JButton("Create");
+ private JButton _updateButton = new JButton("Update");
+ private JButton _deleteButton = new JButton("Delete");
+ private JButton _duplicateButton = new JButton("Snapshot");
+
+ protected JPanel _listPanel = new JPanel();
+ private ReorderableJList _sideList = null;
+
+
+ private static String errorOpt = "error";
+ @SuppressWarnings("unused")
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ private static int _nextID = 1;
+ @SuppressWarnings("unused")
+ private int _algoCode;
+
+ private BackupHolder _rnaList;
+
+
+ /*public AppVarnaBinding() {
+ //super("VARNA in Jalview");
+ //this.set_seq("ATGC");
+ //this.set_str(".().");
+ //RNAPanelDemoInit();
+
+ //initVarna("ATGCATGATATATATATAT","....((((...))))....");
+ initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1);
+ }*/
+
+ public AppVarnaBinding(String seq,String struc){
+ //super("VARNA in Jalview");
+ initVarna(seq,struc);
+ }
+
+ public AppVarnaBinding(ArrayList<RNA> rnaList){
+ //super("VARNA in Jalview");
+ initVarnaEdit(rnaList);
+ }
+
+
+
+ private void initVarna(String seq, String str){
+ DefaultListModel dlm = new DefaultListModel();
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
+ vp.showRNAInterpolated(sel.rna,sel.config,map);
+ _seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN());
+ }
+ }
+ });
+
+ _rnaList = new BackupHolder(dlm,_sideList);
+ RNA _RNA1 = new RNA("User defined 1");
+
+ try {
+ vp = new VARNAPanel("0",".");
+ _RNA1.setRNA(seq, str);
+ _RNA1.drawRNARadiate(vp.getConfig());
+ } catch (ExceptionNonEqualLength e) {
+ vp.errorDialog(e);
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ vp.setPreferredSize(new Dimension(400, 400));
+ _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+ //TODO setBackground(_backgroundColor);
+ vp.setBackground(_backgroundColor);
+
+ //TODO getContentPane().setLayout(new BorderLayout());
+ //TODO getContentPane().add(vp, BorderLayout.CENTER);
+
+ //setVisible(true);
+ vp.addVARNAListener(this);
+ }
+
+ private void initVarnaEdit(ArrayList<RNA> rnaInList)
+ {
+ DefaultListModel dlm = new DefaultListModel();
+
+
+ int marginTools = 40;
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ //System.out.println(arg0);
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
+ vp.showRNAInterpolated(sel.rna,sel.config,map);
+ //_seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN());
+ }
+ }
+ });
+ _rnaList = new BackupHolder(dlm,_sideList);
+
+ try {
+ vp = new VARNAPanel("0",".");
+ for(int i=0;i<rnaInList.size();i++){
+ rnaInList.get(i).drawRNARadiate(vp.getConfig());
+ }
+ } catch (ExceptionNonEqualLength e) {
+ vp.errorDialog(e);
+ }
+ vp.setPreferredSize(new Dimension(400, 400));
+ for(int i=0;i<rnaInList.size();i++){
+ if(i<rnaInList.size()-1){
+ _rnaList.add(vp.getConfig().clone(),rnaInList.get(i),rnaInList.get(i).getName());
+ }else{
+ _rnaList.add(vp.getConfig().clone(),rnaInList.get(i),rnaInList.get(i).getName(),true);
+ }
+ }
+
+ /*_rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
+ _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);*/
+
+ JScrollPane listScroller = new JScrollPane(_sideList);
+ listScroller.setPreferredSize(new Dimension(150, 0));
+
+ vp.setBackground(_backgroundColor);
+
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ //_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ //_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq.setFont(textFieldsFont);
+ _seq.setText(rnaInList.get(0).getSeq());
+
+ _updateButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ sel.rna.setSequence("A");
+ }
+ });
+
+ //_seqPanel.setLayout(new BorderLayout());
+ //_seqPanel.add(_seqLabel, BorderLayout.WEST);
+ //_seqPanel.add(_seq, BorderLayout.CENTER);
+
+ _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _str.setFont(textFieldsFont);
+ _strPanel.setLayout(new BorderLayout());
+ _strPanel.add(_strLabel, BorderLayout.WEST);
+ _strPanel.add(_str, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(1, 0));
+ //_input.add(_seqPanel);
+ _input.add(_strPanel);
+
+ JPanel goPanel = new JPanel();
+ goPanel.setLayout(new BorderLayout());
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ //_tools.add(_info, BorderLayout.SOUTH);
+ _tools.add(goPanel, BorderLayout.EAST);
+
+ /*_deleteButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.removeSelected();
+ }
+ });
+ _duplicateButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.add((VARNAConfig)vp.getConfig().clone(),vp.getRNA().clone(),vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
+ }});
+ */
+ goPanel.add(_updateButton, BorderLayout.CENTER);
+
+
+ JPanel ops = new JPanel();
+ ops.setLayout(new GridLayout(1,2));
+ ops.add(_deleteButton);
+ ops.add(_duplicateButton);
+
+ JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
+
+ _listPanel.add(ops,BorderLayout.SOUTH);
+ _listPanel.add(j,BorderLayout.NORTH);
+ _listPanel.add(listScroller,BorderLayout.CENTER);
+
+
+
+ //JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
+ /**TODO
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(split, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.NORTH);
+ */
+
+ //TODO setVisible(true);
+ DropTarget dt = new DropTarget(vp, this);
+
+ vp.addVARNAListener(this);
+ }
+
+ public JPanel getTools(){
+ return _tools;
+ }
+
+ public JPanel getListPanel(){
+ return _listPanel;
+ }
+
+ /**
+ * TODO: Is it effective to transfer the whole RNA?
+ * @return Currently selected RNA
+ */
+ public RNA getSelectedRNA(){
+ return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna;
+ }
+
+ /**
+ * Substitute currently selected RNA with the edited one
+ * @param rnaEdit
+ */
+ public void updateSelectedRNA(RNA rnaEdit){
+ vp.repaint();
+ vp.showRNA(rnaEdit);
+ }
+
+ /*
+ private void RNAPanelDemoInit()
+ {
+ DefaultListModel dlm = new DefaultListModel();
+
+
+ int marginTools = 40;
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ //System.out.println(arg0);
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
+ vp.showRNAInterpolated(sel.rna,sel.config,map);
+ _seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN());
+ }
+ }
+ });
+
+ _rnaList = new BackupHolder(dlm,_sideList);
+ RNA _RNA1 = new RNA("User defined 1");
+ RNA _RNA2 = new RNA("User defined 2");
+ try {
+ vp = new VARNAPanel("0",".");
+ _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
+ _RNA1.drawRNARadiate(vp.getConfig());
+ _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
+ _RNA2.drawRNARadiate(vp.getConfig());
+ } catch (ExceptionNonEqualLength e) {
+ vp.errorDialog(e);
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ vp.setPreferredSize(new Dimension(400, 400));
+ _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
+ _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+ JScrollPane listScroller = new JScrollPane(_sideList);
+ listScroller.setPreferredSize(new Dimension(150, 0));
+
+ setBackground(_backgroundColor);
+ vp.setBackground(_backgroundColor);
+
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq.setFont(textFieldsFont);
+ _seq.setText(DEFAULT_SEQUENCE);
+
+ _createButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ try {
+ RNA nRNA = new RNA(generateDefaultName());
+ nRNA.setRNA(_seq.getText(), _str.getText());
+ nRNA.drawRNARadiate(vp.getConfig());
+ _rnaList.add(new VARNAConfig(),nRNA,true);
+ } catch (ExceptionUnmatchedClosingParentheses e1) {
+ JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+ }
+ }
+ });
+
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq, BorderLayout.CENTER);
+
+ _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _str.setFont(textFieldsFont);
+ _strPanel.setLayout(new BorderLayout());
+ _strPanel.add(_strLabel, BorderLayout.WEST);
+ _strPanel.add(_str, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(2, 0));
+ _input.add(_seqPanel);
+ _input.add(_strPanel);
+
+ JPanel goPanel = new JPanel();
+ goPanel.setLayout(new BorderLayout());
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_info, BorderLayout.SOUTH);
+ _tools.add(goPanel, BorderLayout.EAST);
+
+ _deleteButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.removeSelected();
+ }
+ });
+ _duplicateButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.add((VARNAConfig)vp.getConfig().clone(),vp.getRNA().clone(),vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
+ }});
+
+ JPanel ops = new JPanel();
+ ops.setLayout(new GridLayout(1,2));
+ ops.add(_deleteButton);
+ ops.add(_duplicateButton);
+
+ JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
+
+ _listPanel.add(ops,BorderLayout.SOUTH);
+ _listPanel.add(j,BorderLayout.NORTH);
+ _listPanel.add(listScroller,BorderLayout.CENTER);
+
+ goPanel.add(_createButton, BorderLayout.CENTER);
+
+ JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(split, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.NORTH);
+
+ setVisible(true);
+ DropTarget dt = new DropTarget(vp, this);
+
+ vp.addVARNAListener(this);
+ }
+ */
+ public static String generateDefaultName()
+ {
+ return "User file #"+_nextID++;
+ }
+
+ public RNA getRNA() {
+ return (RNA)_sideList.getSelectedValue();
+ }
+
+
+
+ public String[][] getParameterInfo() {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ public void init() {
+ vp.setBackground(_backgroundColor);
+ _error = true;
+ }
+
+ @SuppressWarnings("unused")
+ private Color getSafeColor(String col, Color def) {
+ Color result;
+ try {
+ result = Color.decode(col);
+ } catch (Exception e) {
+ try {
+ result = Color.getColor(col, def);
+ } catch (Exception e2) {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return vp;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ vp = surface;
+ }
+
+
+ public String get_seq() {
+ return _seq.getText();
+ }
+
+ public void set_seq(String _seq) {
+ this._seq.setText(_seq);
+ }
+
+ public String get_str(){
+ return _str.getText();
+ }
+
+ public void set_str(String _str){
+ this._str.setText(_str);
+ }
+
+ public JLabel get_info() {
+ return _info;
+ }
+
+ public void set_info(JLabel _info) {
+ this._info = _info;
+ }
+
+ /*public static void main(String[] args) {
+ AppVarnaBinding d = new AppVarnaBinding();
+ d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ d.pack();
+ d.setVisible(true);
+ }*/
+
+
+ public void dragEnter(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragExit(DropTargetEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragOver(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void drop(DropTargetDropEvent dtde) {
+ try {
+ Transferable tr = dtde.getTransferable();
+ DataFlavor[] flavors = tr.getTransferDataFlavors();
+ for (int i = 0; i < flavors.length; i++) {
+ if (flavors[i].isFlavorJavaFileListType()) {
+ dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ Object ob = tr.getTransferData(flavors[i]);
+ if (ob instanceof List)
+ {
+ List list = (List) ob;
+ for (int j = 0; j < list.size(); j++) {
+ Object o = list.get(j);
+
+ if (dtde.getSource() instanceof DropTarget)
+ {
+ DropTarget dt = (DropTarget) dtde.getSource();
+ Component c = dt.getComponent();
+ if (c instanceof VARNAPanel)
+ {
+ String path = o.toString();
+ VARNAPanel vp = (VARNAPanel) c;
+ try{
+ FullBackup bck = VARNAPanel.importSession(path);
+ _rnaList.add(bck.config, bck.rna,bck.name,true);
+ }
+ catch (ExceptionLoadingFailed e3)
+ {
+ RNA r = new RNA();
+ r.loadSecStr(path);
+ r.drawRNA(vp.getConfig());
+ String name =r.getName();
+ if (name.equals(""))
+ {
+ name = path.substring(path.lastIndexOf(File.separatorChar)+1);
+ }
+ _rnaList.add(vp.getConfig().clone(),r,name,true);
+ }
+ }
+ }
+ }
+ }
+ // If we made it this far, everything worked.
+ dtde.dropComplete(true);
+ return;
+ }
+ }
+ // Hmm, the user must not have dropped a file list
+ dtde.rejectDrop();
+ } catch (Exception e) {
+ e.printStackTrace();
+ dtde.rejectDrop();
+ }
+
+ }
+
+ public void dropActionChanged(DropTargetDragEvent arg0) {
+ }
+
+ private class BackupHolder{
+ private DefaultListModel _rnaList;
+ private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+ JList _l;
+
+ public BackupHolder(DefaultListModel rnaList, JList l)
+ {
+ _rnaList = rnaList;
+ _l = l;
+ }
+
+ public void add(VARNAConfig c, RNA r)
+ {
+ add(c, r, r.getName(),false);
+ }
+
+ public void add(VARNAConfig c, RNA r,boolean select)
+ {
+ add(c, r, r.getName(),select);
+ }
+
+ public void add(VARNAConfig c, RNA r, String name)
+ {
+ add(c, r, name,false);
+ }
+ public void add(VARNAConfig c, RNA r, String name, boolean select)
+ {
+ if (select){
+ _l.removeSelectionInterval(0, _rnaList.size());
+ }
+ if (name.equals(""))
+ {
+ name = generateDefaultName();
+ }
+ FullBackup bck = new FullBackup(c,r,name);
+ _rnas.add(0, r);
+ _rnaList.add(0,bck);
+ if (select){
+ _l.setSelectedIndex(0);
+ }
+ }
+
+ public void remove(int i)
+ {
+ _rnas.remove(i);
+ _rnaList.remove(i);
+
+ }
+ public DefaultListModel getModel()
+ {
+ return _rnaList;
+ }
+ public boolean contains(RNA r)
+ {
+ return _rnas.contains(r);
+ }
+ /*public int getSize()
+ {
+ return _rnaList.getSize();
+ }*/
+ public FullBackup getElementAt(int i)
+ {
+ return (FullBackup) _rnaList.getElementAt(i);
+ }
+
+ public void removeSelected()
+ {
+ int i = _l.getSelectedIndex();
+ if (i!=-1)
+ {
+ if (_rnaList.getSize()==1)
+ {
+ RNA r = new RNA();
+ try {
+ r.setRNA(" ", ".");
+ } catch (ExceptionUnmatchedClosingParentheses e1) {
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ }
+ vp.showRNA(r);
+ vp.repaint();
+ }
+ else
+ {
+ int newi = i+1;
+ if (newi==_rnaList.getSize())
+ {
+ newi = _rnaList.getSize()-2;
+ }
+ FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
+ _l.setSelectedValue(bck,true);
+ }
+ _rnaList.remove(i);
+ }
+
+ }
+ }
+
+ public void onLayoutChanged() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onUINewStructure(VARNAConfig v, RNA r) {
+ _rnaList.add(v, r,"",true);
+ }
+
+ public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseClicked(MouseEvent e) {
+ if(e.getClickCount() == 2){
+ int index = _sideList.locationToIndex(e.getPoint());
+ ListModel dlm = _sideList.getModel();
+ FullBackup item = (FullBackup) dlm.getElementAt(index);;
+ _sideList.ensureIndexIsVisible(index);
+ /*TODO Object newName = JOptionPane.showInputDialog(
+ this,
+ "Specify a new name for this RNA",
+ "Rename RNA",
+ JOptionPane.QUESTION_MESSAGE,
+ (Icon)null,
+ null,
+ item.toString());
+ if (newName!=null)
+ {
+ item.name = newName.toString();
+ this._sideList.repaint();
+ }*/
+ }
+ }
+
+ public void mouseEntered(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseExited(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mousePressed(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseReleased(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public Color getColour(int atomIndex, int pdbResNum, String chain,
+ String pdbId) {
+ // TODO Auto-generated method stub
+ return null;
+ }
+
+ @Override
+ public String[] getPdbFile() {
+ // TODO Auto-generated method stub
+ return null;
+ }
+
+ @Override
+ public void highlightAtom(int atomIndex, int pdbResNum, String chain,
+ String pdbId) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void mouseOverStructure(int atomIndex, String strInfo) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void releaseReferences(Object svl) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void updateColours(Object source) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void componentHidden(ComponentEvent e) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void componentMoved(ComponentEvent e) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void componentResized(ComponentEvent e) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void componentShown(ComponentEvent e) {
+ // TODO Auto-generated method stub
+
+ }
+
+ @Override
+ public void onStructureRedrawn()
+ {
+ // TODO Auto-generated method stub
+
+ }
+}
+
+
+/*
+ public static void main(String[] args)
+ {
+ JTextField str = new JTextField("ATGC");
+
+ AppVarnaBinding vab = new AppVarnaBinding();
+ vab.varnagui.set_seq(str);
+ vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ vab.varnagui.pack();
+ vab.varnagui.setVisible(true);
+ }
+}
+*/
\ No newline at end of file
}
// TODO: update this text for each release or centrally store it for lite
// and application
- message.append("\nAuthors: Jim Procter, Andrew Waterhouse, Michele Clamp, James Cuff, Steve Searle,\n David Martin & Geoff Barton."
+ message.append("\nAuthors: Jim Procter, Jan Engelhardt, Lauren Lui, Andrew Waterhouse, Michele Clamp, James Cuff, Steve Searle,\n David Martin & Geoff Barton."
+ "\nDevelopment managed by The Barton Group, University of Dundee, Scotland, UK.\n"
+ "\nFor help, see the FAQ at www.jalview.org and/or join the jalview-discuss@jalview.org mailing list\n"
+ "\nIf you use Jalview, please cite:"
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.gui;
+
+import java.util.*;
+import java.awt.event.*;
+
+import jalview.datamodel.*;
+import jalview.schemes.*;
+
+/**
+ * Helps generate the colors for RNA secondary structure. Future: add option to
+ * change colors based on covariation.
+ *
+ * @author Lauren Michelle Lui
+ *
+ */
+public class RNAHelicesColourChooser
+{
+
+ AlignViewport av;
+
+ AlignmentPanel ap;
+
+ ColourSchemeI oldcs;
+
+ Hashtable oldgroupColours;
+
+ jalview.datamodel.AlignmentAnnotation currentAnnotation;
+
+ boolean adjusting = false;
+
+ public RNAHelicesColourChooser(AlignViewport av, final AlignmentPanel ap)
+ {
+ oldcs = av.getGlobalColourScheme();
+ if (av.alignment.getGroups() != null)
+ {
+ oldgroupColours = new Hashtable();
+ Vector allGroups = ap.av.alignment.getGroups();
+ SequenceGroup sg;
+ for (int g = 0; g < allGroups.size(); g++)
+ {
+ sg = (SequenceGroup) allGroups.get(g);
+ if (sg.cs != null)
+ {
+ oldgroupColours.put(sg, sg.cs);
+ }
+ }
+ }
+ this.av = av;
+ this.ap = ap;
+
+ if (oldcs instanceof RNAHelicesColour)
+ {
+ RNAHelicesColour rhc = (RNAHelicesColour) oldcs;
+
+ }
+
+ adjusting = true;
+ Vector list = new Vector();
+ int index = 1;
+ for (int i = 0; i < av.alignment.getAlignmentAnnotation().length; i++)
+ {
+ String label = av.alignment.getAlignmentAnnotation()[i].label;
+ if (!list.contains(label))
+ list.addElement(label);
+ else
+ list.addElement(label + "_" + (index++));
+ }
+
+ adjusting = false;
+
+ changeColour();
+
+ }
+
+ void changeColour()
+ {
+ // Check if combobox is still adjusting
+ if (adjusting)
+ {
+ return;
+ }
+
+ currentAnnotation = av.alignment.getAlignmentAnnotation()[0];// annotations.getSelectedIndex()];
+
+ RNAHelicesColour rhc = null;
+
+ rhc = new RNAHelicesColour(currentAnnotation);
+
+ av.setGlobalColourScheme(rhc);
+
+ if (av.alignment.getGroups() != null)
+ {
+ Vector allGroups = ap.av.alignment.getGroups();
+ SequenceGroup sg;
+ for (int g = 0; g < allGroups.size(); g++)
+ {
+ sg = (SequenceGroup) allGroups.get(g);
+
+ if (sg.cs == null)
+ {
+ continue;
+ }
+
+ sg.cs = new RNAHelicesColour(currentAnnotation);
+
+ }
+ }
+
+ ap.paintAlignment(false);
+ }
+
+ void reset()
+ {
+ av.setGlobalColourScheme(oldcs);
+ if (av.alignment.getGroups() != null)
+ {
+ Vector allGroups = ap.av.alignment.getGroups();
+ SequenceGroup sg;
+ for (int g = 0; g < allGroups.size(); g++)
+ {
+ sg = (SequenceGroup) allGroups.get(g);
+ sg.cs = (ColourSchemeI) oldgroupColours.get(sg);
+ }
+ }
+ }
+
+ public void annotations_actionPerformed(ActionEvent e)
+ {
+ changeColour();
+ }
+
+}
groupEditing = group;
startseq = seqCanvas.cursorY;
lastres = seqCanvas.cursorX;
- editSequence(true, seqCanvas.cursorX + getKeyboardNo1());
+ editSequence(true, false, seqCanvas.cursorX + getKeyboardNo1());
endEditing();
}
groupEditing = group;
startseq = seqCanvas.cursorY;
lastres = seqCanvas.cursorX + getKeyboardNo1();
- editSequence(false, seqCanvas.cursorX);
+ editSequence(false, false, seqCanvas.cursorX);
endEditing();
}
+
+ void insertNucAtCursor(boolean group,String nuc){
+ groupEditing = group;
+ startseq = seqCanvas.cursorY;
+ lastres = seqCanvas.cursorX;
+ editSequence(false, true, seqCanvas.cursorX + getKeyboardNo1());
+ endEditing();
+ }
void numberPressed(char value)
{
if ((res < av.getAlignment().getWidth()) && (res < lastres))
{
// dragLeft, delete gap
- editSequence(false, res);
+ editSequence(false, false,res);
}
else
{
- editSequence(true, res);
+ editSequence(true, false,res);
}
mouseDragging = true;
}
}
- synchronized void editSequence(boolean insertGap, int startres)
+ //TODO: Make it more clever than many booleans
+ synchronized void editSequence(boolean insertGap, boolean editSeq, int startres)
{
int fixedLeft = -1;
int fixedRight = -1;
{
editCommand.appendEdit(EditCommand.INSERT_GAP, new SequenceI[]
{ seq }, lastres, startres - lastres, av.alignment, true);
- }
+ }
}
else
{
+ if(!editSeq){
// dragging to the left
if (fixedColumns && fixedRight != -1)
{
{ seq }, startres, max, av.alignment, true);
}
}
+ }else{//insertGap==false AND editSeq==TRUE;
+ if (fixedColumns && fixedRight != -1)
+ {
+ for (int j = lastres; j < startres; j++)
+ {
+ insertChar(j, new SequenceI[]
+ { seq }, fixedRight);
+ }
+ }
+ else
+ {
+ editCommand.appendEdit(EditCommand.INSERT_NUC, new SequenceI[]
+ { seq }, lastres, startres - lastres, av.alignment, true);
+ }
+ }
}
}
addProperties(al);
for (int i = 0; i < annotations.size(); i++)
{
- al.addAnnotation((AlignmentAnnotation) annotations.elementAt(i));
+ // detect if annotations.elementAt(i) rna secondary structure
+ // if so then do:
+ /*
+ * SequenceFeature[] pairArray =
+ * Rna.GetBasePairsFromAlignmentAnnotation(annotations.elementAt(i));
+ * Rna.HelixMap(pairArray);
+ */
+ AlignmentAnnotation an = (AlignmentAnnotation) annotations
+ .elementAt(i);
+ an.validateRangeAndDisplay();
+ al.addAnnotation(an);
}
}
}\r
}\r
if (hasSymbols\r
- && (token.equals("H") || token.equals("E") || token\r
+ && (token.equals("H") || token.equals("E") || token.equals("S") || token\r
.equals(" ")))\r
{\r
// Either this character represents a helix or sheet\r
*/
public static final String[] READABLE_EXTENSIONS = new String[]
{ "fa, fasta, fastq", "aln", "pfam", "msf", "pir", "blc", "amsa", "jar",
- "sto" }; // ,
+ "sto,stk" }; // ,
// ".blast"
// };
// SelectAllFilter needs to be set first before adding further
// file filters to fix bug on Mac OSX
setAcceptAllFileFilterUsed(selectAll);
-
+
for (int i = 0; i < suffix.length; i++)
{
JalviewFileFilter jvf = new JalviewFileFilter(suffix[i], desc[i]);
addChoosableFileFilter(jvf);
-
if ((selected != null) && selected.equalsIgnoreCase(desc[i]))
{
chosen = jvf;
\r
import com.stevesoft.pat.*;\r
import jalview.datamodel.*;\r
+import jalview.analysis.Rna;\r
\r
// import org.apache.log4j.*;\r
\r
Hashtable seqs = new Hashtable();\r
Regex p, r, rend, s, x;\r
\r
+ // Temporary line for processing RNA annotation\r
+ // String RNAannot = "";\r
+\r
// ------------------ Parsing File ----------------------\r
// First, we have to check that this file has STOCKHOLM format, i.e. the\r
// first line must match\r
r = new Regex("#=(G[FSRC]?)\\s+(.*)"); // Finds any annotation line\r
x = new Regex("(\\S+)\\s+(\\S+)"); // split id from sequence\r
\r
+ // Convert all bracket types to parentheses (necessary for passing to VARNA)\r
+ Regex openparen = new Regex("(<|\\[)", "(");\r
+ Regex closeparen = new Regex("(>|\\])", ")");\r
+\r
+ // Detect if file is RNA by looking for bracket types\r
+ Regex detectbrackets = new Regex("(<|>|\\[|\\]|\\(|\\))");\r
+\r
rend.optimize();\r
p.optimize();\r
s.optimize();\r
r.optimize();\r
x.optimize();\r
+ openparen.optimize();\r
+ closeparen.optimize();\r
\r
while ((line = nextLine()) != null)\r
{\r
int start = 1;\r
int end = -1;\r
String sid = acc;\r
- // Retrieve hash of annotations for this accession\r
+ /*\r
+ * Retrieve hash of annotations for this accession\r
+ * Associate Annotation with accession\r
+ */\r
Hashtable accAnnotations = null;\r
\r
if (seqAnn != null && seqAnn.containsKey(acc))\r
{\r
accAnnotations = (Hashtable) seqAnn.remove(acc);\r
+ //TODO: add structures to sequence\r
}\r
\r
// Split accession in id and from/to\r
jalview.util.DBRefUtils.parseToDbRef(seqO, src, "0", acn);\r
// seqO.addDBRef(dbref);\r
}\r
+ } \r
+ if (accAnnotations != null && accAnnotations.containsKey("SS"))\r
+ {\r
+ Vector v = (Vector) accAnnotations.get("SS");\r
+ \r
+ for (int i = 0; i < v.size(); i++)\r
+ {\r
+ AlignmentAnnotation an = (AlignmentAnnotation) v.elementAt(i);\r
+ seqO.addAlignmentAnnotation(an);\r
+ //annotations.add(an);\r
+ }\r
}\r
+ \r
Hashtable features = null;\r
// We need to adjust the positions of all features to account for gaps\r
try\r
ann = new Hashtable();\r
seqAnn.put(acc, ann);\r
}\r
-\r
+ //TODO test structure, call parseAnnotationRow with vector from hashtable for specific sequence\r
Hashtable features;\r
// Get an object with all the content for an annotation\r
if (ann.containsKey("features"))\r
}\r
ns += seq;\r
content.put(description, ns);\r
+
+ if(type.equals("SS")){\r
+ Hashtable strucAnn;\r
+ if (seqAnn.containsKey(acc))\r
+ {\r
+ strucAnn = (Hashtable) seqAnn.get(acc);\r
+ }\r
+ else\r
+ {\r
+ strucAnn = new Hashtable();\r
+ }\r
+ \r
+ Vector newStruc=new Vector();\r
+ parseAnnotationRow(newStruc, type,ns);\r
+ \r
+ strucAnn.put(type, newStruc);\r
+ seqAnn.put(acc, strucAnn);\r
+ }\r
}\r
else\r
{\r
private AlignmentAnnotation parseAnnotationRow(Vector annotation,\r
String label, String annots)\r
{\r
+ String convert1, convert2 = null;\r
+\r
+ // Convert all bracket types to parentheses\r
+ Regex openparen = new Regex("(<|\\[)", "(");\r
+ Regex closeparen = new Regex("(>|\\])", ")");\r
+\r
+ // Detect if file is RNA by looking for bracket types\r
+ Regex detectbrackets = new Regex("(<|>|\\[|\\]|\\(|\\))");\r
+\r
+ convert1 = openparen.replaceAll(annots);\r
+ convert2 = closeparen.replaceAll(convert1);\r
+ annots = convert2;\r
+\r
String type = (label.indexOf("_cons") == label.length() - 5) ? label\r
.substring(0, label.length() - 5) : label;\r
boolean ss = false;\r
// be written out\r
if (ss)\r
{\r
- ann.secondaryStructure = jalview.schemes.ResidueProperties\r
- .getDssp3state(pos).charAt(0);\r
+ if (detectbrackets.search(pos))\r
+ {\r
+ ann.secondaryStructure = jalview.schemes.ResidueProperties\r
+ .getRNASecStrucState(pos).charAt(0);\r
+ }\r
+ else\r
+ {\r
+ ann.secondaryStructure = jalview.schemes.ResidueProperties\r
+ .getDssp3state(pos).charAt(0);\r
+ }\r
+\r
if (ann.secondaryStructure == pos.charAt(0) || pos.charAt(0) == 'C')\r
{\r
ann.displayCharacter = ""; // null; // " ";\r
annot.annotations.length);\r
System.arraycopy(els, 0, anns, annot.annotations.length, els.length);\r
annot.annotations = anns;\r
+ //System.out.println("else: ");\r
}\r
return annot;\r
}\r
+ id);\r
return id;\r
}\r
+ /**\r
+ * //ssline is complete secondary structure line private AlignmentAnnotation\r
+ * addHelices(Vector annotation, String label, String ssline) {\r
+ * \r
+ * // decide on secondary structure or not. Annotation[] els = new\r
+ * Annotation[ssline.length()]; for (int i = 0; i < ssline.length(); i++) {\r
+ * String pos = ssline.substring(i, i + 1); Annotation ann; ann = new\r
+ * Annotation(pos, "", ' ', 0f); // 0f is 'valid' null - will not\r
+ * \r
+ * ann.secondaryStructure =\r
+ * jalview.schemes.ResidueProperties.getRNAssState(pos).charAt(0);\r
+ * \r
+ * ann.displayCharacter = "x" + ann.displayCharacter;\r
+ * \r
+ * System.out.println(ann.displayCharacter);\r
+ * \r
+ * els[i] = ann; } AlignmentAnnotation helicesAnnot = null; Enumeration e =\r
+ * annotation.elements(); while (e.hasMoreElements()) { helicesAnnot =\r
+ * (AlignmentAnnotation) e.nextElement(); if (helicesAnnot.label.equals(type))\r
+ * break; helicesAnnot = null; } if (helicesAnnot == null) { helicesAnnot =\r
+ * new AlignmentAnnotation(type, type, els);\r
+ * annotation.addElement(helicesAnnot); } else { Annotation[] anns = new\r
+ * Annotation[helicesAnnot.annotations.length + els.length];\r
+ * System.arraycopy(helicesAnnot.annotations, 0, anns, 0,\r
+ * helicesAnnot.annotations.length); System.arraycopy(els, 0, anns,\r
+ * helicesAnnot.annotations.length, els.length); helicesAnnot.annotations =\r
+ * anns; }\r
+ * \r
+ * helicesAnnot.features = Rna.GetBasePairs(ssline);\r
+ * Rna.HelixMap(helicesAnnot.features);\r
+ * \r
+ * \r
+ * return helicesAnnot; }\r
+ */\r
}\r
protected JRadioButtonMenuItem BLOSUM62Colour = new JRadioButtonMenuItem();
+ protected JRadioButtonMenuItem nucleotideColour = new JRadioButtonMenuItem();
+
+ protected JRadioButtonMenuItem purinePyrimidineColour = new JRadioButtonMenuItem();
+
+ // protected JRadioButtonMenuItem covariationColour = new
+ // JRadioButtonMenuItem();
+
JMenuItem njTreeBlosumMenuItem = new JMenuItem();
JMenuItem avDistanceTreeBlosumMenuItem = new JMenuItem();
public JCheckBoxMenuItem showSeqFeaturesHeight = new JCheckBoxMenuItem();
- protected JRadioButtonMenuItem nucleotideColour = new JRadioButtonMenuItem();
-
JMenuItem deleteGroups = new JMenuItem();
JMenuItem delete = new JMenuItem();
JMenuItem annotationColour = new JMenuItem();
+ JMenuItem rnahelicesColour = new JMenuItem();
+
JMenuItem associatedData = new JMenuItem();
protected JCheckBoxMenuItem autoCalculate = new JCheckBoxMenuItem();
colours.add(PIDColour);
colours.add(BLOSUM62Colour);
colours.add(nucleotideColour);
+ colours.add(purinePyrimidineColour);
+ // colours.add(covariationColour);
setColourSelected(jalview.bin.Cache
.getDefault("DEFAULT_COLOUR", "None"));
break;
+ case ColourSchemeProperty.PURINEPYRIMIDINE:
+ purinePyrimidineColour.setSelected(true);
+
+ break;
+ /*
+ * case ColourSchemeProperty.COVARIATION:
+ * covariationColour.setSelected(true);
+ *
+ * break;
+ */
case ColourSchemeProperty.USER_DEFINED:
userDefinedColour.setSelected(true);
BLOSUM62Colour_actionPerformed(e);
}
});
+ nucleotideColour.setText("Nucleotide");
+ nucleotideColour.addActionListener(new java.awt.event.ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ nucleotideColour_actionPerformed(e);
+ }
+ });
+
+ purinePyrimidineColour.setText("Purine/Pyrimidine");
+ purinePyrimidineColour
+ .addActionListener(new java.awt.event.ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ purinePyrimidineColour_actionPerformed(e);
+ }
+ });
+ /*
+ * covariationColour.setText("Covariation");
+ * covariationColour.addActionListener(new java.awt.event.ActionListener() {
+ * public void actionPerformed(ActionEvent e) {
+ * covariationColour_actionPerformed(e); } });
+ */
+
avDistanceTreeBlosumMenuItem.setText("Average Distance Using BLOSUM62");
avDistanceTreeBlosumMenuItem
.addActionListener(new java.awt.event.ActionListener()
annotationColour_actionPerformed(e);
}
});
+
+ rnahelicesColour.setText("By RNA helices");
+ rnahelicesColour.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent e)
+ {
+ rnahelicesColour_actionPerformed(e);
+ }
+ });
+
associatedData.setText("Load Features / Annotations");
associatedData.addActionListener(new ActionListener()
{
colourMenu.add(turnColour);
colourMenu.add(buriedColour);
colourMenu.add(nucleotideColour);
+ colourMenu.add(purinePyrimidineColour);
+ // colourMenu.add(covariationColour);
colourMenu.add(userDefinedColour);
colourMenu.addSeparator();
colourMenu.add(conservationMenuItem);
colourMenu.add(abovePIDThreshold);
colourMenu.add(modifyPID);
colourMenu.add(annotationColour);
+ colourMenu.add(rnahelicesColour);
calculateMenu.add(sort);
calculateMenu.add(calculateTree);
calculateMenu.addSeparator();
{
}
+ protected void purinePyrimidineColour_actionPerformed(ActionEvent e)
+ {
+ }
+
+ /*
+ * protected void covariationColour_actionPerformed(ActionEvent e) { }
+ */
+
protected void noColourmenuItem_actionPerformed(ActionEvent e)
{
}
}
+ public void rnahelicesColour_actionPerformed(ActionEvent e)
+ {
+
+ }
+
public void associatedData_actionPerformed(ActionEvent e)
{
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.jbgui;
+
+import javax.swing.*;
+import java.awt.event.ActionListener;
+import java.awt.event.ActionEvent;
+
+public class GRnaStructureViewer extends JInternalFrame
+{
+ public GRnaStructureViewer()
+ {
+ try
+ {
+ jbInit();
+ } catch (Exception ex)
+ {
+ ex.printStackTrace();
+ }
+ }
+
+ private void jbInit() throws Exception
+ {
+
+ }
+
+}
buriedColour_actionPerformed(actionEvent);
}
});
+ purinePyrimidineColour.setText("Purine/Pyrimidine");
+ purinePyrimidineColour.addActionListener(new ActionListener()
+ {
+ public void actionPerformed(ActionEvent actionEvent)
+ {
+ purinePyrimidineColour_actionPerformed(actionEvent);
+ }
+ });
+
userColour.setText("User Defined ...");
userColour.addActionListener(new ActionListener()
{
colourMenu.add(strandColour);
colourMenu.add(turnColour);
colourMenu.add(buriedColour);
+ colourMenu.add(purinePyrimidineColour);
colourMenu.add(userColour);
colourMenu.add(jmolColour);
colourMenu.add(backGround);
protected JRadioButtonMenuItem turnColour = new JRadioButtonMenuItem();
protected JRadioButtonMenuItem buriedColour = new JRadioButtonMenuItem();
+
+ protected JRadioButtonMenuItem purinePyrimidineColour = new JRadioButtonMenuItem();
+
protected JRadioButtonMenuItem userColour = new JRadioButtonMenuItem();
{
}
+
+ public void purinePyrimidineColour_actionPerformed(ActionEvent actionEvent)
+ {
+
+ }
public void userColour_actionPerformed(ActionEvent actionEvent)
{
{
ret = NONE;
}
+ else if (name.equalsIgnoreCase("Purine/Pyrimidine"))
+ {
+ ret = PURINEPYRIMIDINE;
+ }
+ // else if (name.equalsIgnoreCase("Covariation"))
+ // {
+ // ret = COVARIATION;
+ // }
return ret;
}
{
index = NUCLEOTIDE;
}
+ else if (cs instanceof PurinePyrimidineColourScheme)
+ {
+ index = PURINEPYRIMIDINE;
+ }
+ /*
+ * else if (cs instanceof CovariationColourScheme) { index = COVARIATION; }
+ */
else if (cs instanceof UserColourScheme)
{
if ((((UserColourScheme) cs).getName() != null)
break;
+ case PURINEPYRIMIDINE:
+ ret = "Purine/Pyrimidine";
+
+ break;
+
+ /*
+ * case COVARIATION: ret = "Covariation";
+ *
+ * break;
+ */
case USER_DEFINED:
ret = "User Defined";
break;
+ case PURINEPYRIMIDINE:
+ cs = new PurinePyrimidineColourScheme();
+
+ break;
+
+ // case COVARIATION:
+ // cs = new CovariationColourScheme(annotation);
+
+ // break;
+
case USER_DEFINED:
Color[] col = new Color[24];
for (int i = 0; i < 24; i++)
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.schemes;
+
+import java.awt.*;
+import java.util.Hashtable;
+
+import jalview.datamodel.AlignmentAnnotation;
+
+/**
+ * Became RNAHelicesColour.java. Placeholder for true covariation color scheme
+ *
+ * @author Lauren Michelle Lui
+ * @version 2.5
+ */
+public class CovariationColourScheme extends ResidueColourScheme
+{
+ public Hashtable helixcolorhash = new Hashtable();
+
+ public Hashtable positionsToHelix = new Hashtable();
+
+ int numHelix = 0;
+
+ public AlignmentAnnotation annotation;
+
+ /**
+ * Creates a new CovariationColourScheme object.
+ */
+ public CovariationColourScheme(AlignmentAnnotation annotation)
+ {
+ this.annotation = annotation;
+
+ for (int x = 0; x < this.annotation._rnasecstr.length; x++)
+ {
+ // System.out.println(this.annotation._rnasecstr[x] + " Begin" +
+ // this.annotation._rnasecstr[x].getBegin());
+ // System.out.println(this.annotation._rnasecstr[x].getFeatureGroup());
+ // pairs.put(this.annotation._rnasecstr[x].getBegin(),
+ // this.annotation._rnasecstr[x].getEnd());
+
+ positionsToHelix.put(this.annotation._rnasecstr[x].getBegin(),
+ this.annotation._rnasecstr[x].getFeatureGroup());
+ positionsToHelix.put(this.annotation._rnasecstr[x].getEnd(),
+ this.annotation._rnasecstr[x].getFeatureGroup());
+
+ if (Integer.parseInt(this.annotation._rnasecstr[x].getFeatureGroup()) > numHelix)
+ {
+ numHelix = Integer.parseInt(this.annotation._rnasecstr[x]
+ .getFeatureGroup());
+ }
+
+ }
+
+ for (int j = 0; j <= numHelix; j++)
+ {
+ helixcolorhash.put(Integer.toString(j), jalview.util.ColorUtils
+ .generateRandomColor(Color.white));
+ }
+
+ }
+
+ /**
+ * DOCUMENT ME!
+ *
+ * @param n
+ * DOCUMENT ME!
+ *
+ * @return DOCUMENT ME!
+ */
+ public Color findColour(char c)
+ {
+ // System.out.println("called"); log.debug
+ // Generate a random pastel color
+
+ return ResidueProperties.purinepyrimidine[ResidueProperties.purinepyrimidineIndex[c]];// jalview.util.ColorUtils.generateRandomColor(Color.white);
+ }
+
+ /**
+ * DOCUMENT ME!
+ *
+ * @param n
+ * DOCUMENT ME!
+ * @param j
+ * DOCUMENT ME!
+ *
+ * @return DOCUMENT ME!
+ */
+ public Color findColour(char c, int j)
+ {
+ Color currentColour = Color.white;
+ String currentHelix = null;
+ // System.out.println(c + " " + j);
+ currentHelix = (String) positionsToHelix.get(j);
+ // System.out.println(positionsToHelix.get(j));
+
+ if (currentHelix != null)
+ {
+ currentColour = (Color) helixcolorhash.get(currentHelix);
+ }
+
+ // System.out.println(c + " " + j + " helix " + currentHelix + " " +
+ // currentColour);
+ return currentColour;
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.schemes;
+
+import java.awt.*;
+
+/**
+ * Class is based off of NucleotideColourScheme
+ *
+ * @author Lauren Michelle Lui
+ */
+public class PurinePyrimidineColourScheme extends ResidueColourScheme
+{
+ /**
+ * Creates a new PurinePyrimidineColourScheme object.
+ */
+ public PurinePyrimidineColourScheme()
+ {
+ super(ResidueProperties.purinepyrimidine, 0);
+ }
+
+ /**
+ * Finds the corresponding color for the type of character inputed
+ *
+ * @param c
+ * Character in sequence
+ *
+ * @return Color from purinepyrimidineIndex in
+ * jalview.schemes.ResidueProperties
+ */
+ public Color findColour(char c)
+ {
+ return colors[ResidueProperties.purinepyrimidineIndex[c]];
+ }
+
+ /**
+ * Returns color based on conservation
+ *
+ * @param c
+ * Character in sequence
+ * @param j
+ * Threshold
+ *
+ * @return Color in RGB
+ */
+ public Color findColour(char c, int j)
+ {
+ Color currentColour;
+ if ((threshold == 0) || aboveThreshold(c, j))
+ {
+ try
+ {
+ currentColour = colors[ResidueProperties.purinepyrimidineIndex[c]];
+ } catch (Exception ex)
+ {
+ return Color.white;
+ }
+ }
+ else
+ {
+ return Color.white;
+ }
+
+ if (conservationColouring)
+ {
+ currentColour = applyConservation(currentColour, j);
+ }
+
+ return currentColour;
+ }
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.schemes;
+
+import java.awt.*;
+import java.util.Hashtable;
+
+import jalview.datamodel.AlignmentAnnotation;
+
+/**
+ * Looks at the information computed from an RNA Stockholm format file on the
+ * secondary structure of the alignment. Extracts the information on the
+ * positions of the helices present and assigns colors.
+ *
+ * @author Lauren Michelle Lui
+ * @version 2.5
+ */
+public class RNAHelicesColour extends ResidueColourScheme
+{
+
+ /**
+ * Stores random colors generated for the number of helices
+ */
+ public Hashtable helixcolorhash = new Hashtable();
+
+ /**
+ * Maps sequence positions to the RNA helix they belong to. Key: position,
+ * Value: helix
+ */
+ public Hashtable positionsToHelix = new Hashtable();
+
+ /**
+ * Number of helices in the RNA secondary structure
+ */
+ int numHelix = 0;
+
+ public AlignmentAnnotation annotation;
+
+ /**
+ * Creates a new RNAHelicesColour object.
+ */
+ public RNAHelicesColour(AlignmentAnnotation annotation)
+ {
+ this.annotation = annotation;
+
+ // Figure out number of helices
+ // Length of rnasecstr is the number of pairs of positions that base pair
+ // with each other in the secondary structure
+ for (int x = 0; x < this.annotation._rnasecstr.length; x++)
+ {
+
+ /*
+ * System.out.println(this.annotation._rnasecstr[x] + " Begin" +
+ * this.annotation._rnasecstr[x].getBegin());
+ */
+ // System.out.println(this.annotation._rnasecstr[x].getFeatureGroup());
+
+ positionsToHelix.put(this.annotation._rnasecstr[x].getBegin(),
+ this.annotation._rnasecstr[x].getFeatureGroup());
+ positionsToHelix.put(this.annotation._rnasecstr[x].getEnd(),
+ this.annotation._rnasecstr[x].getFeatureGroup());
+
+ if (Integer.parseInt(this.annotation._rnasecstr[x].getFeatureGroup()) > numHelix)
+ {
+ numHelix = Integer.parseInt(this.annotation._rnasecstr[x]
+ .getFeatureGroup());
+ }
+
+ }
+
+ // Generate random colors and store
+ for (int j = 0; j <= numHelix; j++)
+ {
+ helixcolorhash.put(Integer.toString(j), jalview.util.ColorUtils
+ .generateRandomColor(Color.white));
+ }
+
+ }
+
+ /**
+ * Returns default color base on purinepyrimidineIndex in
+ * jalview.schemes.ResidueProperties (Allows coloring in sequence logo)
+ *
+ * @param c
+ * Character in sequence
+ *
+ * @return color in RGB
+ */
+ public Color findColour(char c)
+ {
+ return ResidueProperties.purinepyrimidine[ResidueProperties.purinepyrimidineIndex[c]];
+ // random colors for all positions
+ // jalview.util.ColorUtils.generateRandomColor(Color.white); If you want
+ }
+
+ /**
+ * Returns color based on helices
+ *
+ * @param c
+ * Character in sequence
+ * @param j
+ * Threshold
+ *
+ * @return Color in RGB
+ */
+ public Color findColour(char c, int j)
+ {
+ Color currentColour = Color.white;
+ String currentHelix = null;
+ currentHelix = (String) positionsToHelix.get(j);
+
+ if (currentHelix != null)
+ {
+ currentColour = (Color) helixcolorhash.get(currentHelix);
+ }
+
+ // System.out.println(c + " " + j + " helix " + currentHelix + " " +
+ // currentColour);
+ return currentColour;
+ }
+}
public static final int[] nucleotideIndex;
+ public static final int[] purinepyrimidineIndex;
+
public static final Hashtable aa3Hash = new Hashtable();
public static final Hashtable aa2Triplet = new Hashtable();
nucleotideName.put("y", "Unknown Pyrimidine");
nucleotideName.put("N", "Unknown");
nucleotideName.put("n", "Unknown");
+ nucleotideName.put("W", "Weak nucleotide (A or T)");
+ nucleotideName.put("w", "Weak nucleotide (A or T)");
+ nucleotideName.put("S", "Strong nucleotide (G or C)");
+ nucleotideName.put("s", "Strong nucleotide (G or C)");
+ nucleotideName.put("M", "Amino (A or C)");
+ nucleotideName.put("m", "Amino (A or C)");
+ nucleotideName.put("K", "Keto (G or T)");
+ nucleotideName.put("k", "Keto (G or T)");
+ nucleotideName.put("B", "Not A (G or C or T)");
+ nucleotideName.put("b", "Not A (G or C or T)");
+ nucleotideName.put("H", "Not G (A or C or T)");
+ nucleotideName.put("h", "Not G (A or C or T)");
+ nucleotideName.put("D", "Not C (A or G or T)");
+ nucleotideName.put("d", "Not C (A or G or T)");
+ nucleotideName.put("V", "Not T (A or G or C");
+ nucleotideName.put("v", "Not T (A or G or C");
+
+ }
+
+ static
+ {
+ purinepyrimidineIndex = new int[255];
+ for (int i = 0; i < 255; i++)
+ {
+ purinepyrimidineIndex[i] = 3; // non-nucleotide symbols are all non-gap
+ // gaps.
+ }
+
+ purinepyrimidineIndex['A'] = 0;
+ purinepyrimidineIndex['a'] = 0;
+ purinepyrimidineIndex['C'] = 1;
+ purinepyrimidineIndex['c'] = 1;
+ purinepyrimidineIndex['G'] = 0;
+ purinepyrimidineIndex['g'] = 0;
+ purinepyrimidineIndex['T'] = 1;
+ purinepyrimidineIndex['t'] = 1;
+ purinepyrimidineIndex['U'] = 1;
+ purinepyrimidineIndex['u'] = 1;
+ purinepyrimidineIndex['I'] = 2;
+ purinepyrimidineIndex['i'] = 2;
+ purinepyrimidineIndex['X'] = 2;
+ purinepyrimidineIndex['x'] = 2;
+ purinepyrimidineIndex['R'] = 0;
+ purinepyrimidineIndex['r'] = 0;
+ purinepyrimidineIndex['Y'] = 1;
+ purinepyrimidineIndex['y'] = 1;
+ purinepyrimidineIndex['N'] = 2;
+ purinepyrimidineIndex['n'] = 2;
}
static
new Color(235, 65, 60), // G
new Color(60, 136, 238), // T
new Color(60, 136, 238), // U
- Color.white, // I
- Color.white, // X
+ Color.white, // I (inosine)
+ Color.white, // X (xanthine)
Color.white, // R
Color.white, // Y
Color.white, // N
Color.white, // Gap
};
+ // Added for PurinePyrimidineColourScheme
+ public static final Color[] purinepyrimidine =
+ { new Color(255, 131, 250), // A, G, R purines purplish/orchid
+ new Color(64, 224, 208), // C,U, T, Y pyrimidines turquoise
+ Color.white, // all other nucleotides
+ Color.white // Gap
+ };
+
// Zappo
public static final Color[] zappo =
{ Color.pink, // A
return ss.toString();
}
+ /**
+ * Used by getRNASecStrucState
+ *
+ */
+ public static Hashtable toRNAssState;
+ static
+ {
+ toRNAssState = new Hashtable();
+ toRNAssState.put(")", "S");
+ toRNAssState.put("(", "S");
+ }
+
+ /**
+ * translate to RNA secondary structure representation
+ *
+ * @param ssstring
+ * @return ssstring as a RNA-state secondary structure assignment.
+ */
+ public static String getRNASecStrucState(String ssstring)
+ {
+ if (ssstring == null)
+ {
+ return null;
+ }
+ StringBuffer ss = new StringBuffer();
+ for (int i = 0; i < ssstring.length(); i++)
+ {
+ String ssc = ssstring.substring(i, i + 1);
+ if (toRNAssState.containsKey(ssc))
+ {
+ ss.append((String) toRNAssState.get(ssc));
+ }
+ else
+ {
+ ss.append(" ");
+ }
+ }
+ return ss.toString();
+ }
+
// main method generates perl representation of residue property hash
// / cut here
public static void main(String[] args)
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.structure;
+
+import jalview.datamodel.*;
+
+public interface SecondaryStructureListener
+{
+ public void mouseOverSequence(SequenceI sequence, int index);
+ public void mouseOverStructure(int atomIndex, String strInfo);
+
+}
((VamsasListener) listeners.elementAt(i)).mouseOver(seq,
indexpos, source);
}
+ else if(listeners.elementAt(i) instanceof SecondaryStructureListener){
+ ((SecondaryStructureListener) listeners.elementAt(i)).mouseOverSequence(seq,indexpos);
+ }
}
}
}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+
+/**
+ * author: Lauren Michelle Lui
+ */
+
+package jalview.util;
+
+import java.awt.Color;
+import java.util.Random;
+
+public class ColorUtils
+{
+
+ /**
+ * Generates a random color, will mix with input color. Code taken from
+ * http://stackoverflow
+ * .com/questions/43044/algorithm-to-randomly-generate-an-aesthetically
+ * -pleasing-color-palette
+ *
+ * @param mix
+ * @return Random color in RGB
+ */
+ public static final Color generateRandomColor(Color mix)
+ {
+ Random random = new Random();
+ int red = random.nextInt(256);
+ int green = random.nextInt(256);
+ int blue = random.nextInt(256);
+
+ // mix the color
+ if (mix != null)
+ {
+ red = (red + mix.getRed()) / 2;
+ green = (green + mix.getGreen()) / 2;
+ blue = (blue + mix.getBlue()) / 2;
+ }
+
+ Color color = new Color(red, green, blue);
+ return color;
+
+ }
+
+}
// alignment is\r
// 'default' for\r
// PFAM\r
+ addDBRefSourceImpl(jalview.ws.dbsources.RfamFull.class);\r
+ addDBRefSourceImpl(jalview.ws.dbsources.RfamSeed.class);\r
registerDasSequenceSources();\r
}\r
\r
* @author JimP\r
* \r
*/\r
-abstract public class Pfam extends DbSourceProxyImpl implements\r
+abstract public class Pfam extends Xfam implements\r
DbSourceProxy\r
{\r
\r
* \r
* @see jalview.ws.DbSourceProxy#getDbVersion()\r
*/\r
- public String getDbVersion()\r
+ @Override\r
+public String getDbVersion()\r
{\r
// TODO Auto-generated method stub\r
return null;\r
}\r
\r
- /**\r
+ /**Returns base URL for selected Pfam alignment type\r
* \r
* @return PFAM URL stub for this DbSource\r
*/\r
- protected abstract String getPFAMURL();\r
+ @Override\r
+protected abstract String getXFAMURL();\r
\r
/*\r
* (non-Javadoc)\r
// individual references to each sequence in each family alignment that's\r
// retrieved.\r
startQuery();\r
- AlignmentI rcds = new jalview.io.FormatAdapter().readFile(getPFAMURL()\r
+ AlignmentI rcds = new jalview.io.FormatAdapter().readFile(getXFAMURL()\r
+ queries.trim().toUpperCase(), jalview.io.FormatAdapter.URL,\r
"STH");\r
for (int s = 0, sNum = rcds.getHeight(); s < sNum; s++)\r
/*\r
* public String getDbName() { return "PFAM"; // getDbSource(); }\r
*/\r
+ \r
+ \r
+ public String getXfamSource() { return jalview.datamodel.DBRefSource.PFAM; }\r
+ \r
+ \r
}\r
* \r
* @see jalview.ws.dbsources.Pfam#getPFAMURL()\r
*/\r
- protected String getPFAMURL()\r
+ protected String getXFAMURL()\r
{\r
return "http://pfam.sanger.ac.uk/family/alignment/download/format?alnType=full&format=stockholm&order=t&case=l&gaps=default&entry=";\r
}\r
return "PF03760";\r
}\r
\r
+public String getDbVersion() {\r
+ return null;\r
+}\r
+\r
}\r
* \r
* @see jalview.ws.dbsources.Pfam#getPFAMURL()\r
*/\r
- protected String getPFAMURL()\r
+ protected String getXFAMURL()\r
{\r
return "http://pfam.sanger.ac.uk/family/alignment/download/format?alnType=seed&format=stockholm&order=t&case=l&gaps=default&entry=";\r
}\r
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.ws.dbsources;
+
+import com.stevesoft.pat.Regex;
+
+import jalview.ws.seqfetcher.DbSourceProxy;
+
+/**
+ * Contains methods for fetching sequences from Rfam database
+ *
+ * @author Lauren Michelle Lui
+ */
+abstract public class Rfam extends Xfam implements DbSourceProxy
+{
+
+ public Rfam()
+ {
+ super();
+ // all extensions of this RFAM source base class are DOMAINDB sources
+ addDbSourceProperty(jalview.datamodel.DBRefSource.DOMAINDB);
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.DbSourceProxy#getAccessionSeparator() Left here for
+ * consistency with Pfam class
+ */
+ public String getAccessionSeparator()
+ {
+ // TODO Auto-generated method stub
+ return null;
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.DbSourceProxy#getAccessionValidator() * Left here for
+ */
+ public Regex getAccessionValidator()
+ {
+ // TODO Auto-generated method stub
+ return null;
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * Left here for consistency with Pfam class
+ *
+ * @see jalview.ws.DbSourceProxy#getDbSource() public String getDbSource() { *
+ * this doesn't work - DbSource is key for the hash of DbSourceProxy instances
+ * - 1:many mapping for DbSource to proxy will be lost. * suggest : RFAM is an
+ * 'alignment' source - means proxy is higher level than a sequence source.
+ * return jalview.datamodel.DBRefSource.RFAM; }
+ */
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.DbSourceProxy#getDbVersion()
+ */
+ @Override
+ public String getDbVersion()
+ {
+ // TODO Auto-generated method stub
+ return null;
+ }
+
+ /**Returns base URL for selected Rfam alignment type
+ *
+ * @return RFAM URL stub for this DbSource
+ */
+ @Override
+ protected abstract String getXFAMURL();
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.DbSourceProxy#isValidReference(java.lang.String)
+ */
+ public boolean isValidReference(String accession)
+ {
+ return accession.indexOf("RF") == 0;
+ }
+
+ /* (non-Javadoc)
+ * @see jalview.ws.dbsources.Xfam#getXfamSource()
+ */
+ public String getXfamSource()
+ {
+ return jalview.datamodel.DBRefSource.RFAM;
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+
+package jalview.ws.dbsources;
+
+import jalview.ws.seqfetcher.DbSourceProxy;
+
+/**
+ * Flyweight class specifying retrieval of Full family alignments from RFAM
+ *
+ * @author Lauren Michelle Lui
+ *
+ */
+public class RfamFull extends Rfam implements DbSourceProxy
+{
+ public RfamFull()
+ {
+ super();
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.dbsources.Rfam#getXFAMURL()
+ */
+ protected String getXFAMURL()
+ {
+ return "http://rfam.sanger.ac.uk/family/alignment/download/format?alnType=full&nseLabels=0&format=stockholm&acc=";
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.seqfetcher.DbSourceProxy#getDbName()
+ */
+ public String getDbName()
+ {
+ return "RFAM (Full)";
+ }
+
+ public String getDbSource()
+ {
+ return getDbName(); // so we have unique DbSource string.
+ }
+
+ public String getTestQuery()
+ {
+ // Can be retrieved from http://rfam.janelia.org/cgi-bin/getdesc?acc=RF00014
+ // or
+ // http://rfam.sanger.ac.uk/family/alignment/download/format?alnType=full&nseLabels=0&format=stockholm&acc=RF00014
+ return "RF00014";
+ }
+
+ public String getDbVersion()
+ {
+ return null;
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.ws.dbsources;
+
+import jalview.ws.seqfetcher.DbSourceProxy;
+
+/**
+ * Flyweight class specifying retrieval of Seed family alignments from RFAM
+ *
+ * @author Lauren Michelle Lui
+ *
+ */
+public class RfamSeed extends Rfam implements DbSourceProxy
+{
+ public RfamSeed()
+ {
+ super();
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.dbsources.Rfam#getRFAMURL()
+ */
+ protected String getXFAMURL()
+ {
+ return "http://rfam.sanger.ac.uk/family/alignment/download/format?alnType=seed&nseLabels=0&format=stockholm&acc=";
+ // Janelia Farms url
+ // "http://rfam.janelia.org/cgi-bin/getalignment?type=seed&fmt=stockholm&acc=";
+ }
+
+ /*
+ * (non-Javadoc)
+ *
+ * @see jalview.ws.seqfetcher.DbSourceProxy#getDbName()
+ */
+ public String getDbName()
+ {
+ return "RFAM (Seed)";
+ }
+
+ public String getDbSource()
+ {
+ return getDbName(); // so we have unique DbSource string.
+ }
+
+ public String getTestQuery()
+ {
+ return "RF00014";
+ } // http://rfam.janelia.org/cgi-bin/getdesc?acc=RF00014
+
+ public String getDbVersion()
+ {
+ return null;
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.5)
+ * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ */
+package jalview.ws.dbsources;
+
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.DBRefEntry;
+import jalview.ws.seqfetcher.DbSourceProxyImpl;
+
+/**
+ * Acts as a superclass for the Rfam and Pfam classes
+ *
+ * @author Lauren Michelle Lui
+ *
+ */
+public abstract class Xfam extends DbSourceProxyImpl
+{
+
+ public Xfam()
+ {
+ super();
+ }
+
+ protected abstract String getXFAMURL();
+
+ public abstract String getDbVersion();
+
+ abstract String getXfamSource();
+
+ public AlignmentI getSequenceRecords(String queries) throws Exception
+ {
+ // TODO: this is not a perfect implementation. We need to be able to add
+ // individual references to each sequence in each family alignment that's
+ // retrieved.
+ startQuery();
+ AlignmentI rcds = new jalview.io.FormatAdapter().readFile(getXFAMURL()
+ + queries.trim().toUpperCase(), jalview.io.FormatAdapter.URL,
+ "STH");
+ for (int s = 0, sNum = rcds.getHeight(); s < sNum; s++)
+ {
+ rcds.getSequenceAt(s).addDBRef(new DBRefEntry(getXfamSource(),
+ // getDbSource(),
+ getDbVersion(), queries.trim().toUpperCase()));
+ if (!getDbSource().equals(getXfamSource()))
+ { // add the specific ref too
+ rcds.getSequenceAt(s).addDBRef(
+ new DBRefEntry(getDbSource(), getDbVersion(), queries
+ .trim().toUpperCase()));
+ }
+ }
+ stopQuery();
+ return rcds;
+ }
+
+}
\ No newline at end of file
git://source.jalview.org / jalview.git / commitdiff
