*/
package jalview.gui;
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Component;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.datatransfer.DataFlavor;
+import java.awt.datatransfer.Transferable;
+import java.awt.dnd.DnDConstants;
+import java.awt.dnd.DropTarget;
+import java.awt.dnd.DropTargetDragEvent;
+import java.awt.dnd.DropTargetDropEvent;
+import java.awt.dnd.DropTargetEvent;
+import java.awt.dnd.DropTargetListener;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.MouseEvent;
+import java.awt.event.MouseListener;
+import java.io.File;
+import java.text.DateFormat;
+import java.util.ArrayList;
+import java.util.Date;
+import java.util.List;
+
+import javax.swing.DefaultListModel;
+import javax.swing.DefaultListSelectionModel;
+import javax.swing.Icon;
+import javax.swing.JButton;
import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JList;
+import javax.swing.JOptionPane;
+import javax.swing.JPanel;
+import javax.swing.JScrollPane;
+import javax.swing.JSplitPane;
+import javax.swing.JTextField;
+import javax.swing.ListModel;
+import javax.swing.ListSelectionModel;
+import javax.swing.UIManager;
+import javax.swing.UnsupportedLookAndFeelException;
+import javax.swing.event.ListSelectionEvent;
+import javax.swing.event.ListSelectionListener;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.components.ReorderableJList;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
+import fr.orsay.lri.varna.models.FullBackup;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+public class AppVarnaBinding extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener {
+
+ /**
+ *
+ */
+ //private static final long serialVersionUID = -790155708306987257L;
+
+ private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-import fr.orsay.lri.varna.applications.*;
+ private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+ private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
+ // private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+ // private static final String DEFAULT_STRUCTURE2 =
+ // "((((..(((....)))..))))";
+
+ private VARNAPanel _vp;
+
+ private JPanel _tools = new JPanel();
+ private JPanel _input = new JPanel();
+
+ private JPanel _seqPanel = new JPanel();
+ private JPanel _strPanel = new JPanel();
+ private JLabel _info = new JLabel();
+ private JTextField _str = new JTextField();
+ private JTextField _seq = new JTextField();
+ private JLabel _strLabel = new JLabel(" Str:");
+ private JLabel _seqLabel = new JLabel(" Seq:");
+ private JButton _createButton = new JButton("Create");
+ private JButton _deleteButton = new JButton("Delete");
+ private JButton _duplicateButton = new JButton("Snapshot");
+
+ private JPanel _listPanel = new JPanel();
+ private ReorderableJList _sideList = null;
-public class AppVarnaBinding// extends jalview.ext.jmol.JalviewJmolBinding
-{
- protected JFrame varnagui;
-
- public AppVarnaBinding(){
- newVarnaGui();
+
+ private static String errorOpt = "error";
+ @SuppressWarnings("unused")
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ private static int _nextID = 1;
+ @SuppressWarnings("unused")
+ private int _algoCode;
+
+ private BackupHolder _rnaList;
+
+
+ public AppVarnaBinding() {
+ super("VARNA in Jalview");
+ //this.set_seq("ATGC");
+ //this.set_str(".().");
+ //RNAPanelDemoInit();
+
+ //initVarna("ATGCATGATATATATATAT","....((((...))))....");
+ initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1);
}
+
+
+
+ private void initVarna(String seq, String str){
+ DefaultListModel dlm = new DefaultListModel();
+
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
+ _vp.showRNAInterpolated(sel.rna,sel.config,map);
+ _seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN());
+ }
+ }
+ });
+
+ _rnaList = new BackupHolder(dlm,_sideList);
+ RNA _RNA1 = new RNA("User defined 1");
+
+ try {
+ _vp = new VARNAPanel("0",".");
+ _RNA1.setRNA(seq, str);
+ _RNA1.drawRNARadiate(_vp.getConfig());
+ } catch (ExceptionNonEqualLength e) {
+ _vp.errorDialog(e);
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ _vp.setPreferredSize(new Dimension(400, 400));
+ _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+ setBackground(_backgroundColor);
+ _vp.setBackground(_backgroundColor);
+
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(_vp, BorderLayout.CENTER);
+
+ setVisible(true);
+ _vp.addVARNAListener(this);
+ }
+
+ private void RNAPanelDemoInit()
+ {
+ DefaultListModel dlm = new DefaultListModel();
+
+
+ int marginTools = 40;
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(this);
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener( new ListSelectionListener(){
+ public void valueChanged(ListSelectionEvent arg0) {
+ //System.out.println(arg0);
+ if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize());
+ _vp.showRNAInterpolated(sel.rna,sel.config,map);
+ _seq.setText(sel.rna.getSeq());
+ _str.setText(sel.rna.getStructDBN());
+ }
+ }
+ });
+
+ _rnaList = new BackupHolder(dlm,_sideList);
+ RNA _RNA1 = new RNA("User defined 1");
+ RNA _RNA2 = new RNA("User defined 2");
+ try {
+ _vp = new VARNAPanel("0",".");
+ _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1);
+ _RNA1.drawRNARadiate(_vp.getConfig());
+ _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
+ _RNA2.drawRNARadiate(_vp.getConfig());
+ } catch (ExceptionNonEqualLength e) {
+ _vp.errorDialog(e);
+ } catch (ExceptionUnmatchedClosingParentheses e2) {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3) {
+ e3.printStackTrace();
+ }
+ _vp.setPreferredSize(new Dimension(400, 400));
+ _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName());
+ _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
+
+ JScrollPane listScroller = new JScrollPane(_sideList);
+ listScroller.setPreferredSize(new Dimension(150, 0));
+
+ setBackground(_backgroundColor);
+ _vp.setBackground(_backgroundColor);
+
+
+ Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+ _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _seq.setFont(textFieldsFont);
+ _seq.setText(DEFAULT_SEQUENCE);
+
+ _createButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ try {
+ RNA nRNA = new RNA(generateDefaultName());
+ nRNA.setRNA(_seq.getText(), _str.getText());
+ nRNA.drawRNARadiate(_vp.getConfig());
+ _rnaList.add(new VARNAConfig(),nRNA,true);
+ } catch (ExceptionUnmatchedClosingParentheses e1) {
+ JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ JOptionPane.showMessageDialog(_vp, e1.getMessage(),"Error", JOptionPane.ERROR_MESSAGE);
+ }
+ }
+ });
+
+
+ _seqPanel.setLayout(new BorderLayout());
+ _seqPanel.add(_seqLabel, BorderLayout.WEST);
+ _seqPanel.add(_seq, BorderLayout.CENTER);
+
+ _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+ _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+ _str.setFont(textFieldsFont);
+ _strPanel.setLayout(new BorderLayout());
+ _strPanel.add(_strLabel, BorderLayout.WEST);
+ _strPanel.add(_str, BorderLayout.CENTER);
+
+ _input.setLayout(new GridLayout(2, 0));
+ _input.add(_seqPanel);
+ _input.add(_strPanel);
+
+ JPanel goPanel = new JPanel();
+ goPanel.setLayout(new BorderLayout());
+
+ _tools.setLayout(new BorderLayout());
+ _tools.add(_input, BorderLayout.CENTER);
+ _tools.add(_info, BorderLayout.SOUTH);
+ _tools.add(goPanel, BorderLayout.EAST);
+
+ _deleteButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.removeSelected();
+ }
+ });
+ _duplicateButton.addActionListener(new ActionListener() {
+ public void actionPerformed(ActionEvent e) {
+ _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true);
+ }});
+
+ JPanel ops = new JPanel();
+ ops.setLayout(new GridLayout(1,2));
+ ops.add(_deleteButton);
+ ops.add(_duplicateButton);
+
+ JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
+
+ _listPanel.add(ops,BorderLayout.SOUTH);
+ _listPanel.add(j,BorderLayout.NORTH);
+ _listPanel.add(listScroller,BorderLayout.CENTER);
+
+ goPanel.add(_createButton, BorderLayout.CENTER);
+
+ JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp);
+ getContentPane().setLayout(new BorderLayout());
+ getContentPane().add(split, BorderLayout.CENTER);
+ getContentPane().add(_tools, BorderLayout.NORTH);
+
+ setVisible(true);
+ DropTarget dt = new DropTarget(_vp, this);
- public void newVarnaGui(){
- varnagui=new VARNAGUI();
- }
+ _vp.addVARNAListener(this);
+ }
+
+ public static String generateDefaultName()
+ {
+ return "User file #"+_nextID++;
+ }
+
+ public RNA getRNA() {
+ return (RNA)_sideList.getSelectedValue();
+ }
+
+
+
+ public String[][] getParameterInfo() {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ public void init() {
+ _vp.setBackground(_backgroundColor);
+ _error = true;
+ }
+
+ @SuppressWarnings("unused")
+ private Color getSafeColor(String col, Color def) {
+ Color result;
+ try {
+ result = Color.decode(col);
+ } catch (Exception e) {
+ try {
+ result = Color.getColor(col, def);
+ } catch (Exception e2) {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ public VARNAPanel get_varnaPanel() {
+ return _vp;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface) {
+ _vp = surface;
+ }
+
+
+ public String get_seq() {
+ return _seq.getText();
+ }
+
+ public void set_seq(String _seq) {
+ this._seq.setText(_seq);
+ }
+ public String get_str(){
+ return _str.getText();
+ }
+ public void set_str(String _str){
+ this._str.setText(_str);
+ }
+
+ public JLabel get_info() {
+ return _info;
+ }
+
+ public void set_info(JLabel _info) {
+ this._info = _info;
+ }
+
+ public static void main(String[] args) {
+ AppVarnaBinding d = new AppVarnaBinding();
+ d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+ d.pack();
+ d.setVisible(true);
+ }
+
+
+ public void dragEnter(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragExit(DropTargetEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void dragOver(DropTargetDragEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void drop(DropTargetDropEvent dtde) {
+ try {
+ Transferable tr = dtde.getTransferable();
+ DataFlavor[] flavors = tr.getTransferDataFlavors();
+ for (int i = 0; i < flavors.length; i++) {
+ if (flavors[i].isFlavorJavaFileListType()) {
+ dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ Object ob = tr.getTransferData(flavors[i]);
+ if (ob instanceof List)
+ {
+ List list = (List) ob;
+ for (int j = 0; j < list.size(); j++) {
+ Object o = list.get(j);
+
+ if (dtde.getSource() instanceof DropTarget)
+ {
+ DropTarget dt = (DropTarget) dtde.getSource();
+ Component c = dt.getComponent();
+ if (c instanceof VARNAPanel)
+ {
+ String path = o.toString();
+ VARNAPanel vp = (VARNAPanel) c;
+ try{
+ FullBackup bck = VARNAPanel.importSession(path);
+ _rnaList.add(bck.config, bck.rna,bck.name,true);
+ }
+ catch (ExceptionLoadingFailed e3)
+ {
+ RNA r = new RNA();
+ r.loadSecStr(path);
+ r.drawRNA(vp.getConfig());
+ String name =r.getName();
+ if (name.equals(""))
+ {
+ name = path.substring(path.lastIndexOf(File.separatorChar)+1);
+ }
+ _rnaList.add(vp.getConfig().clone(),r,name,true);
+ }
+ }
+ }
+ }
+ }
+ // If we made it this far, everything worked.
+ dtde.dropComplete(true);
+ return;
+ }
+ }
+ // Hmm, the user must not have dropped a file list
+ dtde.rejectDrop();
+ } catch (Exception e) {
+ e.printStackTrace();
+ dtde.rejectDrop();
+ }
+
+ }
+
+ public void dropActionChanged(DropTargetDragEvent arg0) {
+ }
+
+ private class BackupHolder{
+ private DefaultListModel _rnaList;
+ private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+ JList _l;
+
+ public BackupHolder(DefaultListModel rnaList, JList l)
+ {
+ _rnaList = rnaList;
+ _l = l;
+ }
+
+ public void add(VARNAConfig c, RNA r)
+ {
+ add(c, r, r.getName(),false);
+ }
+
+ public void add(VARNAConfig c, RNA r,boolean select)
+ {
+ add(c, r, r.getName(),select);
+ }
+
+ public void add(VARNAConfig c, RNA r, String name)
+ {
+ add(c, r, name,false);
+ }
+ public void add(VARNAConfig c, RNA r, String name, boolean select)
+ {
+ if (select){
+ _l.removeSelectionInterval(0, _rnaList.size());
+ }
+ if (name.equals(""))
+ {
+ name = generateDefaultName();
+ }
+ FullBackup bck = new FullBackup(c,r,name);
+ _rnas.add(0, r);
+ _rnaList.add(0,bck);
+ if (select){
+ _l.setSelectedIndex(0);
+ }
+ }
+
+ public void remove(int i)
+ {
+ _rnas.remove(i);
+ _rnaList.remove(i);
+
+ }
+ public DefaultListModel getModel()
+ {
+ return _rnaList;
+ }
+ public boolean contains(RNA r)
+ {
+ return _rnas.contains(r);
+ }
+ /*public int getSize()
+ {
+ return _rnaList.getSize();
+ }*/
+ public FullBackup getElementAt(int i)
+ {
+ return (FullBackup) _rnaList.getElementAt(i);
+ }
+
+ public void removeSelected()
+ {
+ int i = _l.getSelectedIndex();
+ if (i!=-1)
+ {
+ if (_rnaList.getSize()==1)
+ {
+ RNA r = new RNA();
+ try {
+ r.setRNA(" ", ".");
+ } catch (ExceptionUnmatchedClosingParentheses e1) {
+ } catch (ExceptionFileFormatOrSyntax e1) {
+ }
+ _vp.showRNA(r);
+ _vp.repaint();
+ }
+ else
+ {
+ int newi = i+1;
+ if (newi==_rnaList.getSize())
+ {
+ newi = _rnaList.getSize()-2;
+ }
+ FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
+ _l.setSelectedValue(bck,true);
+ }
+ _rnaList.remove(i);
+ }
+
+ }
+ }
+
+ public void onLayoutChanged() {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void onUINewStructure(VARNAConfig v, RNA r) {
+ _rnaList.add(v, r,"",true);
+ }
+
+ public void onWarningEmitted(String s) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseClicked(MouseEvent e) {
+ if(e.getClickCount() == 2){
+ int index = _sideList.locationToIndex(e.getPoint());
+ ListModel dlm = _sideList.getModel();
+ FullBackup item = (FullBackup) dlm.getElementAt(index);;
+ _sideList.ensureIndexIsVisible(index);
+ Object newName = JOptionPane.showInputDialog(
+ this,
+ "Specify a new name for this RNA",
+ "Rename RNA",
+ JOptionPane.QUESTION_MESSAGE,
+ (Icon)null,
+ null,
+ item.toString());
+ if (newName!=null)
+ {
+ item.name = newName.toString();
+ this._sideList.repaint();
+ }
+ }
+ }
+
+ public void mouseEntered(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseExited(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mousePressed(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+
+ public void mouseReleased(MouseEvent arg0) {
+ // TODO Auto-generated method stub
+
+ }
+}
+
+
+/*
public static void main(String[] args)
{
+ JTextField str = new JTextField("ATGC");
+
AppVarnaBinding vab = new AppVarnaBinding();
+ vab.varnagui.set_seq(str);
vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
vab.varnagui.pack();
vab.varnagui.setVisible(true);
}
}
+*/
\ No newline at end of file
git://source.jalview.org / jalview.git / commitdiff