<classpathentry kind="lib" path="lib/jdas-1.0.4.jar"/>
<classpathentry kind="lib" path="lib/spring-core-3.0.5.RELEASE.jar"/>
<classpathentry kind="lib" path="lib/spring-web-3.0.5.RELEASE.jar"/>
- <classpathentry kind="lib" path="lib/groovy-all-1.8.2.jar"/>
<classpathentry kind="lib" path="lib/min-jabaws-client-2.1.0.jar" sourcepath="/clustengine"/>
<classpathentry kind="lib" path="lib/json_simple-1.1.jar" sourcepath="/Users/jimp/Downloads/json_simple-1.1-all.zip"/>
<classpathentry kind="lib" path="lib/slf4j-api-1.7.7.jar"/>
<classpathentry kind="con" path="org.testng.TESTNG_CONTAINER"/>
<classpathentry kind="lib" path="lib/biojava-core-4.1.0.jar"/>
<classpathentry kind="lib" path="lib/biojava-ontology-4.1.0.jar"/>
+ <classpathentry kind="lib" path="lib/groovy-all-2.4.6-indy.jar"/>
<classpathentry kind="output" path="classes"/>
</classpath>
commons-logging-1.1.1.jar
commons-logging.jar
commons-net-3.3.jar
+groovy-all-2.4.6-indy.jar APL 2.0 License - downloaded and extracted from https://dl.bintray.com/groovy/maven/apache-groovy-binary-2.4.6.zip
httpclient-4.0.3.jar
httpcore-4.0.1.jar
httpmime-4.0.3.jar
<echo message="build - compiles all necessary files for Application" />
<echo message="makedist - compiles and places all necessary jar files into directory dist" />
<echo message="makefulldist - signs all jar files and builds jnlp file for full distribution" />
- <echo message=" this needs a keystore and key. Add -Dtimestamp to timestamp signed jars"/>
+ <echo message=" this needs a keystore and key."/>
+ <echo message=" Add -Dtimestamp to timestamp signed jars"/>
+ <echo message=" -Djalview.keyalg and -Djalview.keydig are SHA1/SHA1withRSA"/>
<echo message=" See docs/building.html for more information." />
<echo message="compileApplet - compiles all necessary files for Applet" />
<echo message="makeApplet - compiles, then packages and obfuscates the Applet" />
<!-- locally valid proxy for signing with external time server -->
<property name="proxyPort" value="80"/>
<property name="proxyHost" value="sqid"/>
+ <!-- key sign/digest algorithms -->
+ <property name="jalview.keyalg" value="SHA1withRSA" description="key algorithm for signing"/>
+ <property name="jalview.keydig" value="SHA1" description="algorithm for jar digest"/>
<!-- default TestNG groups to run -->
<property name="testng-groups" value="Functional" />
</target>
<target name="-jarsignwithtsa" depends="makedist,preparejnlp" if="timestamp">
- <signjar storepass="${jalview.keystore.pass}" keypass="${jalview.key.pass}" keystore="${jalview.keystore}" alias="${jalview.key}" lazy="false" verbose="false" sigalg="SHA1withRSA"
+ <signjar storepass="${jalview.keystore.pass}" keypass="${jalview.key.pass}" keystore="${jalview.keystore}" alias="${jalview.key}" lazy="false" verbose="false" sigalg="${jalview.keyalg}" digestalg="${jalview.keydig}"
tsaproxyhost="${proxyHost}" tsaproxyport="${proxyPort}" tsaurl="${jalview.tsaurl}">
<fileset dir="${packageDir}">
<include name="*.jar" />
</signjar>
</target>
<target name="-jarsignnotsa" depends="makedist,preparejnlp" unless="timestamp">
- <signjar storepass="${jalview.keystore.pass}" keypass="${jalview.key.pass}" keystore="${jalview.keystore}" alias="${jalview.key}" lazy="false" verbose="false" sigalg="SHA1withRSA">
+ <signjar storepass="${jalview.keystore.pass}" keypass="${jalview.key.pass}" keystore="${jalview.keystore}" alias="${jalview.key}" lazy="false" verbose="false" sigalg="${jalview.keyalg}" digestalg="${jalview.keydig}">
<fileset dir="${packageDir}">
<include name="*.jar" />
</fileset>
</information>
<resources>
<j2se version="${j2sev}" initial_heap_size="${inih}" max_heap_size="${maxh}" />
+ <jar main="true" href="jalview.jar"/>
<fileset dir="${packageDir}">
- <include name="jalview.jar" />
- </fileset>
- <fileset dir="${packageDir}">
+ <exclude name="jalview.jar" />
<include name="*.jar" />
<include name="*_*.jar" />
- <exclude name="jalview.jar" />
<exclude name="*jnilib.jar" />
</fileset>
<property name="jalview.version" value="${JALVIEW_VERSION}" />
<pathelement location="appletlib/${jsoup}" />
<pathelement location="appletlib/${jsonSimple}" />
<pathelement location="appletlib/${javaJson}" />
- <pathelement location="appletlib/plugin.jar" />
+ <fileset dir="${java.home}/lib">
+ <include name="plugin.jar" />
+ </fileset>
</path>
<taskdef resource="proguard/ant/task.properties" classpath="utils/proguard.jar" />
</title>
<body>
<h1>
-Adding Groovy Support to Jalview
+Groovy Support in Jalview
</h1>
<p>
-There is currently no scripting language
-extension within Jalview, in part because a
-scripting API has not yet been developed.
-</p>
-<p>It is, however, really easy to embed scripting
-engines like groovy. If groovy is detected on the
-classpath, a new menu entry on the Desktop's Tools
-menu will open the GroovyShell.
+ <a href="http://www.groovy-lang.org">Groovy</a> has been bundled with the Jalview desktop since circa 2012. The program supports interactive execution of groovy scripts via the Groovy Console, and command line execution via the '-groovy' option. The main source for documentation about Groovy in Jalview is the <a href="http://www.jalview.org/help/html/features/groovy.html">online help pages</a>.
</p>
<p>Here are some scripts to get you started:</p>
<ul><li>Getting the title, alignment and first sequence from the current alignFrame<br>
<pre>
-def alf = Jalview.getAlignframes();
+def alf = Jalview.getAlignFrames();
print alf[0].getTitle();
def alignment = alf[0].viewport.alignment;
def seq = alignment.getSequenceAt(0);
</pre>
</li>
</ul>
-<h1>Getting Groovy...</h1>
-<p>
-You need the core groovy jars which include the GroovyShell. The easiest way of doing
-this is to add the groovy-all-*.jar to the lib directory whose path is given in the java.ext.dirs property.</p>
-<p>The is obtained from the <em>embedded</em> directory within the <a
-href="http://dist.codehaus.org/groovy/distributions"/>groovy distribution</a>).
-</p>
<h2>TODO</h2>
<p>
Using Java class methods from Groovy is straightforward, but currently, there isn't a set of easy to use methods for the jalview objects. A Jalview Scripting API needs to be developed to make this easier.</p>
<p>
You will need the following (hopefully):<br>
<ul>
-<li>Java development kit (JDK1.6 is the recommended platform for developing with Jalview, although JDK1.7 seems to work too!).</li>
-<li>Ant (we think 1.5.4 is quite sufficient to use the simple build
-file supplied, and it seems to work with later versions e.g. 1.7).</li>
+<li>Java development kit (JDK1.8 is now the recommended platform for developing with Jalview.</li>
+<li>Ant (1.7 or later will be needed for some of the jarsigning tools).</li>
</ul>
With any luck, after setting your paths and JAVA_HOME correctly, you
just need to change to the Jalview directory and run ant (this works
-from JBuilder and eclipse too, but NetBeans is a bit trickier).
+from eclipse too, but NetBeans is a bit trickier).
<pre>
ant
</pre>
dist. But first you need to make your own key:
<p><strong>Making your own key</strong></p>
-<p>The ant 'makefulldist' target assumes that a keystore exists in a
-directory 'keys'. To make a key accessible using the default settings
-in the build.xml file then make the keys directory and add the
-jarsigner key with the following :
-</p>
-<pre>
-mkdir keys
-keytool -genkey -keystore keys/.keystore -keypass alignmentisfun
--storepass alignmentisfun -alias jalview
- (you will have to answer some personal questions here)
-ant makedist
- (should eventually generate a Jalview.jnlp file
- in ./dist along with a set of signed jars using the jalview
- key)
-</pre>
-
- <p>
+ <p>The ant 'makefulldist' target assumes that a keystore exists in
+ a directory 'keys'. To make a key accessible using the default
+ settings in the build.xml file then make the keys directory and add
+ the jarsigner key with the following :</p>
+ <pre>mkdir keys</pre>
+ <pre>keytool -genkey -keystore keys/.keystore -keypass alignmentisfun
+ -storepass alignmentisfun -sigalg SHA1withRSA -keyalg RSA -alias jalview</pre>
+ <em>(you will have to answer some personal questions here)</em>
+ <pre>ant makedist -DWebStartLocation="file://.pathtojalviewsource./dist" -Dapplication.codebase="*"</pre>
+ <p>This should eventually generate a jalview.jnlp file in ./dist
+ along with a set of signed jars using the jalview key). In order to
+ test locally via webstart you'll now need to add 'file:/' to your
+ java webstart security exception list. Then:</p>
+ <pre>javaws file://.pathtojalviewsource./dist/jalview.jnlp</pre>
+ <p>Please remember to remove that entry afterwards, since it will leave
+ your system vulnerable to malicious code.
+ </p>
+ <p>
<strong>Building the JalviewLite applet<br>
</strong> The JalviewLite applet is compiled using a subset of the packages in
the src directory (specifically: MCView, and jalview.{datamodel,
ST-TURN-IIL blue|255,0,255|absolute|20.0|95.0|below|66.0
-GAMMA-TURN-CLASSIC red|0,255,255|20.0|95.0|below|66.0
+GAMMA-TURN-CLASSIC red|0,255,255|20.0|95.0|below|66.0
BETA-TURN-IR 9a6a94
BETA-TURN-IL d6a6ca
BETA-BULGE 1dc451
ST-MOTIF ac25a1
STARTGROUP uniprot
+<html><a href="http://pfam.xfam.org/family/PF00111">Pfam family</a></html> FER_CAPAA -1 0 0 Pfam
Iron-sulfur (2Fe-2S) FER_CAPAA -1 39 39 METAL
Iron-sulfur (2Fe-2S) FER_CAPAA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER_CAPAA -1 47 47 METAL
Iron-sulfur (2Fe-2S) FER_CAPAA -1 77 77 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_8</a></html> FER_CAPAA -1 8 83 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_8</a></html> FER_CAPAA -1 8 83 Pfam
Ferredoxin_fold Status: True Positive FER_CAPAA -1 3 93 Cath
Iron-sulfur (2Fe-2S) FER_CAPAN -1 86 86 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 94 94 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 124 124 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_13</a></html> FER_CAPAN -1 55 130 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_13</a></html> FER_CAPAN -1 55 130 Pfam
Ferredoxin_fold Status: True Positive FER_CAPAN -1 45 140 Cath
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 86 86 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 94 94 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 124 124 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_13</a></html> FER1_SOLLC -1 55 130 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_13</a></html> FER1_SOLLC -1 55 130 Pfam
Ferredoxin_fold Status: True Positive FER1_SOLLC -1 45 140 Cath
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_13</a></html> Q93XJ9_SOLTU -1 55 130 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_13</a></html> Q93XJ9_SOLTU -1 55 130 Pfam
Ferredoxin_fold Status: True Positive Q93XJ9_SOLTU -1 45 140 Cath
Iron-sulfur (2Fe-2S) FER1_PEA -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER1_PEA -1 96 96 METAL
Iron-sulfur (2Fe-2S) FER1_PEA -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER1_PEA -1 129 129 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_13</a></html> FER1_PEA -1 60 135 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_13</a></html> FER1_PEA -1 60 135 Pfam
Ferredoxin_fold Status: True Positive FER1_PEA -1 50 145 Cath
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 63_13</a></html> Q7XA98_TRIPR -1 63 138 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 63_13</a></html> Q7XA98_TRIPR -1 63 138 Pfam
Ferredoxin_fold Status: True Positive Q7XA98_TRIPR -1 53 148 Cath
Iron-sulfur (2Fe-2S) FER1_MESCR -1 90 90 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 95 95 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 98 98 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 128 128 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 59_13</a></html> FER1_MESCR -1 59 134 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 59_13</a></html> FER1_MESCR -1 59 134 Pfam
Ferredoxin_fold Status: True Positive FER1_MESCR -1 49 144 Cath
Iron-sulfur (2Fe-2S) FER1_SPIOL -1 89 89 METAL
Iron-sulfur (2Fe-2S) FER1_SPIOL -1 94 94 METAL
Iron-sulfur (2Fe-2S) FER1_SPIOL -1 97 97 METAL
Iron-sulfur (2Fe-2S) FER1_SPIOL -1 127 127 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 58_13</a></html> FER1_SPIOL -1 58 133 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 58_13</a></html> FER1_SPIOL -1 58 133 Pfam
Ferredoxin_fold Status: True Positive FER1_SPIOL -1 48 143 Cath
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 39 39 METAL
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 47 47 METAL
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 77 77 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_8</a></html> FER3_RAPSA -1 8 83 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_8</a></html> FER3_RAPSA -1 8 83 Pfam
Ferredoxin_fold Status: True Positive FER3_RAPSA -1 3 93 Cath
Iron-sulfur (2Fe-2S) FER_BRANA -1 39 39 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 47 47 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 77 77 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_8</a></html> FER_BRANA -1 8 83 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_8</a></html> FER_BRANA -1 8 83 Pfam
Ferredoxin_fold Status: True Positive FER_BRANA -1 2 96 Cath
Iron-sulfur (2Fe-2S) FER2_ARATH -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 96 96 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 129 129 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_13</a></html> FER2_ARATH -1 60 135 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_13</a></html> FER2_ARATH -1 60 135 Pfam
Ferredoxin_fold Status: True Positive FER2_ARATH -1 50 145 Cath
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_11</a></html> Q93Z60_ARATH -1 60 118 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_11</a></html> Q93Z60_ARATH -1 60 118 Pfam
Ferredoxin_fold Status: True Positive Q93Z60_ARATH -1 52 118 Cath
Iron-sulfur (2Fe-2S) FER1_MAIZE -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER1_MAIZE -1 96 96 METAL
Iron-sulfur (2Fe-2S) FER1_MAIZE -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER1_MAIZE -1 129 129 METAL
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_13</a></html> FER1_MAIZE -1 60 135 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_13</a></html> FER1_MAIZE -1 60 135 Pfam
Ferredoxin_fold Status: True Positive FER1_MAIZE -1 50 145 Cath
-<html>Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 52_12</a></html> O80429_MAIZE -1 52 127 Pfam
+<html>Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 52_12</a></html> O80429_MAIZE -1 52 127 Pfam
Ferredoxin_fold Status: True Positive O80429_MAIZE -1 42 137 Cath
ENDGROUP uniprot
--- /dev/null
+import jalview.workers.FeatureCounterI;
+import jalview.workers.AlignmentAnnotationFactory;
+
+/*
+ * Example script that registers two alignment annotation calculators
+ * - one that counts residues in a column with Pfam annotation
+ * - one that counts only charged residues with Pfam annotation
+ * To try this, first load uniref50.fa from the examples folder, then load features
+ * from examples/exampleFeatures.txt, before running this script from the Groovy console.
+
+ * Modify this example as required to count by column any desired value that can be
+ * derived from the residue and sequence features at each position of an alignment.
+ */
+
+/*
+ * A closure that returns true for any Charged residue
+ */
+def isCharged = { residue ->
+ switch(residue) {
+ case ['D', 'd', 'E', 'e', 'H', 'h', 'K', 'k', 'R', 'r']:
+ return true
+ }
+ false
+}
+
+/*
+ * A closure that returns 1 if sequence features include type 'Pfam', else 0
+ * Argument should be a list of SequenceFeature
+ */
+def hasPfam = { features ->
+ for (sf in features)
+ {
+ /*
+ * Here we inspect the type of the sequence feature.
+ * You can also test sf.description, sf.score, sf.featureGroup,
+ * sf.strand, sf.phase, sf.begin, sf.end
+ * or sf.getValue(attributeName) for GFF 'column 9' properties
+ */
+ if ("Pfam".equals(sf.type))
+ {
+ return true
+ }
+ }
+ false
+}
+
+/*
+ * Closure that counts residues with a Pfam feature annotation
+ * Parameters are
+ * - the name (label) for the alignment annotation
+ * - the description (tooltip) for the annotation
+ * - a closure (groovy function) that tests whether to include a residue
+ * - a closure that tests whether to increment count based on sequence features
+ */
+def getColumnCounter = { name, desc, acceptResidue, acceptFeatures ->
+ [
+ getName: { name },
+ getDescription: { desc },
+ getMinColour: { [0, 255, 255] }, // cyan
+ getMaxColour: { [0, 0, 255] }, // blue
+ count:
+ { res, feats ->
+ def c = 0
+ if (acceptResidue.call(res))
+ {
+ if (acceptFeatures.call(feats))
+ {
+ c++
+ }
+ }
+ c
+ }
+ ] as FeatureCounterI
+}
+
+/*
+ * Define an annotation that counts any residue with Pfam domain annotation
+ */
+def pfamAnnotation = getColumnCounter("Pfam", "Count of residues with Pfam domain annotation", {true}, hasPfam)
+
+/*
+ * Define an annotation that counts charged residues with Pfam domain annotation
+ */
+def chargedPfamAnnotation = getColumnCounter("Pfam charged", "Count of charged residues with Pfam domain annotation", isCharged, hasPfam)
+
+/*
+ * Register the annotations
+ */
+AlignmentAnnotationFactory.newCalculator(pfamAnnotation)
+AlignmentAnnotationFactory.newCalculator(chargedPfamAnnotation)
--- /dev/null
+import jalview.workers.AlignmentAnnotationFactory;
+import jalview.workers.AnnotationProviderI;
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.Annotation;
+import jalview.util.ColorUtils;
+import jalview.util.Comparison;
+import java.awt.Color;
+
+/*
+ * Example script to compute two alignment annotations
+ * - count of Phosphorylation features
+ * - count of Turn features
+ * To try this, first load example file uniref50.fa and load on features file
+ * exampleFeatures.txt, before running this script
+ *
+ * The script only needs to be run once - it will be registered by Jalview
+ * and recalculated automatically when the alignment changes.
+ */
+
+/*
+ * A closure that returns true if value includes "PHOSPHORYLATION"
+ */
+def phosCounter = { type -> type.contains("PHOSPHORYLATION") }
+
+/*
+ * A closure that returns true if value includes "TURN"
+ */
+def turnCounter = { type -> type.contains("TURN") }
+
+/*
+ * A closure that computes and returns an array of Annotation values,
+ * one for each column of the alignment
+ */
+def getAnnotations(al, fr, counter)
+{
+ def width = al.width
+ def counts = new int[width]
+ def max = 0
+
+ /*
+ * count features in each column, record the maximum value
+ */
+ for (col = 0 ; col < width ; col++)
+ {
+ def count = 0
+ for (row = 0 ; row < al.height ; row++)
+ {
+ seq = al.getSequenceAt(row)
+ if (seq != null && col < seq.getLength())
+ {
+ def res = seq.getCharAt(col)
+ if (!Comparison.isGap(res))
+ {
+ pos = seq.findPosition(col)
+ features = fr.findFeaturesAtRes(seq, pos)
+ for (feature in features)
+ {
+ if (counter.call(feature.type))
+ {
+ count++
+ }
+ }
+ }
+ }
+ }
+ counts[col] = count
+ if (count > max)
+ {
+ max = count
+ }
+ }
+
+ /*
+ * make the Annotation objects, with a graduated colour scale
+ * (from min value to max value) for the histogram bars
+ */
+ def zero = '0' as char
+ def anns = new Annotation[width]
+ for (col = 0 ; col < width ; col++)
+ {
+ def c = counts[col]
+ if (c > 0)
+ {
+ Color color = ColorUtils.getGraduatedColour(c, 0, Color.cyan,
+ max, Color.blue)
+ anns[col] = AlignmentAnnotationFactory.newAnnotation(String.valueOf(c),
+ String.valueOf(c), zero, c, color)
+ }
+ }
+ anns
+}
+
+/*
+ * Define the method that performs the calculations, and builds two
+ * AlignmentAnnotation objects
+ */
+def annotator =
+ [ calculateAnnotation: { al, fr ->
+ def phosAnns = getAnnotations(al, fr, phosCounter)
+ def ann1 = AlignmentAnnotationFactory.newAlignmentAnnotation("Phosphorylation", "Count of Phosphorylation features", phosAnns)
+ def turnAnns = getAnnotations(al, fr, turnCounter)
+ def ann2 = AlignmentAnnotationFactory.newAlignmentAnnotation("Turn", "Count of Turn features", turnAnns)
+ return [ann1, ann2]
+ }
+ ] as AnnotationProviderI
+
+/*
+ * Register the annotation calculator with Jalview
+ */
+AlignmentAnnotationFactory.newCalculator(annotator)
Iron-sulfur (2Fe-2S) FER_CAPAA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER_CAPAA -1 47 47 METAL
Iron-sulfur (2Fe-2S) FER_CAPAA -1 77 77 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_83</a></html> FER_CAPAA -1 8 83 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_83</a></html> FER_CAPAA -1 8 83 Pfam
Chloroplast FER_CAPAN -1 1 47 TRANSIT
Iron-sulfur (2Fe-2S) FER_CAPAN -1 86 86 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 94 94 METAL
Iron-sulfur (2Fe-2S) FER_CAPAN -1 124 124 METAL
Phosphothreonine FER_CAPAN -1 136 136 MOD_RES
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_130</a></html> FER_CAPAN -1 55 130 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_130</a></html> FER_CAPAN -1 55 130 Pfam
Chloroplast FER1_SOLLC -1 1 47 TRANSIT
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 86 86 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 94 94 METAL
Iron-sulfur (2Fe-2S) FER1_SOLLC -1 124 124 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_130</a></html> FER1_SOLLC -1 55 130 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_130</a></html> FER1_SOLLC -1 55 130 Pfam
Evidence: EI4 Q93XJ9_SOLTU -1 1 48 SIGNAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 55_130</a></html> Q93XJ9_SOLTU -1 55 130 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 55_130</a></html> Q93XJ9_SOLTU -1 55 130 Pfam
Chloroplast FER1_PEA -1 1 52 TRANSIT
L -> I (in strain: cv. Onward) FER1_PEA -1 59 59 VARIANT
I -> L (in strain: cv. Onward) FER1_PEA -1 85 85 VARIANT
Iron-sulfur (2Fe-2S) FER1_PEA -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER1_PEA -1 129 129 METAL
YPTS -> PPPA (in Ref. 2) FER1_PEA -1 132 135 CONFLICT
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_135</a></html> FER1_PEA -1 60 135 Pfam
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 63_138</a></html> Q7XA98_TRIPR -1 63 138 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_135</a></html> FER1_PEA -1 60 135 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 63_138</a></html> Q7XA98_TRIPR -1 63 138 Pfam
Chloroplast FER1_MESCR -1 1 51 TRANSIT
Iron-sulfur (2Fe-2S) FER1_MESCR -1 90 90 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 95 95 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 98 98 METAL
Iron-sulfur (2Fe-2S) FER1_MESCR -1 128 128 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 59_134</a></html> FER1_MESCR -1 59 134 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 59_134</a></html> FER1_MESCR -1 59 134 Pfam
Chloroplast FER1_SPIOL -1 1 50 TRANSIT
STRAND FER1_SPIOL -1 52 59 STRAND
TURN FER1_SPIOL -1 60 61 TURN
STRAND FER1_SPIOL -1 130 133 STRAND
STRAND FER1_SPIOL -1 135 138 STRAND
HELIX FER1_SPIOL -1 142 144 HELIX
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 58_133</a></html> FER1_SPIOL -1 58 133 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 58_133</a></html> FER1_SPIOL -1 58 133 Pfam
I -> V FER3_RAPSA -1 8 8 VARIANT
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 39 39 METAL
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER3_RAPSA -1 77 77 METAL
R -> K FER3_RAPSA -1 91 91 VARIANT
M -> V FER3_RAPSA -1 95 95 VARIANT
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_83</a></html> FER3_RAPSA -1 8 83 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_83</a></html> FER3_RAPSA -1 8 83 Pfam
Chloroplast FER1_ARATH -1 1 52 TRANSIT
Iron-sulfur (2Fe-2S) FER1_ARATH -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER1_ARATH -1 96 96 METAL
Iron-sulfur (2Fe-2S) FER1_ARATH -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER1_ARATH -1 129 129 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_135</a></html> FER1_ARATH -1 60 135 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_135</a></html> FER1_ARATH -1 60 135 Pfam
Iron-sulfur (2Fe-2S) FER_BRANA -1 39 39 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 44 44 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 47 47 METAL
Iron-sulfur (2Fe-2S) FER_BRANA -1 77 77 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 8_83</a></html> FER_BRANA -1 8 83 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 8_83</a></html> FER_BRANA -1 8 83 Pfam
Chloroplast FER2_ARATH -1 1 52 TRANSIT
Iron-sulfur (2Fe-2S) FER2_ARATH -1 91 91 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 96 96 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 99 99 METAL
Iron-sulfur (2Fe-2S) FER2_ARATH -1 129 129 METAL
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_135</a></html> FER2_ARATH -1 60 135 Pfam
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_118</a></html> Q93Z60_ARATH -1 60 118 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_135</a></html> FER2_ARATH -1 60 135 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_118</a></html> Q93Z60_ARATH -1 60 118 Pfam
Chloroplast FER1_MAIZE -1 1 52 TRANSIT
STRAND FER1_MAIZE -1 57 59 STRAND
STRAND FER1_MAIZE -1 72 74 STRAND
STRAND FER1_MAIZE -1 132 135 STRAND
STRAND FER1_MAIZE -1 137 141 STRAND
TURN FER1_MAIZE -1 142 142 TURN
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 60_135</a></html> FER1_MAIZE -1 60 135 Pfam
-<html>Description: Fer2 Status: True Positive <a href="http://pfam.sanger.ac.uk/family/PF00111">Pfam 52_127</a></html> O80429_MAIZE -1 52 127 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 60_135</a></html> FER1_MAIZE -1 60 135 Pfam
+<html>Description: Fer2 Status: True Positive <a href="http://pfam.xfam.org/family/PF00111">Pfam 52_127</a></html> O80429_MAIZE -1 52 127 Pfam
ENDGROUP uniprot
--- /dev/null
+##gff-version 2
+# exonerate output in gff2 format; not gff3 because
+# - 'similarity' is not a Sequence Ontology term
+# - attributes' name/values are separated by space ' ' not equals '='
+##source-version exonerate:protein2genome:local 2.2.0
+##date 2015-01-16
+##type DNA
+#
+# exonerate run with --showtargetgff generates 'features on the target' i.e. mappings to the query
+# tab-delimited
+# seqname source feature start end score strand frame attributes
+#
+seq1 exonerate:protein2genome:local gene 8 11 3652 - . gene_id 0 ; sequence seq2 ; gene_orientation .
+seq1 exonerate:protein2genome:local cds 9 11 . - .
+seq1 exonerate:protein2genome:local exon 9 11 . - . insertions 3 ; deletions 6
+#seq1 exonerate:protein2genome:local similarity 8 11 3652 - . alignment_id 0 ; Query seq2 ; Align 11 1 3
+seq1 exonerate:protein2genome:local similarity 9 11 3652 - . alignment_id 0 ; Query seq2 ; Align 11 1 3
+#
+# appending FASTA sequences is strictly a GFF3 format feature
+# but Jalview is able to handle this mixture of GFF2 / GFF3 :-)
+#
+##FASTA
+>seq1
+ACTACGACACGACGACGACGACG
+>seq2
+CDEQEATGTQDAQEQAQC
+
--- /dev/null
+uniprot_data_columns
+#
+_group.id
+_group.name
+_group.sort_order
+g1;Quality Measures;3
+g2;Cross References;2
+g3;Names & Taxonomy;1
+g4;Procedures & Softwares;4
+g5;Date Of;5
+g6;Miscellenous;6
+g7;Sequences;7
+g8;Function;8
+g9;Interaction;9
+g10;Expression;10
+g11;Gene Ontology;11
+g12;Pathology & Biotech;12
+g13;Subcellular location;13
+g14;PTM / Processing;14
+g15;Structure;15
+g16;Publications;16
+g17;Date of;17
+g18;Family & Domain;18
+#
+_data_column.primary_key;entry name
+_data_column.default_response_page_size;100
+#
+_data_column.name
+_data_column.code
+_data_column.group_id
+_data_column.data_type
+_data_column.min_col_width
+_data_column.max_col_width
+_data_column.preferred_col_width
+_data_column.is_shown_by_default
+_data_column.is_searchable
+Entry Name;entry name;String;g3;80;100;85;true;true
+Protein names;protein names;String;g3;300;1500;500;true;true
+Gene Names;genes;String;g3;50;1000;95;true;true
+Organism;organism;String;g3;50;1000;95;true;true
+Organism ID;organism-id;int;g3;60;100;80;false;true
+Proteomes;proteome;String;g3;50;1000;95;false;true
+Taxonomic lineage (ALL);lineage(ALL);String;g3;50;400;95;false;false
+Virus hosts;virus hosts;String;g3;50;1000;95;false;true
+Fragment;fragment;String;g7;50;1000;95;false;true
+Gene encoded by;encodedon;String;g7;50;1000;95;false;true
+Alternative products (isoforms);comment(ALTERNATIVE PRODUCTS);String;g7;50;1000;95;false;false
+Erroneous gene model prediction;comment(ERRONEOUS GENE MODEL PREDICTION);String;g7;50;1000;95;false;false
+Erroneous initiation;comment(ERRONEOUS INITIATION);String;g7;50;1000;95;false;false
+Erroneous translation;comment(ERRONEOUS TRANSLATION);String;g7;50;1000;95;false;false
+Frameshift;comment(FRAMESHIFT);String;g7;50;1000;95;false;false
+Mass spectrometry;comment(MASS SPECTROMETRY);String;g7;50;1000;95;false;false
+Polymorphism;comment(POLYMORPHISM);String;g7;50;1000;95;false;false
+RNA editing;comment(RNA EDITING);String;g7;50;1000;95;false;false
+Sequence caution;comment(SEQUENCE CAUTION);String;g7;50;1000;95;false;false
+Length;length;int;g7;50;100;95;false;true
+Mass;mass;String;g7;50;100;80;false;true
+Sequence;sequence;String;g7;50;1000;95;false;true
+Alternative sequence;feature(ALTERNATIVE SEQUENCE);String;g7;50;1000;95;false;false
+Natural variant;feature(NATURAL VARIANT);String;g7;50;1000;95;false;false
+Non-adjacent residues;feature(NON ADJACENT RESIDUES);String;g7;50;1000;95;false;false
+Non-standard residue;feature(NON STANDARD RESIDUE);String;g7;50;1000;95;false;false
+Non-terminal residue;feature(NON TERMINAL RESIDUE);String;g7;50;1000;95;false;false
+Sequence conflict;feature(SEQUENCE CONFLICT);String;g7;50;1000;95;false;false
+Sequence uncertainty;feature(SEQUENCE UNCERTAINTY);String;g7;50;1000;95;false;false
+Version (Sequence);version(sequence);String;g7;50;1000;95;false;false
+EC number;ec;String;g8;50;1000;95;false;true
+Absorption;comment(ABSORPTION);String;g8;50;1000;95;false;false
+Catalytic activity;comment(CATALYTIC ACTIVITY);String;g8;50;1000;95;false;false
+Cofactor;comment(COFACTOR);String;g8;50;1000;95;false;false
+Enzyme regulation;comment(ENZYME REGULATION);String;g8;50;1000;95;false;false
+Function [CC];comment(FUNCTION);String;g8;50;1000;95;false;false
+Kinetics;comment(KINETICS);String;g8;50;1000;95;false;false
+Pathway;comment(PATHWAY);String;g8;50;1000;95;false;false
+Redox potential;comment(REDOX POTENTIAL);String;g8;50;1000;95;false;false
+Temperature dependence;comment(TEMPERATURE DEPENDENCE);String;g8;50;1000;95;false;false
+pH dependence;comment(PH DEPENDENCE);String;g8;50;1000;95;false;false
+Active site;feature(ACTIVE SITE);String;g8;50;1000;95;false;false
+Binding site;feature(BINDING SITE);String;g8;50;1000;95;false;false
+DNA binding;feature(DNA BINDING);String;g8;50;1000;95;false;false
+Metal binding;feature(METAL BINDING);String;g8;50;1000;95;false;false
+Nucleotide binding;feature(NP BIND);String;g8;50;1000;95;false;false
+Site;feature(SITE);String;g8;50;1000;95;false;false
+Annotation;annotation score;String;g6;50;1000;95;false;true
+Features;features;String;g6;50;1000;95;false;true
+Caution;comment(CAUTION);String;g6;50;1000;95;false;false
+Miscellaneous [CC];comment(GENERAL);String;g6;50;1000;95;false;false
+Keywords;keywords;String;g6;50;1000;95;false;true
+Protein existence;existence;String;g6;50;1000;95;false;true
+Status;reviewed;String;g6;50;1000;95;false;true
+ALL;entry name;String;g7;50;1000;95;false;true;
+Subunit structure [CC];comment(SUBUNIT);String;g9;50;1000;95;false;false
+Interacts with;interactor;String;g9;50;1000;95;false;true
+Developmental stage;comment(DEVELOPMENTAL STAGE);String;g10;50;1000;95;false;false
+Induction;comment(INDUCTION);String;g10;50;1000;95;false;false
+Tissue specificity;comment(TISSUE SPECIFICITY);String;g10;50;1000;95;false;false
+Gene ontology (GO);go;String;g11;50;1000;95;false;true
+Gene ontology (biological process);go(biological process);String;g11;50;1000;95;false;false
+Gene ontology (molecular function);go(molecular function);String;g11;50;1000;95;false;false
+Gene ontology (cellular component);go(cellular component);String;g11;50;1000;95;false;false
+Gene ontology IDs;go-id;String;g11;50;1000;95;false;true
+Allergenic properties;comment(ALLERGEN);String;g12;50;1000;95;false;false
+Biotechnological use;comment(BIOTECHNOLOGY);String;g12;50;1000;95;false;false
+Disruption phenotype;comment(DISRUPTION PHENOTYPE);String;g12;50;1000;95;false;false
+Involvement in disease;comment(DISEASE);String;g12;50;1000;95;false;false
+Pharmaceutical use;comment(PHARMACEUTICAL);String;g12;50;1000;95;false;false
+Toxic dose;comment(TOXIC DOSE);String;g12;50;1000;95;false;false
+Subcellular location [CC];comment(SUBCELLULAR LOCATION);String;g13;50;1000;95;false;false
+Intramembrane;feature(INTRAMEMBRANE);String;g13;50;1000;95;false;false
+Topological domain;feature(TOPOLOGICAL DOMAIN);String;g13;50;1000;95;false;false
+Transmembrane;feature(TRANSMEMBRANE);String;g13;50;1000;95;false;false
+Post-translational modification;comment(PTM);String;g14;50;1000;95;false;false
+Chain;feature(CHAIN);String;g14;50;1000;95;false;false
+Cross-link;feature(CROSS LINK);String;g14;50;1000;95;false;false
+Disulfide bond;feature(DISULFIDE BOND);String;g14;50;1000;95;false;false
+Glycosylation;feature(GLYCOSYLATION);String;g14;50;1000;95;false;false
+Initiator methionine;feature(INITIATOR METHIONINE);String;g14;50;1000;95;false;false
+Lipidation;feature(LIPIDATION);String;g14;50;1000;95;false;false
+Modified residue;feature(MODIFIED RESIDUE);String;g14;50;1000;95;false;false
+Peptide;feature(PEPTIDE);String;g14;50;1000;95;false;false
+Propeptide;feature(PROPEPTIDE);String;g14;50;1000;95;false;false
+Signal peptide;feature(SIGNAL);String;g14;50;1000;95;false;false
+Transit peptide;feature(TRANSIT);String;g14;50;1000;95;false;false
+3D;3d;String;g15;50;1000;95;false;false
+Beta strand;feature(BETA STRAND);String;g15;50;1000;95;false;false
+Helix;feature(HELIX);String;g15;50;1000;95;false;false
+Turn;feature(TURN);String;g15;50;1000;95;false;false
+PubMed ID;citation;String;g16;50;1000;95;false;true
+Date of creation;created;String;g17;80;150;100;true;true
+Date of last modification;last-modified;String;g17;80;150;100;true;true
+Date of last sequence modification;sequence-modified;String;g17;80;150;100;false;true
+Version (entry);version(entry);int;g17;80;100;80;false;false
+Domain [CC];comment(DOMAIN);String;g18;80;1000;95;false;false
+Sequence similarities;comment(SIMILARITY);String;g18;50;1000;95;false;false
+Protein families;families;String;g18;50;1000;95;false;true
+Coiled coil;feature(COILED COIL);String;g18;50;1000;95;false;false
+Compositional bias;feature(COMPOSITIONAL BIAS);String;g18;50;1000;95;false;false
+Domain [FT];feature(DOMAIN EXTENT);String;g18;50;1000;95;false;false
+Motif;feature(MOTIF);String;g18;50;1000;95;false;false
+Region;feature(REGION);String;g18;50;1000;95;false;false
+Repeat;feature(REPEAT);String;g18;50;1000;95;false;false
+Zinc finger;feature(ZINC FINGER);String;g18;50;1000;95;false;false
+Cross-reference (EMBL);database(EMBL);String;g2;50;1000;95;false;false
+Cross-reference (PDB);database(PDB);String;g2;50;1000;95;false;false
+Cross-reference (ENSEMBL);database(ENSEMBL);String;g2;50;1000;95;false;false
+Cross-reference (PFAM);database(PFAM);String;g2;50;1000;95;false;false
+Cross-reference (RFAM);database(RFAM);String;g2;50;1000;95;false;false
+Cross-reference (CATH);database(CATH);String;g2;50;1000;95;false;false
+Cross-reference (SCOPE);database(SCOPE);String;g2;50;1000;95;false;false
+Cross-reference (GO);database(GO);String;g2;50;1000;95;false;false
+Cross-reference (INTERPRO);database(INTERPRO);String;g2;50;1000;95;false;false
+Mapped PubMed ID;citationmapping;String;g16;50;1000;95;false;true
+#
<tocitem text="PDB Sequence Fetcher" target="pdbfetcher" />
<tocitem text="PDB Structure Chooser" target="pdbchooser" />
<tocitem text="Chimera Viewer" target="chimera" />
- <tocitem text="Select columns by annotation" target="selectcolbyannot" />
+ <tocitem text="Select Columns by Annotation" target="selectcolbyannot" />
<tocitem text="Latest Release Notes" target="release"/>
</tocitem>
<tocitem text="Viewing Trees" target="treeviewer" expand="false" />
<tocitem text="Fetching Sequences" target="seqfetch" />
- <tocitem text="Select columns by annotation" target="selectcolbyannot" />
+ <tocitem text="Select Columns by Annotation" target="selectcolbyannot" />
<tocitem text="Nucleic Acid Support" target="nucleicAcids" expand="false">
<tocitem text="Viewing RNA structure" target="varna" />
<tocitem text="Consensus" target="calcs.consensus" />
<tocitem text="RNA Structure Consensus" target="calcs.alstrconsensus" />
<tocitem text="Annotations File Format" target="annotations.fileformat" />
- <tocitem text="Select Column by Annotation" target="calcs.annotation" />
+ <tocitem text="Select Columns by Annotation" target="selectcolbyannot" />
</tocitem>
<tocitem text="3D Structure Data" target="viewingpdbs" expand="false">
<tocitem text="PDB Sequence Fetcher" target="pdbfetcher" />
<tocitem text="Annotations Menu" target="alwAnnotations" />
<tocitem text="Format Menu" target="alwFormat" />
<tocitem text="Colour Menu" target="alwColour" />
- <tocitem text="Calculation Menu" target="alwCalc" />
+ <tocitem text="Calculate Menu" target="alwCalc" />
<tocitem text="Web Service Menu" target="wsMenu" />
<tocitem text="Annotation Panel Menu" target="annotPanelMenu" />
<tocitem text="Popup Menu" target="popMenu" />
followed by a <em>description</em> for the row, which is shown in a
tooltip when the user mouses over the annotation row's label. Since
Jalview 2.7, the description field may also contain HTML tags (in
- the same way as a <a href="featuresFile.html">sequence feature's</a>
+ the same way as a <a href="featuresFormat.html">sequence feature's</a>
label), providing the text is enclosed in an <html/> tag.
<ul>
<em>Please note: URL links embedded in HTML descriptions are
the bottom of the list is rendered <em>below</em> a feature higher
up in the list.<br> <em><strong>You can change
the order of a feature by dragging it up and down the list with
- the mouse</strong></em>.
+ the mouse (not applet)</strong></em>.
</p>
<p>
The <strong><em>Optimise order</em></strong> button (currently only
<strong>The Groovy Shell</strong>
</p>
<p>
- <a href="http://groovy.codehaus.org/">Groovy</a> is an "<em>agile
+ <a href="http://www.groovy-lang.org/">Groovy</a> is an "<em>agile
and dynamic language for the Java platform</em>". The groovy
scripting language makes it extremely easy to programmatically
interact with Java programs, in much the same way that Javascript is
page.
</p>
<p>
- <strong><em>Getting Groovy...</em> </strong><br> Jalview Groovy
- support is only possible if the core groovy jars which include the
- GroovyShell are present on the CLASSPATH when Jalview is started.
- </p>
- <p>
- The jars are obtained from the <em>embedded</em> directory within
- the <a href="http://dist.codehaus.org/groovy/distributions">groovy
- distribution</a>. The easiest way of adding them to the Jalview
- classpath is to download and build Jalview from its source
- distribution, and then add the groovy-all-*.jar to the lib directory
- whose path is given in the java.ext.dirs property.
- </p>
- <p>
- <strong>Opening Jalview's Groovy Console</strong><br>If groovy
- is available, then the <strong>Tools→Groovy
- Console...</strong> menu entry will be available from the Jalview Desktop's
- drop-down menu. Selecting this will open the <a
- href="http://groovy.codehaus.org/Groovy+Console"
- >Groovy Console</a> which allows you to interactively execute Groovy
+ <strong><em>Getting Groovy...</em> </strong><br> Jalview comes with
+ an embedded installation of Groovy. All you need is to select <strong>Tools→Groovy
+ Console...</strong> menu option from the Jalview Desktop's
+ drop-down menu. After a short pause, you should then see the <a
+ href="http://groovy-lang.org/groovyconsole.html"
+ >Groovy Console</a> appear. This allows you to interactively execute Groovy
scripts within the Jalview run-time environment.
</p>
<p>
--- /dev/null
+<!DOCTYPE html>
+<html>
+<head>
+<meta charset="UTF-8">
+<title>mmCIF File Format</title>
+</head>
+<body>
+ <strong>mmCIF File Format</strong>
+ <p>The mmCIF file format (macromolecular Crystallographic
+ Information) was developed under the auspices of the International Union of Crystallography (IUCr) to extend the Crystallographic Information
+ File (CIF) data representation used for describing small molecule
+ structures and associated diffraction experiments.</p>
+ <strong>Merits of mmCIF file format</strong>
+ <ul>
+ <li>Large structures (containing >62 chains and/or 99999 ATOM
+ records) that cannot be fully represented in the PDB file format are
+ available in the PDB archive as single PDBx/mmCIF files.</li>
+ <li>PDBx/mmCIF file format provides richer data annotation</li>
+ <li>PDBx/mmCIF became the standard PDB archive format in 2014.
+ Since 2016 the PDB File Format is no longer being modified or
+ extended to support new content.
+ </li>
+ </ul>
+
+ <em>mmCIF file format support for importing 3D structure data from
+ flat file and EMBL-PDBe via mmCIF was added in Jalview 2.9.1</em>
+</body>
+</html>
\ No newline at end of file
retrieved by the <a href="seqfetch.html">Sequence Fetcher</a>, and
allows sequence features to be mapped directly from Uniprot das
sources to their coding region on EMBL sequence records.
+ </p>
+ <p>In Jalview 2.9.1 <a href="siftsmapping.html">SIFTS Mapping</a> was added as a better means for explicitly identifying the coordinates corresponding to a displayed sequence when viewing a PDB structure associated with a sequence </p>
</body>
</html>
--- /dev/null
+<!DOCTYPE html>
+<html>
+<head>
+<meta charset="UTF-8">
+<title>SIFTS Mapping</title>
+</head>
+<body>
+
+ <p><strong>SIFTS Mapping</strong></p>
+
+ <p>
+ SIFTS (Structure integration with function, taxonomy
+ and sequences) provides an up-to-date resource for residue-level
+ mapping between Uniprot and PDB entries. The information is updated and
+ released weekly simultaneously with the release of new PDB entries.
+ SIFTS Entries are published as XML files and made publicly available via an FTP
+ site hosted at the European Bioinformatics Institute.
+ </p>
+
+ <p>
+ At the point of viewing a PDB structure, Jalview downloads a SIFTS file
+ for the target entry and uses it to accurately map the sequence residues with the
+ structure residue. Prior to SIFTS integration, Jalview uses Needleman and Wunsch
+ Alignment algorithm to map sequence residues to structure residues, and that may not
+ always result to a correct mapping since it is computational determined.
+ </p>
+
+ <p>
+ The default method for 'Sequence ↔ Structure' mapping can be configured
+ in the Structure tab in the <strong>Tools → Preferences</strong> dialog box. When 'SIFTS'
+ is enabled as the default, all mappings between 'Sequence ↔ Structure' is
+ performed via SIFTS provided that there is a valid SIFTS entry for PDB structure. If no
+ valid SIFTS resource is available, then the 'Sequence ↔ Structure' mapping falls
+ back to Needleman and Wunsch Alignment algorithm.
+ </p>
+
+ <p>To verify the mapping method used, you can view the mapping output via the structure viewer menu <strong>File → View mapping.</strong> A sample mapping output can be seen in the screenshot below. The highlighted position shows the method used. </p>
+ <p>
+ <img src="sifts_mapping_output.png" align="left" alt="SIFTS mapping output" />
+ </p>
+
+ <p><em>SIFTS Mapping integration was added in Jalview 2.9.1</em></p>
+
+</body>
+</html>
\ No newline at end of file
<li>On selecting rows, columns or regions in one alignment, the
corresponding selection is made in the other</li>
<li>Sequence ordering in one alignment (using the cursor, or <strong><a
- href="../calculate/sorting.html"
+ href="../calculations/sorting.html"
>"Calculate→Sort")</a></strong> is also applied to the other
</li>
<li>Editing (gap insertion / deletion) in the protein alignment
panels.</li>
<li>Panel heights are adjusted dragging the divider between
them using the mouse</li>
- <li><a href="menus/alwview.html"><strong>"View→New
+ <li><a href="../menus/alwview.html"><strong>"View→New
View / Expand Views / Gather Views"</strong></a> behave as for a normal
alignment window, but always create new views as Split Frames</li>
</ul>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
+<head>
+<title>UniProtKB query fields</title>
+</head>
+
+<body>
+ <p>
+ <strong>UniProtKB query fields</strong>
+ </p>
+<p>Supported query fields for searching specific data in UniProtKB (see also <a href="text-search">query syntax</a>).</p>
+
+<table border="1" width="95%">
+ <tr>
+ <th>Field</th>
+ <th>Example</th>
+ <th>Description</th>
+ </tr>
+ <tr>
+ <td>accession</td>
+ <td>
+ <code>accession:P62988</code>
+ </td>
+ <td>
+ Lists all entries with the primary or secondary
+ accession number P62988.
+ </td>
+ </tr>
+ <tr>
+ <td>active</td>
+ <td>
+ <code>active:no </code>
+ </td>
+ <td>
+ Lists all obsolete entries.
+ </td>
+ </tr>
+ <tr>
+ <td>annotation</td>
+ <td>
+ <code>
+ annotation:(type:non-positional)
+ <br />
+ annotation:(type:positional)
+ <br />
+ annotation:(type:mod_res "Pyrrolidone carboxylic acid" evidence:experimental)
+ </code>
+ </td>
+ <td>
+ Lists all entries with:
+ <ul>
+ <li>any general annotation (comments [CC])</li>
+ <li>any sequence annotation (features [FT])</li>
+ <li>at least one amino acid modified with a Pyrrolidone carboxylic acid group</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>author</td>
+ <td>
+ <code>
+ author:ashburner
+ </code>
+ </td>
+ <td>
+ Lists all entries with at least one reference co-authored by Michael Ashburner.
+ </td>
+ </tr>
+ <tr>
+ <td>cdantigen</td>
+ <td>
+ <code>
+ cdantigen:CD233
+ </code>
+ </td>
+ <td>
+ Lists all entries whose cluster of differentiation number is CD233.
+ </td>
+ </tr>
+ <tr>
+ <td>citation</td>
+ <td>
+ <code>
+ citation:("intracellular structural proteins")
+ <br />
+ citation:(author:ashburner journal:nature)
+ citation:9169874
+ </code>
+ </td>
+ <td>
+ Lists all entries with a literature citation:
+ <ul>
+ <li>containing the phrase "intracellular structural proteins" in either title or abstract</li>
+ <li>co-authored by Michael Ashburner and published in Nature</li>
+ <li>with the PubMed identifier 9169874</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>cluster</td>
+ <td>
+ <code>
+ cluster:UniRef90_A5YMT3
+ </code>
+ </td>
+ <td>
+ Lists all entries in the UniRef 90% identity cluster whose
+ representative sequence is UniProtKB entry A5YMT3.
+ </td>
+ </tr>
+ <tr>
+ <td>count</td>
+ <td>
+ <code>
+ annotation:(type:transmem count:5)<br />
+ annotation:(type:transmem count:[5 TO *])<br />
+ annotation:(type:cofactor count:[3 TO *])
+ </code>
+ </td>
+ <td>Lists all entries with:
+ <ul>
+ <li>exactly 5 transmembrane regions</li>
+ <li>5 or more transmembrane regions</li>
+ <li>3 or more Cofactor comments</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>created</td>
+ <td>
+ <code>
+ created:[20121001 TO *]<br />
+ reviewed:yes AND created:[current TO *]
+ </code>
+ </td>
+ <td>
+ Lists all entries created since October 1st 2012.<br />
+ Lists all new UniProtKB/Swiss-Prot entries in the last release.
+ </td>
+ </tr>
+ <tr>
+ <td>database</td>
+ <td>
+ <code>
+ database:(type:pfam)
+ <br />
+ database:(type:pdb 1aut)
+ </code>
+ </td>
+ <td>
+ Lists all entries with:
+ <ul>
+ <li>a cross-reference to the Pfam database</li>
+ <li>a cross-reference to the PDB database entry 1aut</li>
+ </ul>
+
+ </td>
+ </tr>
+ <tr>
+ <td>domain</td>
+ <td>
+ <code>
+ domain:VWFA
+ </code>
+ </td>
+ <td>
+ Lists all entries with a Von Willebrand factor type A domain described
+ in the 'Family and Domains' section.
+ </td>
+ </tr>
+ <tr>
+ <td>ec</td>
+ <td>
+ <code>
+ ec:3.2.1.23
+ </code>
+ </td>
+ <td>
+ Lists all beta-galactosidases.
+ </td>
+ </tr>
+ <tr>
+ <td>evidence</td>
+ <td>
+ <code>
+ annotation:(type:signal evidence:ECO_0000269)<br />
+ (type:mod_res phosphoserine evidence:ECO_0000269)<br />
+ annotation:(type:function AND evidence:ECO_0000255)
+ </code>
+ </td>
+ <td>Lists all entries with:
+ <ul>
+ <li>a signal sequence whose positions have been experimentally proven</li>
+ <li>experimentally proven phosphoserine sites</li>
+ <li>a function manually asserted according to rules</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>family</td>
+ <td>
+ <code>
+ family:serpin
+ </code>
+ </td>
+ <td>
+ Lists all entries belonging to the Serpin family of proteins.
+ </td>
+ </tr>
+ <tr>
+ <td>fragment</td>
+ <td>
+ <code>
+ fragment:yes
+ </code>
+ </td>
+ <td>
+ Lists all entries with an incomplete sequence.
+ </td>
+ </tr>
+
+ <tr>
+ <td>gene</td>
+ <td>
+ <code>
+ gene:HSPC233
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins encoded by gene HSPC233.
+ </td>
+ </tr>
+ <tr>
+ <td>go</td>
+ <td>
+ <code>
+ go:cytoskeleton
+ <br />
+ go:0015629
+ </code>
+ </td>
+ <td>
+ Lists all entries associated with:
+ <ul>
+ <li>a GO term containing the word "cytoskeleton"</li>
+ <li>the GO term Actin cytoskeleton and any subclasses</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>host</td>
+ <td>
+ <code>
+ host:mouse
+ <br />
+ host:10090
+ <br />
+ host:40674
+ </code>
+ </td>
+ <td>
+ Lists all entries for viruses infecting:
+ <ul>
+ <li>organisms with a name containing the word "mouse"</li>
+ <li>Mus musculus (Mouse)</li>
+ <li>all mammals (all taxa classified under the taxonomy node for Mammalia)</li>
+ </ul>
+ </td>
+ </tr>
+ <tr>
+ <td>id</td>
+ <td>
+ <code>id:P00750</code>
+ </td>
+ <td>
+ Returns the entry with the primary
+ accession number P00750.
+ </td>
+ </tr>
+ <tr>
+ <td>inn</td>
+ <td>
+ <code>
+ inn:Anakinra
+ </code>
+ </td>
+ <td>
+ Lists all entries whose "International Nonproprietary Name" is Anakinra.
+ </td>
+ </tr>
+ <tr>
+ <td>interactor</td>
+ <td>
+ <code>
+ interactor:P00520
+ </code>
+ </td>
+ <td>
+ Lists all entries describing interactions with the protein described by
+ entry P00520.
+ </td>
+ </tr>
+ <tr>
+ <td>keyword</td>
+ <td>
+ <code>
+ keyword:toxin
+ </code>
+ </td>
+ <td>
+ Lists all entries associated with the keyword Toxin.
+ </td>
+ </tr>
+ <tr>
+ <td>length</td>
+ <td>
+ <code>
+ length:[500 TO 700]
+ </code>
+ </td>
+ <td>
+ Lists all entries describing sequences of length between 500 and 700 residues.
+ </td>
+ </tr>
+ <tr>
+ <td>lineage</td>
+ <td />
+ <td>
+ This field is a synonym for the field <code>taxonomy</code>.
+ </td>
+ </tr>
+ <tr>
+ <td>mass</td>
+ <td>
+ <code>
+ mass:[500000 TO *]
+ </code>
+ </td>
+ <td>
+ Lists all entries describing sequences with a mass of at least 500,000 Da.
+ </td>
+ </tr>
+ <tr>
+ <td>method</td>
+ <td>
+ <code>
+ method:maldi
+ <br />
+ method:xray
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins identified by: matrix-assisted laser
+ desorption/ionization (MALDI), crystallography (X-Ray). The
+ <code>method</code> field searches names of physico-chemical
+ identification methods in the 'Biophysicochemical properties' subsection of the 'Function' section, the 'Publications' and
+ 'Cross-references' sections.
+ </td>
+ </tr>
+ <tr>
+ <td>mnemonic</td>
+ <td>
+ <code>
+ mnemonic:ATP6_HUMAN
+ </code>
+ </td>
+ <td>
+ Lists all entries with entry name (ID) ATP6_HUMAN. Searches also
+ obsolete entry names.
+ </td>
+ </tr>
+ <tr>
+ <td>modified</td>
+ <td>
+ <code>
+ modified:[20120101 TO 20120301]<br />
+ reviewed:yes AND modified:[current TO *]
+ </code>
+ </td>
+ <td>
+ Lists all entries that were last modified between January and March 2012.<br />
+ Lists all UniProtKB/Swiss-Prot entries modified in the last release.
+ </td>
+ </tr>
+ <tr>
+ <td>name</td>
+ <td>
+ <code>
+ name:"prion protein"
+ </code>
+ </td>
+ <td>
+ Lists all entries for prion proteins.
+ </td>
+ </tr>
+ <tr>
+ <td>organelle</td>
+ <td>
+ <code>
+ organelle:Mitochondrion
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins encoded by a gene of the mitochondrial
+ chromosome.
+ </td>
+ </tr>
+ <tr>
+ <td>organism</td>
+ <td>
+ <code>
+ organism:"Ovis aries"
+ <br />
+ organism:9940
+ <br />
+ organism:sheep
+ <br />
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins expressed in sheep (first 2 examples) and
+ organisms whose name contains the term "sheep".
+ </td>
+ </tr>
+
+ <tr>
+ <td>plasmid</td>
+ <td>
+ <code>
+ plasmid:ColE1
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins encoded by a gene of plasmid ColE1.
+ </td>
+ </tr>
+ <tr>
+ <td>proteome</td>
+ <td>
+ <code>
+ proteome:UP000005640
+ </code>
+ </td>
+ <td>
+ Lists all entries from the human proteome.
+ </td>
+ </tr>
+ <tr>
+ <td>proteomecomponent</td>
+ <td>
+ <code>
+ proteomecomponent:"chromosome 1" and organism:9606
+ </code>
+ </td>
+ <td>
+ Lists all entries from the human chromosome 1.
+ </td>
+ </tr>
+ <tr>
+ <td>replaces</td>
+ <td>
+ <code>
+ replaces:P02023
+ </code>
+ </td>
+ <td>
+ Lists all entries that were created from a merge with entry P02023.
+ </td>
+ </tr>
+ <tr>
+ <td>reviewed</td>
+ <td>
+ <code>
+ reviewed:yes
+ </code>
+ </td>
+ <td>
+ Lists all UniProtKB/Swiss-Prot entries.
+ </td>
+ </tr>
+ <tr>
+ <td>scope</td>
+ <td>
+ <code>
+ scope:mutagenesis
+ </code>
+ </td>
+ <td>
+ Lists all entries containing a reference that was used to gather
+ information about mutagenesis.
+ </td>
+ </tr>
+ <tr>
+ <td>sequence</td>
+ <td>
+ <code>
+ sequence:P05067-9
+ </code>
+ </td>
+ <td>
+ Lists all entries containing a link to isoform 9 of the sequence
+ described in entry P05067. Allows searching by specific sequence
+ identifier.
+ </td>
+ </tr>
+ <tr>
+ <td>sequence_modified</td>
+ <td>
+ <code>
+ sequence_modified:[20120101 TO 20120301]<br />
+ reviewed:yes AND sequence_modified:[current TO *]
+ </code>
+ </td>
+ <td>
+ Lists all entries whose sequences were last modified between January and March 2012.<br />
+ Lists all UniProtKB/Swiss-Prot entries whose sequences were modified in the last release.
+ </td>
+ </tr>
+ <tr>
+ <td>source</td>
+ <td>
+ <code>
+ source:intact
+ </code>
+ </td>
+ <td>
+ Lists all entries containing a GO term whose annotation source is the
+ IntAct database.
+ </td>
+ </tr>
+ <tr>
+ <td>strain</td>
+ <td>
+ <code>
+ strain:wistar
+ </code>
+ </td>
+ <td>
+ Lists all entries containing a reference relevant to strain wistar.
+ </td>
+ </tr>
+ <tr>
+ <td>taxonomy</td>
+ <td>
+ <code>
+ taxonomy:40674
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins expressed in Mammals. This field is used to retrieve
+ entries for all organisms classified below a given taxonomic node taxonomy classification).
+ </td>
+ </tr>
+ <tr>
+ <td>tissue</td>
+ <td>
+ <code>
+ tissue:liver
+ </code>
+ </td>
+ <td>
+ Lists all entries containing a reference describing the protein sequence
+ obtained from a clone isolated from liver.
+ </td>
+ </tr>
+ <tr>
+ <td>web</td>
+ <td>
+ <code>
+ web:wikipedia
+ </code>
+ </td>
+ <td>
+ Lists all entries for proteins that are described in Wikipedia.
+ </td>
+ </tr>
+</table>
+
+</body>
+</html>
\ No newline at end of file
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
+<head>
+<title>The Uniprot Free Text Search Interface</title>
+</head>
+<body>
+
+ <strong>The Uniprot Free Text Search Interface</strong>
+ <p>
+ Jalview provides a specialised interface that allows fast and
+ efficient discovery and retrieval of data from the Uniprot database.
+ It allows
+ interactive querying of Uniprot metadata with free text and structured
+ queries, so sequences can be located without prior knowledge of
+ their database accessions, or <em>via</em> manual cross-referencing
+ from Uniprot or other bioinformatics websites.
+ </p>
+ <p>
+ To open the UniProt Sequence Fetcher, select UniProt as the database from
+ any <a href="seqfetch.html">Sequence Fetcher</a> dialog (opened <em>via</em>
+ <strong>"File →Fetch Sequences"</strong>).
+ </p>
+ <p>
+ <img src="uniprotseqfetcher.png" align="left"
+ alt="Uniprot sequence fetcher (introduced in Jalview 2.9.1)"
+ />
+ </p>
+
+ <p>
+ <strong>Searching the Uniprot Database</strong>
+ </p>
+ <p>
+ To search the Uniprot, begin typing in the text box. The results of your
+ query are shown in the search results tab, which queries Uniprot after 1.5secs every time
+ you type in the search text box. You can sort results according to
+ the displayed columns, and select entries with the mouse or
+ keyboard. Once you have selected one or more entries, hit the <strong>OK</strong>
+ button to retrieve and visualise the sequences in Jalview Alignment interface.
+ </p>
+ <ul>
+ <li><strong>Searching a specific Uniprot field </strong> If you
+ want to find sequences based on a specific Uniprot metadata field,
+ you can select it from the drop-down menu.</li>
+
+
+ <li><strong>Bulk Uniprot retrieval</strong><br>
+ Firstly, switch the search target to Uniprot Id, then enter multiple IDs by separating them with a semi-colon.
+ e.g. fila_human; mnt_human; mnt_mouse<br />Hitting Return or OK will automatically
+ fetch those IDs, like the default Sequence Fetcher interface.</li>
+
+ <li><strong>Advanced / Custom querying</strong>
+ The table below provides a brief overview of the supported Uniprot query syntax (see <a href="uniprotqueryfields.html">query fields for UniProtKB</a>):
+ <table border="1" width="95%">
+ <tr>
+ <td><code>human antigen</code></td>
+ <td rowspan="3">All entries containing both terms.</td>
+ </tr>
+ <tr>
+ <td><code>human AND antigen</code></td>
+ </tr>
+ <tr>
+ <td><code>human && antigen</code></td>
+ </tr>
+ <tr>
+ <td><code>"human antigen"</code></td>
+ <td>All entries containing both terms in the exact order.</td>
+ </tr>
+ <tr>
+ <td><code>human -antigen</code></td>
+ <td rowspan="3">All entries containing the term <code>human</code>
+ but not <code>antigen</code>.
+ </td>
+ </tr>
+ <tr>
+ <td><code>human NOT antigen</code></td>
+ </tr>
+ <tr>
+ <td><code>human ! antigen</code></td>
+ </tr>
+ <tr>
+ <td><code>human OR mouse</code></td>
+ <td rowspan="2">All entries containing either term.</td>
+ </tr>
+ <tr>
+ <td><code>human || mouse</code></td>
+ </tr>
+ <tr>
+ <td><code>antigen AND (human OR mouse)</code></td>
+ <td>Using parentheses to override boolean precedence rules.</td>
+ </tr>
+ <tr>
+ <td><code>anti*</code></td>
+ <td>All entries containing terms starting with <code>anti</code>.
+ Asterisks can also be used at the beginning and within terms. <strong>Note:</strong>
+ Terms starting with an asterisk or a single letter followed by an
+ asterisk can slow down queries considerably.
+ </td>
+ </tr>
+ <tr>
+ <td><code> author:Tiger*</code></td>
+ <td>Citations that have an author whose name starts with <code>Tiger</code>.
+ To search in a specific field of a dataset, you must prefix your
+ search term with the field name and a colon. To discover what
+ fields can be queried explicitly, observe the query hints that are
+ shown after submitting a query or use the query builder (see
+ below).
+ </td>
+ </tr>
+ <tr>
+ <td><code>length:[100 TO *]</code></td>
+ <td>All entries with a sequence of at least 100 amino acids.</td>
+ </tr>
+ <tr>
+ <td><code>citation:(author:Arai author:Chung)</code></td>
+ <td>All entries with a publication that was coauthored by two
+ specific authors.</td>
+ </tr>
+ </table>
+ </li>
+</ul>
+ <p>
+ <strong>Result pagination</strong>
+ </p>
+ The query results returned from the Uniprot server are paginated for performance optimisation.
+ The button labelled <strong>' << '</strong> and <strong>' >> '</strong> can be used to navigate to the next or previous result page respectively.
+ The page range is shown on the title bar of the Free Text Search interface. Jalview's pagination implementation supports multiple selection of entries across multiple pages.
+
+
+ <p>
+ <strong>Customising The Uniprot Sequence Fetcher</strong>
+ </p>
+ <p>
+ To change the displayed meta-data in the search result, click the
+ 'Customise Displayed Options' tab, and select the fields you'd like
+ to displayed or remove.
+ </p>
+ <p>
+ <em>The Uniprot Free Test Search Interface was introduced in
+ Jalview 2.9.1</em>
+ </p>
+</body>
+</html>
\ No newline at end of file
</p>
<p>
+ <strong>Importing PDB Entries or files in mmCIF format</strong><br>
+ <a href="mmcif.html">mmCIF file format</a> provides an alternative means for
+ importing 3D structure data from flat file and EMBL-PDBe
+ web-service. To enable mmCIF as the default format for
+ importing PBD sequences from the PDB sequence fetcher, add or modify the
+ property
+ <code>DEFAULT_STRUCTURE_FORMAT=mmCIF</code> in Jalview properties file.
+ Once this is done, the steps followed in retrieving PDB format files above can
+ be followed to obtain the same data with mmCIF. <em>mmCIF format file support was added in Jalview 2.9.1.</em></p>
+
+
+
+ <p>
<strong>Associating a large number of PDB files to
sequences in an alignment</strong><br /> It is often the case when working
with structure alignments that you will have a directory of PDB
<td>Both</td>
<td>Cuts the (fully) selected sequences from the alignment. <!-- not yet in this version
This will not happen if only some
-columns are selected, you should use the <a href="features/regionHiding.html">Hide Regions feature</a> instead.-->
+columns are selected, you should use the <a href="features/hiddenRegions.html">Hide Regions feature</a> instead.-->
</td>
</tr>
<tr>
action on the whole alignment, or selected rows, columns, or
regions.
</em> <br></li>
+ <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+ <em>These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
+ of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
+ perform 'Reverse Complement' followed by 'Translate as cDNA':
+ <br><small>
+ Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
+ </em> <br></li>
<li><strong>Get Cross-References</strong> (not applet)<br>
<em>This option is visible where sequences have
cross-references to other standard databases; for example, an
dialog box.
</em></li>
<li><strong>Groovy Console...<em> (only
- available if groovy is on the classpath)</em><br></strong> <em>Open's
- the <a href="../groovy.html">Groovy Console</a> for
+ available if groovy is on the classpath)</em><br></strong> <em>Opens
+ the <a href="../features/groovy.html">Groovy Console</a> for
interactive scripting.
</em><strong><br></strong></li>
and sequence description to be entered. Press OK to accept
your edit. To save sequence descriptions, you must save in
Fasta, PIR or Jalview File format.</em></li>
- <li><a href="sqaddrefannot"><strong>Add
- Reference Annotations<br>
- </strong><em>When enabled, copies any available alignment
+ <li><strong>Add <a href="../features/annotation.html#seqannots">Reference Annotations</a></strong><br>
+ <em>When enabled, copies any available alignment
annotation for this sequence to the current view.</em></li>
<li><strong>Set as Reference</strong> or <strong>Unmark
as Reference</strong><br /> Sets or unsets the reference sequence for
<tr>
<td width="60" nowrap>
<div align="center">
- <strong><a name="Jalview.2.9.0b2">2.9.0b2</a><br />
- <em>16/10/2015</em></strong>
+ <strong><a name="Jalview.2.9.1">2.9.1</a><br /> <em>1/6/2016</em></strong>
</div>
</td>
+ <td><em>General</em>
+ <ul>
+ <li></li>
+ </ul> <em>Application</em>
+ <ul>
+ <li></li>
+ </ul> <em>Applet</em>
+ <ul>
+ <li></li>
+ </ul></td>
<td>
- <em>General</em>
- <ul>
- <li>Time stamps for signed Jalview application and applet jars</li>
- </ul>
+ <div align="left">
+ <em>General</em>
+ <ul>
+ <li></li>
+ </ul>
+ <em>Application</em>
+ <ul>
+ <li></li>
+ </ul>
+ <em>Applet</em>
+ <ul>
+ <li></li>
+ </ul>
+ </div>
+ </td>
+ </tr>
+ <tr>
+ <td width="60" nowrap>
+ <div align="center">
+ <strong><a name="Jalview.2.9.0b2">2.9.0b2</a><br />
+ <em>16/10/2015</em></strong>
+ </div>
</td>
+ <td><em>General</em>
+ <ul>
+ <li>Time stamps for signed Jalview application and applet
+ jars</li>
+ </ul></td>
<td>
<div align="left">
- <em>Application</em><ul>
- <li>Duplicate group consensus and conservation rows shown when tree is partitioned</li>
- <li>Erratic behaviour when tree partitions made with multiple cDNA/Protein split views</li>
- </ul>
+ <em>Application</em>
+ <ul>
+ <li>Duplicate group consensus and conservation rows
+ shown when tree is partitioned</li>
+ <li>Erratic behaviour when tree partitions made with
+ multiple cDNA/Protein split views</li>
+ </ul>
</div>
</td>
</tr>
<em>8/10/2015</em></strong>
</div>
</td>
- <td>
- <em>General</em>
+ <td><em>General</em>
+ <ul>
+ <li>Updated Spanish translations of localized text for
+ 2.9</li>
+ </ul> <em>Application</em>
<ul>
- <li>Updated Spanish translations of localized text for 2.9</li>
- </ul>
- <em>Application</em><ul>
- <!-- <li>cDNA/Protein splitframe window geometry preserved in Jalview projects</li>-->
- <li>Signed OSX InstallAnywhere installer<br></li>
- <li>Support for per-sequence based annotations in BioJSON</li></ul>
- <em>Applet</em>
- <ul><li>Split frame example added to applet examples page</li>
- </ul>
- </td>
+ <!-- <li>cDNA/Protein splitframe window geometry preserved in Jalview projects</li>-->
+ <li>Signed OSX InstallAnywhere installer<br></li>
+ <li>Support for per-sequence based annotations in BioJSON</li>
+ </ul> <em>Applet</em>
+ <ul>
+ <li>Split frame example added to applet examples page</li>
+ </ul></td>
<td>
<div align="left">
- <em>General</em>
+ <em>General</em>
<ul>
- <li>Mapping of cDNA to protein in split frames incorrect when sequence start > 1</li>
- <li>Broken images in filter column by annotation dialog documentation</li>
+ <li>Mapping of cDNA to protein in split frames
+ incorrect when sequence start > 1</li>
+ <li>Broken images in filter column by annotation dialog
+ documentation</li>
<li>Feature colours not parsed from features file</li>
- <li>Exceptions and incomplete link URLs recovered when loading a features file containing HTML tags in feature description</li>
-
+ <li>Exceptions and incomplete link URLs recovered when
+ loading a features file containing HTML tags in feature
+ description</li>
+
</ul>
- <em>Application</em><ul>
- <li>Annotations corrupted after BioJS export and reimport</li>
- <li>Incorrect sequence limits after Fetch DB References with 'trim retrieved sequences'</li>
- <li>Incorrect warning about deleting all data when deleting selected columns</li>
- <li>Patch to build system for shipping properly signed JNLP templates for webstart launch</li>
- <li>EMBL-PDBe fetcher/viewer dialogs do not offer unreleased structures for download or viewing</li>
- <li>Tab/space/return keystroke operation of EMBL-PDBe fetcher/viewer dialogs works correctly</li>
- <li>Disabled 'minimise' button on Jalview windows running on OSX to workaround redraw hang bug</li>
- <li>Split cDNA/Protein view position and geometry not recovered from jalview project</li>
- <li>Initial enabled/disabled state of annotation menu sorter 'show autocalculated first/last' corresponds to alignment view</li>
- <li>Restoring of Clustal, RNA Helices and T-Coffee color schemes from BioJSON</li>
- </ul>
- <em>Applet</em><ul>
- <li>Reorder sequences mirrored in cDNA/Protein split frame</li>
+ <em>Application</em>
+ <ul>
+ <li>Annotations corrupted after BioJS export and
+ reimport</li>
+ <li>Incorrect sequence limits after Fetch DB References
+ with 'trim retrieved sequences'</li>
+ <li>Incorrect warning about deleting all data when
+ deleting selected columns</li>
+ <li>Patch to build system for shipping properly signed
+ JNLP templates for webstart launch</li>
+ <li>EMBL-PDBe fetcher/viewer dialogs do not offer
+ unreleased structures for download or viewing</li>
+ <li>Tab/space/return keystroke operation of EMBL-PDBe
+ fetcher/viewer dialogs works correctly</li>
+ <li>Disabled 'minimise' button on Jalview windows
+ running on OSX to workaround redraw hang bug</li>
+ <li>Split cDNA/Protein view position and geometry not
+ recovered from jalview project</li>
+ <li>Initial enabled/disabled state of annotation menu
+ sorter 'show autocalculated first/last' corresponds to
+ alignment view</li>
+ <li>Restoring of Clustal, RNA Helices and T-Coffee
+ color schemes from BioJSON</li>
+ </ul>
+ <em>Applet</em>
+ <ul>
+ <li>Reorder sequences mirrored in cDNA/Protein split
+ frame</li>
<li>Applet with Jmol examples not loading correctly</li>
- </ul>
+ </ul>
</div>
</td>
</tr>
<tr>
<td><div align="center">
<strong><a name="Jalview.2.8.0b1">2.8.0b1</a><br />
- <em>30/1/2014</em></strong>
+ <em>30/1/2014</em></strong>
</div></td>
<td>
<ul>
<ul>
<li>URL links generated from description line for
regular-expression based URL links (applet and application)
+
<li>Non-positional feature URL links are shown in link
menu</li>
between different screens.</li>
<li>New preference items for sequence ID tooltip and
consensus annotation</li>
- <li>Client to submit sequences and IDs to <a
- href="webServices/index.html#envision2">Envision2</a>
- Workflows
- </li>
+ <li>Client to submit sequences and IDs to Envision2 Workflows</li>
<li><em>Vamsas Capabilities</em>
<ul>
<li>Improved VAMSAS synchronization (Jalview archive
<li>Cancel button for DAS Feature Fetching
<li>PCA and PDB Viewers zoom via mouse roller
<li>User-defined sub-tree colours and sub-tree selection
+
<li>'New Window' button on the 'Output to Text box'
</ul>
<li>Fixed Remove Empty Columns Bug (empty columns at end
of alignment)
<li>Slowed DAS Feature Fetching for increased robustness.
+
<li>Made angle brackets in ASCII feature descriptions
display correctly
<li>WsDbFetch query/result association resolved
<li>Tree leaf to sequence mapping improved
<li>Smooth fonts switch moved to FontChooser dialog box.
+
</ul>
</td>
Function, and Genetics</em> 43(2): 227-241. <a
href="http://www.ncbi.nlm.nih.gov/pubmed/12112692"
>PubMed</a> or available on the <a
- href="http://www.well.ox.ac.uk/~valdar/publications.html"
+ href="http://valdarlab.unc.edu/publications.html"
>Valdar Group publications page</a>), but the SMERFs score was
developed later and described by Manning et al. in 2008 (<a
href="http://www.biomedcentral.com/1471-2105/9/51"
>REST</a> web services exposing sequence alignment, analysis, and
secondary structure prediction programs. Originally, Jalview 2's
services were maintained by the Barton group at the University of
- Dundee, and ran programs on the Life Sciences High-performace
+ Dundee, and ran programs on the Life Sciences High-performance
Computing Cluster. With the advent of <a
href="http://www.compbio.dundee.ac.uk/JABAWS"
>JABAWS</a>, however, it is possible for anyone to host Jalview web
from the input</li>
<li><em>realignment</em> - where any aligned sequences will be
used by the service to construct a profile based alignment of the
- remaining unaligned sequences.</li>
+ remaining unaligned sequences</li>
</ul>
<strong>JABAWS Alignment services</strong>
<br> Most alignment services are provided by the
<a href="JABAWS.html">JABAWS framework</a>, which allows you to
customise the precise parameters used when running each alignment
- prgoram. In addition to the 'Default settings', you may choose from a
+ program. In addition to the 'Default settings', you may choose from a
range of alignment preset settings, or create your own using the
<a href="webServicesParams.html">'Edit Settings And Run ..' dialog
box</a>.
<ul>
<li><a href="http://www.clustal.org/">Clustal Omega and
Clustal W</a> (version 2.0.12)</li>
- <li><a href="http://align.bmr.kyushu-u.ac.jp/mafft/software/">Mafft</a>
+ <li><a href="http://mafft.cbrc.jp/alignment/software/">Mafft</a>
(version 6.8.57b)</li>
<li><a href="http://www.drive5.com/muscle">Muscle</a> (version
3.8.31)</li>
<em>Please Note:
<ul>
<li>The regular expressions supported by Jalview are those
- provided by the <a href="www.javaregex.com">Stevesoft
+ provided by the <a href="http://www.javaregex.com">Stevesoft
javaregex package</a>.
</li>
<li>Some characters must be escaped when specifying them as
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+pdb_data_columns
+#
+_group.id
+_group.name
+_group.sort_order
+g1;Quality Measures;1
+g2;Cross References;2
+g3;Names & Taxonomy;3
+g4;Procedures & Software;4
+g5;Date Of;5
+g6;Miscellenous;6
+#
+_data_column.primary_key;pdb_id
+_data_column.default_response_page_size;100
+#
+_data_column.name
+_data_column.code
+_data_column.group_id
+_data_column.data_type | _data_column.isFormated | _data_column.significantDigit
+_data_column.min_col_width
+_data_column.max_col_width
+_data_column.preferred_col_width
+_data_column.is_shown_by_default
+_data_column.is_searchable
+PDB Id;pdb_id;String;g2;40;60;45;true;true
+Title;title;String;g6;300;1500;400;true;false
+Molecule;molecule_name;String;g3;50;400;95;false;true
+Molecule Type;molecule_type;String;g3;50;400;95;false;true
+Sequence;molecule_sequence;String;g6;50;400;95;false;false
+PFAM Accession;pfam_accession;String;g2;50;400;95;false;true
+PFAM Name;pfam_name;String;g3;50;400;95;false;true
+InterPro Name;interpro_name;String;g3;50;400;95;false;false
+InterPro Accession;interpro_accession;String;g2;50;400;95;false;false
+UniProt Id;uniprot_id;String;g2;50;400;95;false;true
+UniProt Accession;uniprot_accession;String;g2;50;400;95;false;false
+UniProt Coverage;uniprot_coverage;String;g6;50;400;95;false;false
+Uniprot Features;uniprot_features;String;g6;50;400;95;false;false
+R Factor;r_factor;Double|T|3;g1;50;150;85;false;false
+Experimental Method;experimental_method;String;g4;50;400;105;true;false
+Resolution;resolution;Double|T|3;g1;50;150;85;true;false
+Data Quality;data_quality;Double|T|2;g1;50;150;85;false;false
+Overall Quality;overall_quality;Double|T|1;g1;50;150;85;false;false
+Number of Polymers;number_of_polymers;int;g6;50;400;95;false;false
+Number of Protein Chains;number_of_protein_chains;int;g6;50;400;95;false;false
+Number of Bound Molecule;number_of_bound_molecules;int;g6;50;400;95;false;false
+Number of Polymer Residue;number_of_polymer_residues;int;g6;50;400;95;false;false
+GENUS;genus;String;g3;50;400;95;false;true
+Gene Name;gene_name;String;g3;50;400;95;false;true
+GO Id;go_id;String;g2;50;400;95;false;false
+Assembly Id;assembly_id;String;g2;50;400;95;false;false
+Assembly Form;assembly_form;String;g6;50;400;95;false;false
+Assembly Type;assembly_type;String;g6;50;400;95;false;false
+Space Group;spacegroup;String;g6;50;400;95;false;false
+Cath Code;cath_code;String;g2;50;400;95;false;false
+Tax Id;tax_id;String;g2;50;400;95;false;false
+Tax Query;tax_query;String;g2;50;400;95;false;false
+Interacting Entity Id;interacting_entity_id;String;g2;50;400;95;false;false
+Interacting Molecules;interacting_molecules;String;g6;50;400;95;false;false
+Pubmed Id;pubmed_id;int;g2;50;400;95;false;false
+Status;status;String;g6;50;400;95;false;false
+Model Quality;model_quality;Double|T|2;g1;50;150;85;false;false
+Pivot Resolution;pivot_resolution;Double|T|3;g1;50;150;85;false;false
+Data reduction software;data_reduction_software;String;g4;50;400;95;false;false
+Max observed residues;max_observed_residues;String;g6;50;400;95;false;false
+Organism scientific name;organism_scientific_name;String;g3;50;400;95;false;false
+Super kingdom;superkingdom;String;g3;50;400;95;false;false
+Rank;rank;String;g3;50;400;95;false;false
+Crystallisation Ph;crystallisation_ph;String;g6;50;400;95;false;false
+Biological Function;biological_function;String;g6;50;400;95;false;false
+Biological Process;biological_process;String;g6;50;400;95;false;false
+Biological Cell Component;biological_cell_component;String;g6;50;400;95;false;false
+Compound Name;compound_name;String;g3;50;400;95;false;false
+Compound Id;compound_id;String;g2;50;400;95;false;false
+Compound Weight;compound_weight;String;g6;50;400;95;false;false
+Compound Systematic Name;compound_systematic_name;String;g3;50;400;95;false;false
+Interacting Ligands;interacting_ligands;String;g6;50;400;95;false;false
+Journal;journal;String;g6;50;400;95;false;false
+All Authors;all_authors;String;g6;50;400;95;false;false
+Experiment Data Available;experiment_data_available;String;g6;50;400;95;false;false
+Diffraction Protocol;diffraction_protocol;String;g4;50;400;95;false;false
+Refinement Software;refinement_software;String;g4;50;400;95;false;false
+Structure Determination Method;structure_determination_method;String;g4;50;400;95;false;false
+Synchrotron Site;synchrotron_site;String;g6;50;400;95;false;false
+Sample Preparation Method;sample_preparation_method;String;g4;50;400;95;false;false
+Entry Authors;entry_authors;String;g6;50;400;95;false;false
+Citation Title;citation_title;String;g6;50;400;95;false;false
+Structure Solution Software;structure_solution_software;String;g4;50;400;95;false;false
+Entry Entity;entry_entity;String;g6;50;400;95;false;false
+R Free;r_free;Double|T|3;g1;50;150;85;false;false
+Number of Polymer Entities;number_of_polymer_entities;int;g6;50;400;95;false;false
+Number of Bound Entities;number_of_bound_entities;int;g6;50;400;95;false;false
+Crystallisation Reservoir;crystallisation_reservoir;String;g6;50;400;95;false;false
+Data Scalling Software;data_scaling_software;String;g4;50;400;95;false;false
+Detector;detector;String;g6;50;400;95;false;false
+Detector Type;detector_type;String;g6;50;400;95;false;false
+Modified Residue Flag;modified_residue_flag;String;g6;50;400;95;false;false
+Number of Copies;number_of_copies;int;g6;50;400;95;false;false
+Struc Asym Id;struct_asym_id;String;g2;50;400;95;false;false
+Homologus PDB Entity Id;homologus_pdb_entity_id;String;g2;50;400;95;false;false
+Molecule Synonym;molecule_synonym;String;g6;50;400;95;false;false
+Deposition Site;deposition_site;String;g6;50;400;95;false;false
+Synchrotron Beamline;synchrotron_beamline;String;g6;50;400;95;false;false
+Entity Id; entity_id;String;g2;50;400;95;false;false
+Beam Source Name;beam_source_name;String;g3;50;400;95;false;false
+Processing Site;processing_site;String;g6;50;400;95;false;false
+Entity Weight;entity_weight;Double|T|0;g6;50;400;95;false;false
+Version;_version_;Double|F|0;g6;50;400;95;false;false
+ALL;text;String;g6;50;400;95;false;true
+#
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+uniprot_data_columns
+#
+_group.id
+_group.name
+_group.sort_order
+g1;Quality Measures;3
+g2;Cross References;2
+g3;Names & Taxonomy;1
+g4;Procedures & Softwares;4
+g5;Date Of;5
+g6;Miscellenous;6
+g7;Sequences;7
+g8;Function;8
+g9;Interaction;9
+g10;Expression;10
+g11;Gene Ontology;11
+g12;Pathology & Biotech;12
+g13;Subcellular location;13
+g14;PTM / Processing;14
+g15;Structure;15
+g16;Publications;16
+g17;Date of;17
+g18;Family & Domain;18
+#
+_data_column.primary_key;id
+_data_column.default_response_page_size;500
+#
+_data_column.name
+_data_column.code|_data_column.alt_code (optional: used for specifying search code when different from original code)
+_data_column.group_id
+_data_column.data_type
+_data_column.min_col_width
+_data_column.max_col_width
+_data_column.preferred_col_width
+_data_column.is_shown_by_default
+_data_column.is_searchable
+Uniprot Id;id;String;g3;80;150;85;true;true
+Entry Name;entry name|mnemonic;String;g3;100;150;105;true;true
+Protein names;protein names|name;String;g3;300;1500;500;true;true
+Gene Names;genes|gene;String;g3;100;1000;145;true;true
+Organism;organism;String;g3;100;1000;200;true;true
+Organism ID;organism-id;int;g3;60;100;80;false;false
+Proteomes;proteome;String;g3;50;1000;95;false;false
+Taxonomic lineage (ALL);lineage(ALL)|taxonomy;String;g3;50;400;95;false;false
+Virus hosts;virus hosts|host;String;g3;50;1000;95;false;true
+Fragment;fragment;String;g7;50;1000;95;false;false
+Gene encoded by;encodedon;String;g7;50;1000;95;false;false
+Alternative products (isoforms);comment(ALTERNATIVE PRODUCTS);String;g7;50;1000;95;false;false
+Erroneous gene model prediction;comment(ERRONEOUS GENE MODEL PREDICTION);String;g7;50;1000;95;false;false
+Erroneous initiation;comment(ERRONEOUS INITIATION);String;g7;50;1000;95;false;false
+Erroneous translation;comment(ERRONEOUS TRANSLATION);String;g7;50;1000;95;false;false
+Frameshift;comment(FRAMESHIFT);String;g7;50;1000;95;false;false
+Mass spectrometry;comment(MASS SPECTROMETRY);String;g7;50;1000;95;false;false
+Polymorphism;comment(POLYMORPHISM);String;g7;50;1000;95;false;false
+RNA editing;comment(RNA EDITING);String;g7;50;1000;95;false;false
+Sequence caution;comment(SEQUENCE CAUTION);String;g7;50;1000;95;false;false
+Status;reviewed;String;g6;50;100;95;true;true
+Length;length;int|T|0;g7;50;100;65;true;true
+Mass;mass;String;g7;50;100;80;false;true
+Sequence;sequence;String;g7;50;1000;95;false;false
+Alternative sequence;feature(ALTERNATIVE SEQUENCE);String;g7;50;1000;95;false;false
+Natural variant;feature(NATURAL VARIANT);String;g7;50;1000;95;false;false
+Non-adjacent residues;feature(NON ADJACENT RESIDUES);String;g7;50;1000;95;false;false
+Non-standard residue;feature(NON STANDARD RESIDUE);String;g7;50;1000;95;false;false
+Non-terminal residue;feature(NON TERMINAL RESIDUE);String;g7;50;1000;95;false;false
+Sequence conflict;feature(SEQUENCE CONFLICT);String;g7;50;1000;95;false;false
+Sequence uncertainty;feature(SEQUENCE UNCERTAINTY);String;g7;50;1000;95;false;false
+Version (Sequence);version(sequence);String;g7;50;1000;95;false;false
+EC number;ec;String;g8;50;1000;95;false;true
+Absorption;comment(ABSORPTION);String;g8;50;1000;95;false;false
+Catalytic activity;comment(CATALYTIC ACTIVITY);String;g8;50;1000;95;false;false
+Cofactor;comment(COFACTOR);String;g8;50;1000;95;false;false
+Enzyme regulation;comment(ENZYME REGULATION);String;g8;50;1000;95;false;false
+Function [CC];comment(FUNCTION);String;g8;50;1000;95;false;false
+Kinetics;comment(KINETICS);String;g8;50;1000;95;false;false
+Pathway;comment(PATHWAY);String;g8;50;1000;95;false;false
+Redox potential;comment(REDOX POTENTIAL);String;g8;50;1000;95;false;false
+Temperature dependence;comment(TEMPERATURE DEPENDENCE);String;g8;50;1000;95;false;false
+pH dependence;comment(PH DEPENDENCE);String;g8;50;1000;95;false;false
+Active site;feature(ACTIVE SITE);String;g8;50;1000;95;false;false
+Binding site;feature(BINDING SITE);String;g8;50;1000;95;false;false
+DNA binding;feature(DNA BINDING);String;g8;50;1000;95;false;false
+Metal binding;feature(METAL BINDING);String;g8;50;1000;95;false;false
+Nucleotide binding;feature(NP BIND);String;g8;50;1000;95;false;false
+Site;feature(SITE);String;g8;50;1000;95;false;false
+Annotation;annotation score;String;g6;50;1000;95;false;false
+Features;features;String;g6;50;1000;95;false;false
+Caution;comment(CAUTION);String;g6;50;1000;95;false;false
+Miscellaneous [CC];comment(GENERAL);String;g6;50;1000;95;false;false
+Keywords;keywords|keyword;String;g6;50;1000;95;false;true
+Protein existence;existence;String;g6;50;1000;95;false;true
+ALL;Search All;String;g7;50;1000;95;false;true;
+Subunit structure [CC];comment(SUBUNIT);String;g9;50;1000;95;false;false
+Interacts with;interactor;String;g9;50;1000;95;false;false
+Developmental stage;comment(DEVELOPMENTAL STAGE);String;g10;50;1000;95;false;false
+Induction;comment(INDUCTION);String;g10;50;1000;95;false;false
+Tissue specificity;comment(TISSUE SPECIFICITY);String;g10;50;1000;95;false;false
+Gene ontology (GO);go;String;g11;50;1000;95;false;true
+Gene ontology (biological process);go(biological process);String;g11;50;1000;95;false;false
+Gene ontology (molecular function);go(molecular function);String;g11;50;1000;95;false;false
+Gene ontology (cellular component);go(cellular component);String;g11;50;1000;95;false;false
+Gene ontology IDs;go-id;String;g11;50;1000;95;false;true
+Allergenic properties;comment(ALLERGEN);String;g12;50;1000;95;false;false
+Biotechnological use;comment(BIOTECHNOLOGY);String;g12;50;1000;95;false;false
+Disruption phenotype;comment(DISRUPTION PHENOTYPE);String;g12;50;1000;95;false;false
+Involvement in disease;comment(DISEASE);String;g12;50;1000;95;false;false
+Pharmaceutical use;comment(PHARMACEUTICAL);String;g12;50;1000;95;false;false
+Toxic dose;comment(TOXIC DOSE);String;g12;50;1000;95;false;false
+Subcellular location [CC];comment(SUBCELLULAR LOCATION);String;g13;50;1000;95;false;false
+Intramembrane;feature(INTRAMEMBRANE);String;g13;50;1000;95;false;false
+Topological domain;feature(TOPOLOGICAL DOMAIN);String;g13;50;1000;95;false;false
+Transmembrane;feature(TRANSMEMBRANE);String;g13;50;1000;95;false;false
+Post-translational modification;comment(PTM);String;g14;50;1000;95;false;false
+Chain;feature(CHAIN);String;g14;50;1000;95;false;false
+Cross-link;feature(CROSS LINK);String;g14;50;1000;95;false;false
+Disulfide bond;feature(DISULFIDE BOND);String;g14;50;1000;95;false;false
+Glycosylation;feature(GLYCOSYLATION);String;g14;50;1000;95;false;false
+Initiator methionine;feature(INITIATOR METHIONINE);String;g14;50;1000;95;false;false
+Lipidation;feature(LIPIDATION);String;g14;50;1000;95;false;false
+Modified residue;feature(MODIFIED RESIDUE);String;g14;50;1000;95;false;false
+Peptide;feature(PEPTIDE);String;g14;50;1000;95;false;false
+Propeptide;feature(PROPEPTIDE);String;g14;50;1000;95;false;false
+Signal peptide;feature(SIGNAL);String;g14;50;1000;95;false;false
+Transit peptide;feature(TRANSIT);String;g14;50;1000;95;false;false
+3D;3d;String;g15;50;1000;95;false;false
+Beta strand;feature(BETA STRAND);String;g15;50;1000;95;false;false
+Helix;feature(HELIX);String;g15;50;1000;95;false;false
+Turn;feature(TURN);String;g15;50;1000;95;false;false
+PubMed ID;citation;String;g16;50;1000;95;false;true
+Date of creation;created;String;g17;80;150;100;false;true
+Date of last modification;last-modified;String;g17;80;150;100;false;true
+Date of last sequence modification;sequence-modified;String;g17;80;150;100;false;true
+Version (entry);version(entry);int;g17;80;100;80;false;false
+Domain [cc];comment(DOMAIN)|domain;String;g18;80;1000;95;false;true
+Sequence similarities;comment(SIMILARITY);String;g18;50;1000;95;false;false
+Protein families;families|family;String;g18;50;1000;95;false;true
+Coiled coil;feature(COILED COIL);String;g18;50;1000;95;false;false
+Compositional bias;feature(COMPOSITIONAL BIAS);String;g18;50;1000;95;false;false
+Domain [FT];feature(DOMAIN EXTENT);String;g18;50;1000;95;false;false
+Motif;feature(MOTIF);String;g18;50;1000;95;false;false
+Region;feature(REGION);String;g18;50;1000;95;false;false
+Repeat;feature(REPEAT);String;g18;50;1000;95;false;false
+Zinc finger;feature(ZINC FINGER);String;g18;50;1000;95;false;false
+Cross-reference (EMBL);database(EMBL);String;g2;50;1000;95;false;false
+Cross-reference (PDB);database(PDB);String;g2;50;1000;95;false;false
+Cross-reference (ENSEMBL);database(ENSEMBL);String;g2;50;1000;95;false;false
+Cross-reference (PFAM);database(PFAM);String;g2;50;1000;95;false;false
+Cross-reference (RFAM);database(RFAM);String;g2;50;1000;95;false;false
+Cross-reference (CATH);database(CATH);String;g2;50;1000;95;false;false
+Cross-reference (SCOPE);database(SCOPE);String;g2;50;1000;95;false;false
+Cross-reference (GO);database(GO);String;g2;50;1000;95;false;false
+Cross-reference (INTERPRO);database(INTERPRO);String;g2;50;1000;95;false;false
+Mapped PubMed ID;citationmapping;String;g16;50;1000;95;false;true
+#
label.invalid_font = Invalid Font
label.separate_multiple_accession_ids = Enter one or more accession IDs separated by a semi-colon ";"
label.separate_multiple_query_values = Enter one or more {0}s separated by a semi-colon ";"
-label.search_all = Enter one or more search values separated by a semi-colon ";" (Note: This Searches the entire PDB database)
+label.search_all = Enter one or more search values separated by a semi-colon ";" (Note: This Searches the entire database)
label.replace_commas_semicolons = Replace commas with semi-colons
label.parsing_failed_syntax_errors_shown_below_param = Parsing failed. Syntax errors shown below {0}
label.parsing_failed_unrecoverable_exception_thrown_param = \nParsing failed. An unrecoverable exception was thrown\:\n {0}
label.blasting_for_unidentified_sequence = BLASTing for unidentified sequences
label.select_columns_containing = Select columns containing
label.select_columns_not_containing = Select columns that do not contain
+label.hide_columns_containing = Hide columns containing
+label.hide_columns_not_containing = Hide columns that do not contain
option.trim_retrieved_seqs = Trim retrieved sequences
label.trim_retrieved_sequences = When the reference sequence is longer than the sequence that you are working with, only keep the relevant subsequences.
label.use_sequence_id_1 = Use $SEQUENCE_ID$ or $SEQUENCE_ID=/<regex>/=$
error.dbrefsource_implementation_exception =DBRefSource Implementation Exception
error.implementation_error_dbinstance_must_implement_interface = Implmentation Error - getDbInstances must be given a class that implements jalview.ws.seqfetcher.DbSourceProxy (was given{0})
error.implementation_error_must_init_dbsources =Implementation error. Must initialise dbSources
-label.view_controller_toggled_marked = {0} {1} columns {2} containing features of type {3} across {4} sequence(s)
+label.view_controller_toggled_marked = {0} {1} columns containing features of type {2} across {3} sequence(s)
label.toggled = Toggled
label.marked = Marked
label.not = not
label.mark_as_representative = Mark as representative
label.open_jabaws_web_page = Open JABAWS web page
label.opens_the_jabaws_server_homepage = Opens the JABAWS server's homepage in web browser
-label.pdb_sequence_getcher = PDB Sequence Fetcher
+label.pdb_sequence_fetcher = PDB Sequence Fetcher
label.result = result
label.results = results
label.structure_chooser = Structure Chooser
label.structure_chooser_no_of_structures = Structure Chooser - {0} Found ({1})
info.no_pdb_entry_found_for = No PDB entry found for {0}
exception.unable_to_detect_internet_connection = Jalview is unable to detect an internet connection
-exception.pdb_rest_service_no_longer_available = PDB rest services no longer available!
+exception.fts_rest_service_no_longer_available = {0} rest services no longer available!
exception.resource_not_be_found = The requested resource could not be found
-exception.pdb_server_error = There seems to be an error from the PDB server
-exception.pdb_server_unreachable = Jalview is unable to reach the PDBe Solr server. \nPlease ensure that you are connected to the internet and try again.
+exception.fts_server_error = There seems to be an error from the {0} server
+exception.fts_server_unreachable = Jalview is unable to reach the {0} server. \nPlease ensure that you are connected to the internet and try again.
label.nw_mapping = Needleman & Wunsch Alignment
label.sifts_mapping = SIFTs Mapping
label.mapping_method = Sequence \u27f7 Structure mapping method
info.error_creating_file = Error creating {0} file.
exception.outofmemory_loading_mmcif_file = Out of memory loading mmCIF File
info.error_creating_file = Error creating {0} file.
+label.run_groovy = Run Groovy console script
+label.run_groovy_tip = Run the script in the Groovy console over this alignment
+label.couldnt_run_groovy_script = Failed to run Groovy script
+label.uniprot_sequence_fetcher = UniProt Sequence Fetcher
+action.next_page= >>
+action.prev_page= <<
+label.next_page_tooltop=Next Page
+label.prev_page_tooltop=Previous Page
+exception.bad_request=Bad request. There is a problem with your input.
+exception.service_not_available=Service not available. The server is being updated, try again later.
label.select_vamsas_session_opened_as_new_vamsas_session= Selecciones una sesión vamsas para abrirla como una nueva sesión.
label.open_saved_vamsas_session = Abrir una sesión VAMSAS guardada
label.groovy_console = Consola Groovy
-label.lineart = lineart
+label.lineart = Lineart
label.dont_ask_me_again = No volver a preguntar
label.select_eps_character_rendering_style = Seleccionar el carácter EPS como estilo de visualización
label.invert_selection = Invertir selección
error.dbrefsource_implementation_exception = Excepción de implementación DBRefSource
error.implementation_error_dbinstance_must_implement_interface = Error de Implementación- getDbInstances debe recibir una clase que implemente jalview.ws.seqfetcher.DbSourceProxy (recibió {0})
error.implementation_error_must_init_dbsources =Error de implementación. Debe inicializar dbSources
-label.view_controller_toggled_marked = {0} {1} columnas {2} conteniendo caracterÃsticas del tipo {3} en {4} secuencia(s)
+label.view_controller_toggled_marked = {0} {1} columnas conteniendo caracterÃsticas del tipo {2} en {3} secuencia(s)
label.toggled = Invertida
label.marked = Marcada
label.not = no
|| ResidueProperties.nucleotideIndex[nucname
.charAt((deoxyn ? 1 : 0))] == -1)
{
- seq.append("X");
- // System.err.println("PDBReader:Null aa3Hash for " +
- // tmpat.resName);
+ char r = ResidueProperties
+ .getSingleCharacterCode(ResidueProperties
+ .getCanonicalAminoAcid(tmpat.resName));
+ seq.append(r == '0' ? 'X' : r);
+ // System.err.println("PDBReader:Null aa3Hash for " +
+ // tmpat.resName);
}
else
{
import javax.swing.JMenuItem;
import javax.swing.JOptionPane;
import javax.swing.JRadioButtonMenuItem;
-import javax.swing.SwingUtilities;
public class PDBViewer extends JInternalFrame implements Runnable
{
@Override
public void mousePressed(MouseEvent evt)
{
- if (evt.isControlDown()
- || SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
radioItem.removeActionListener(radioItem.getActionListeners()[0]);
return null;
}
- List<ChimeraModel> newModelList = getModelList();
- for (ChimeraModel newModel : newModelList)
+ // patch for Jalview - set model name in Chimera
+ // TODO: find a variant that works for sub-models
+ for (ChimeraModel newModel : getModelList())
{
if (!modelList.contains(newModel))
{
"setattr M name " + modelName + " #"
+ newModel.getModelNumber(), false);
modelList.add(newModel);
-
}
}
// assign color and residues to open models
for (ChimeraModel chimeraModel : modelList)
{
- // // patch for Jalview - set model name in Chimera
- // // TODO: find a variant that works for sub-models
// get model color
Color modelColor = getModelColor(chimeraModel);
if (modelColor != null)
*/
public List<String> sendChimeraCommand(String command, boolean reply)
{
- // System.out.println("chimeradebug>> " + command);
+ // System.out.println("chimeradebug>> " + command);
if (!isChimeraLaunched() || command == null
|| "".equals(command.trim()))
{
*/
package jalview.analysis;
+import static jalview.io.gff.GffConstants.CLINICAL_SIGNIFICANCE;
+
import jalview.datamodel.AlignedCodon;
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.util.MappingUtils;
import jalview.util.StringUtils;
+import java.io.UnsupportedEncodingException;
+import java.net.URLEncoder;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.Collection;
public class AlignmentUtils
{
+ private static final String SEQUENCE_VARIANT = "sequence_variant:";
+ private static final String ID = "ID";
+
+ /**
+ * A data model to hold the 'normal' base value at a position, and an optional
+ * sequence variant feature
+ */
+ static class DnaVariant
+ {
+ String base;
+
+ SequenceFeature variant;
+
+ DnaVariant(String nuc)
+ {
+ base = nuc;
+ }
+
+ DnaVariant(String nuc, SequenceFeature var)
+ {
+ base = nuc;
+ variant = var;
+ }
+ }
+
/**
* given an existing alignment, create a new alignment including all, or up to
* flankSize additional symbols from each sequence's dataset sequence
* /ENSP00000288602?feature=transcript_variation;content-type=text/xml
* which would be a bit slower but possibly more reliable
*/
- LinkedHashMap<Integer, String[][]> variants = buildDnaVariantsMap(
+
+ /*
+ * build a map with codon variations for each potentially varying peptide
+ */
+ LinkedHashMap<Integer, List<DnaVariant>[]> variants = buildDnaVariantsMap(
dnaSeq, dnaToProtein);
/*
* scan codon variations, compute peptide variants and add to peptide sequence
*/
int count = 0;
- for (Entry<Integer, String[][]> variant : variants.entrySet())
+ for (Entry<Integer, List<DnaVariant>[]> variant : variants.entrySet())
{
int peptidePos = variant.getKey();
- String[][] codonVariants = variant.getValue();
- String residue = String.valueOf(peptide.getCharAt(peptidePos - 1)); // 0-based
- List<String> peptideVariants = computePeptideVariants(codonVariants,
- residue);
- if (!peptideVariants.isEmpty())
- {
- String desc = residue + "," // include canonical residue in description
- + StringUtils.listToDelimitedString(peptideVariants, ", ");
- SequenceFeature sf = new SequenceFeature(
- SequenceOntologyI.SEQUENCE_VARIANT, desc, peptidePos,
- peptidePos, 0f, null);
- peptide.addSequenceFeature(sf);
- count++;
- }
+ List<DnaVariant>[] codonVariants = variant.getValue();
+ count += computePeptideVariants(peptide, peptidePos, codonVariants);
}
/*
- * ugly sort to get sequence features in start position order
- * - would be better to store in Sequence as a TreeSet instead?
+ * sort to get sequence features in start position order
+ * - would be better to store in Sequence as a TreeSet or NCList?
*/
Arrays.sort(peptide.getSequenceFeatures(),
new Comparator<SequenceFeature>()
}
/**
- * Builds a map whose key is position in the protein sequence, and value is an
- * array of all variants for the coding codon positions
+ * Computes non-synonymous peptide variants from codon variants and adds them
+ * as sequence_variant features on the protein sequence (one feature per
+ * allele variant). Selected attributes (variant id, clinical significance)
+ * are copied over to the new features.
+ *
+ * @param peptide
+ * the protein sequence
+ * @param peptidePos
+ * the position to compute peptide variants for
+ * @param codonVariants
+ * a list of dna variants per codon position
+ * @return the number of features added
+ */
+ static int computePeptideVariants(SequenceI peptide, int peptidePos,
+ List<DnaVariant>[] codonVariants)
+ {
+ String residue = String.valueOf(peptide.getCharAt(peptidePos - 1));
+ int count = 0;
+ String base1 = codonVariants[0].get(0).base;
+ String base2 = codonVariants[1].get(0).base;
+ String base3 = codonVariants[2].get(0).base;
+
+ /*
+ * variants in first codon base
+ */
+ for (DnaVariant var : codonVariants[0])
+ {
+ if (var.variant != null)
+ {
+ String alleles = (String) var.variant.getValue("alleles");
+ if (alleles != null)
+ {
+ for (String base : alleles.split(","))
+ {
+ String codon = base + base2 + base3;
+ if (addPeptideVariant(peptide, peptidePos, residue, var, codon))
+ {
+ count++;
+ }
+ }
+ }
+ }
+ }
+
+ /*
+ * variants in second codon base
+ */
+ for (DnaVariant var : codonVariants[1])
+ {
+ if (var.variant != null)
+ {
+ String alleles = (String) var.variant.getValue("alleles");
+ if (alleles != null)
+ {
+ for (String base : alleles.split(","))
+ {
+ String codon = base1 + base + base3;
+ if (addPeptideVariant(peptide, peptidePos, residue, var, codon))
+ {
+ count++;
+ }
+ }
+ }
+ }
+ }
+
+ /*
+ * variants in third codon base
+ */
+ for (DnaVariant var : codonVariants[2])
+ {
+ if (var.variant != null)
+ {
+ String alleles = (String) var.variant.getValue("alleles");
+ if (alleles != null)
+ {
+ for (String base : alleles.split(","))
+ {
+ String codon = base1 + base2 + base;
+ if (addPeptideVariant(peptide, peptidePos, residue, var, codon))
+ {
+ count++;
+ }
+ }
+ }
+ }
+ }
+
+ return count;
+ }
+
+ /**
+ * Helper method that adds a peptide variant feature, provided the given codon
+ * translates to a value different to the current residue (is a non-synonymous
+ * variant). ID and clinical_significance attributes of the dna variant (if
+ * present) are copied to the new feature.
+ *
+ * @param peptide
+ * @param peptidePos
+ * @param residue
+ * @param var
+ * @param codon
+ * @return true if a feature was added, else false
+ */
+ static boolean addPeptideVariant(SequenceI peptide, int peptidePos,
+ String residue, DnaVariant var, String codon)
+ {
+ /*
+ * get peptide translation of codon e.g. GAT -> D
+ * note that variants which are not single alleles,
+ * e.g. multibase variants or HGMD_MUTATION etc
+ * are currently ignored here
+ */
+ String trans = codon.contains("-") ? "-"
+ : (codon.length() > 3 ? null : ResidueProperties
+ .codonTranslate(codon));
+ if (trans != null && !trans.equals(residue))
+ {
+ String residue3Char = StringUtils
+ .toSentenceCase(ResidueProperties.aa2Triplet.get(residue));
+ String trans3Char = StringUtils
+ .toSentenceCase(ResidueProperties.aa2Triplet.get(trans));
+ String desc = "p." + residue3Char + peptidePos + trans3Char;
+ // set score to 0f so 'graduated colour' option is offered! JAL-2060
+ SequenceFeature sf = new SequenceFeature(
+ SequenceOntologyI.SEQUENCE_VARIANT, desc, peptidePos,
+ peptidePos, 0f, "Jalview");
+ StringBuilder attributes = new StringBuilder(32);
+ String id = (String) var.variant.getValue(ID);
+ if (id != null)
+ {
+ if (id.startsWith(SEQUENCE_VARIANT))
+ {
+ id = id.substring(SEQUENCE_VARIANT.length());
+ }
+ sf.setValue(ID, id);
+ attributes.append(ID).append("=").append(id);
+ // TODO handle other species variants
+ StringBuilder link = new StringBuilder(32);
+ try
+ {
+ link.append(desc).append(" ").append(id)
+ .append("|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=")
+ .append(URLEncoder.encode(id, "UTF-8"));
+ sf.addLink(link.toString());
+ } catch (UnsupportedEncodingException e)
+ {
+ // as if
+ }
+ }
+ String clinSig = (String) var.variant
+ .getValue(CLINICAL_SIGNIFICANCE);
+ if (clinSig != null)
+ {
+ sf.setValue(CLINICAL_SIGNIFICANCE, clinSig);
+ attributes.append(";").append(CLINICAL_SIGNIFICANCE).append("=")
+ .append(clinSig);
+ }
+ peptide.addSequenceFeature(sf);
+ if (attributes.length() > 0)
+ {
+ sf.setAttributes(attributes.toString());
+ }
+ return true;
+ }
+ return false;
+ }
+
+ /**
+ * Builds a map whose key is position in the protein sequence, and value is a
+ * list of the base and all variants for each corresponding codon position
*
* @param dnaSeq
* @param dnaToProtein
* @return
*/
- static LinkedHashMap<Integer, String[][]> buildDnaVariantsMap(
+ static LinkedHashMap<Integer, List<DnaVariant>[]> buildDnaVariantsMap(
SequenceI dnaSeq, MapList dnaToProtein)
{
/*
- * map from peptide position to all variant features of the codon for it
- * LinkedHashMap ensures we add the peptide features in sequence order
+ * map from peptide position to all variants of the codon which codes for it
+ * LinkedHashMap ensures we keep the peptide features in sequence order
*/
- LinkedHashMap<Integer, String[][]> variants = new LinkedHashMap<Integer, String[][]>();
+ LinkedHashMap<Integer, List<DnaVariant>[]> variants = new LinkedHashMap<Integer, List<DnaVariant>[]>();
SequenceOntologyI so = SequenceOntologyFactory.getInstance();
SequenceFeature[] dnaFeatures = dnaSeq.getSequenceFeatures();
continue;
}
int peptidePosition = mapsTo[0];
- String[][] codonVariants = variants.get(peptidePosition);
+ List<DnaVariant>[] codonVariants = variants.get(peptidePosition);
if (codonVariants == null)
{
- codonVariants = new String[3][];
+ codonVariants = new ArrayList[3];
+ codonVariants[0] = new ArrayList<DnaVariant>();
+ codonVariants[1] = new ArrayList<DnaVariant>();
+ codonVariants[2] = new ArrayList<DnaVariant>();
variants.put(peptidePosition, codonVariants);
}
lastCodon = codon;
/*
- * save nucleotide (and this variant) for each codon position
+ * save nucleotide (and any variant) for each codon position
*/
for (int codonPos = 0; codonPos < 3; codonPos++)
{
String nucleotide = String.valueOf(
dnaSeq.getCharAt(codon[codonPos] - dnaStart))
.toUpperCase();
- if (codonVariants[codonPos] == null)
+ List<DnaVariant> codonVariant = codonVariants[codonPos];
+ if (codon[codonPos] == dnaCol)
{
- /*
- * record current dna base
- */
- codonVariants[codonPos] = new String[] { nucleotide };
+ if (!codonVariant.isEmpty()
+ && codonVariant.get(0).variant == null)
+ {
+ /*
+ * already recorded base value, add this variant
+ */
+ codonVariant.get(0).variant = sf;
+ }
+ else
+ {
+ /*
+ * add variant with base value
+ */
+ codonVariant.add(new DnaVariant(nucleotide, sf));
+ }
}
- if (codon[codonPos] == dnaCol)
+ else if (codonVariant.isEmpty())
{
/*
- * add alleles to dna base (and any previously found alleles)
+ * record (possibly non-varying) base value
*/
- String[] known = codonVariants[codonPos];
- String[] dnaVariants = new String[alleles.length + known.length];
- System.arraycopy(known, 0, dnaVariants, 0, known.length);
- System.arraycopy(alleles, 0, dnaVariants, known.length,
- alleles.length);
- codonVariants[codonPos] = dnaVariants;
+ codonVariant.add(new DnaVariant(nucleotide));
}
}
}
}
/**
- * Returns a sorted, non-redundant list of all peptide translations generated
- * by the given dna variants, excluding the current residue value
- *
- * @param codonVariants
- * an array of base values (acgtACGT) for codon positions 1, 2, 3
- * @param residue
- * the current residue translation
- * @return
- */
- static List<String> computePeptideVariants(String[][] codonVariants,
- String residue)
- {
- List<String> result = new ArrayList<String>();
- for (String base1 : codonVariants[0])
- {
- for (String base2 : codonVariants[1])
- {
- for (String base3 : codonVariants[2])
- {
- String codon = base1 + base2 + base3;
- /*
- * get peptide translation of codon e.g. GAT -> D
- * note that variants which are not single alleles,
- * e.g. multibase variants or HGMD_MUTATION etc
- * are ignored here
- */
- String peptide = codon.contains("-") ? "-"
- : (codon.length() > 3 ? null : ResidueProperties
- .codonTranslate(codon));
- if (peptide != null && !result.contains(peptide)
- && !peptide.equalsIgnoreCase(residue))
- {
- result.add(peptide);
- }
- }
- }
- }
-
- /*
- * sort alphabetically with STOP at the end
- */
- Collections.sort(result, new Comparator<String>()
- {
-
- @Override
- public int compare(String o1, String o2)
- {
- if ("STOP".equals(o1))
- {
- return 1;
- }
- else if ("STOP".equals(o2))
- {
- return -1;
- }
- else
- {
- return o1.compareTo(o2);
- }
- }
- });
- return result;
- }
-
- /**
* Makes an alignment with a copy of the given sequences, adding in any
* non-redundant sequences which are mapped to by the cross-referenced
* sequences.
c = '-';
}
- if (!canonicaliseAa && 'a' <= c && c <= 'z')
- {
- c -= (32); // 32 = 'a' - 'A'
- }
+ c = toUpperCase(c);
}
values[c]++;
}
}
else
{
+ c = toUpperCase(c);
nres++;
if (nres == 1)
}
/**
+ * Returns the upper-cased character if between 'a' and 'z', else the
+ * unchanged value
+ *
+ * @param c
+ * @return
+ */
+ char toUpperCase(char c)
+ {
+ if ('a' <= c && c <= 'z')
+ {
+ c -= (32); // 32 = 'a' - 'A'
+ }
+ return c;
+ }
+
+ /**
* Calculates the conservation sequence
*
* @param consflag
}
if (l > 0)
{
- System.out
- .println("Attempting to retrieve cross referenced sequences.");
+ // System.out
+ // .println("Attempting to retrieve cross referenced sequences.");
DBRefEntry[] t = new DBRefEntry[l];
l = 0;
for (int r = 0; r < xrfs.length; r++)
sfeat.addElement(sfarray[i]);
}
}
- sqinfo.put("SeqFeatures", sfeat);
- sqinfo.put("PdbId",
+ if (seq.getDatasetSequence() == null)
+ {
+ sqinfo.put("SeqFeatures", sfeat);
+ sqinfo.put("PdbId",
(seq.getAllPDBEntries() != null) ? seq.getAllPDBEntries()
: new Vector<PDBEntry>());
- sqinfo.put("datasetSequence",
+ }
+ else
+ {
+ sqinfo.put("datasetSequence",
(seq.getDatasetSequence() != null) ? seq.getDatasetSequence()
: new Sequence("THISISAPLACEHOLDER", ""));
+ }
return sqinfo;
}
&& !(seqds.getName().equals("THISISAPLACEHOLDER") && seqds
.getLength() == 0))
{
+ if (sfeatures!=null)
+ {
+ System.err
+ .println("Implementation error: setting dataset sequence for a sequence which has sequence features.\n\tDataset sequence features will not be visible.");
+ }
sq.setDatasetSequence(seqds);
}
import jalview.api.analysis.ScoreModelI;
import jalview.api.analysis.ViewBasedAnalysisI;
import jalview.datamodel.AlignmentView;
+import jalview.datamodel.SeqCigar;
import jalview.datamodel.SequenceFeature;
-import jalview.datamodel.SequenceI;
-import jalview.util.Comparison;
import java.util.ArrayList;
import java.util.Hashtable;
{
int nofeats = 0;
List<String> dft = fr.getDisplayedFeatureTypes();
-
nofeats = dft.size();
-
- SequenceI[] sequenceString = seqData.getVisibleAlignment(
- Comparison.GapChars.charAt(0)).getSequencesArray();
- int noseqs = sequenceString.length;
- int cpwidth = seqData.getWidth();
+ SeqCigar[] seqs = seqData.getSequences();
+ int noseqs = seqs.length;
+ int cpwidth = 0;// = seqData.getWidth();
float[][] distance = new float[noseqs][noseqs];
if (nofeats == 0)
{
}
return distance;
}
- float max = 0;
- for (int cpos = 0; cpos < cpwidth; cpos++)
+ // need to get real position for view position
+ int[] viscont = seqData.getVisibleContigs();
+ for (int vc = 0; vc < viscont.length; vc += 2)
{
- // get visible features at cpos under view's display settings and compare
- // them
- List<Hashtable<String, SequenceFeature>> sfap = new ArrayList<Hashtable<String, SequenceFeature>>();
- for (int i = 0; i < noseqs; i++)
- {
- Hashtable<String, SequenceFeature> types = new Hashtable<String, SequenceFeature>();
- List<SequenceFeature> sfs = fr.findFeaturesAtRes(sequenceString[i],
- sequenceString[i].findPosition(cpos));
- for (SequenceFeature sf : sfs)
- {
- types.put(sf.getType(), sf);
- }
- sfap.add(types);
- }
- for (int i = 0; i < (noseqs - 1); i++)
+
+ for (int cpos = viscont[vc]; cpos <= viscont[vc + 1]; cpos++)
{
- if (cpos == 0)
- {
- distance[i][i] = 0f;
- }
- for (int j = i + 1; j < noseqs; j++)
+ cpwidth++;
+ // get visible features at cpos under view's display settings and
+ // compare them
+ List<Hashtable<String, SequenceFeature>> sfap = new ArrayList<Hashtable<String, SequenceFeature>>();
+ for (int i = 0; i < noseqs; i++)
{
- int sfcommon = 0;
- // compare the two lists of features...
- Hashtable<String, SequenceFeature> fi = sfap.get(i), fk, fj = sfap
- .get(j);
- if (fi.size() > fj.size())
+ Hashtable<String, SequenceFeature> types = new Hashtable<String, SequenceFeature>();
+ int spos = seqs[i].findPosition(cpos);
+ if (spos != -1)
{
- fk = fj;
+ List<SequenceFeature> sfs = fr.findFeaturesAtRes(
+ seqs[i].getRefSeq(), spos);
+ for (SequenceFeature sf : sfs)
+ {
+ types.put(sf.getType(), sf);
+ }
}
- else
+ sfap.add(types);
+ }
+ for (int i = 0; i < (noseqs - 1); i++)
+ {
+ if (cpos == 0)
{
- fk = fi;
- fi = fj;
+ distance[i][i] = 0f;
}
- for (String k : fi.keySet())
+ for (int j = i + 1; j < noseqs; j++)
{
- SequenceFeature sfj = fk.get(k);
- if (sfj != null)
+ int sfcommon = 0;
+ // compare the two lists of features...
+ Hashtable<String, SequenceFeature> fi = sfap.get(i), fk, fj = sfap
+ .get(j);
+ if (fi.size() > fj.size())
+ {
+ fk = fj;
+ }
+ else
+ {
+ fk = fi;
+ fi = fj;
+ }
+ for (String k : fi.keySet())
{
- sfcommon++;
+ SequenceFeature sfj = fk.get(k);
+ if (sfj != null)
+ {
+ sfcommon++;
+ }
}
+ distance[i][j] += (fi.size() + fk.size() - 2f * sfcommon);
+ distance[j][i] += distance[i][j];
}
- distance[i][j] += (fi.size() + fk.size() - 2f * sfcommon);
- distance[j][i] += distance[i][j];
}
}
}
import jalview.datamodel.AlignmentAnnotation;
+/**
+ * Interface describing a worker that calculates alignment annotation(s). The
+ * main (re-)calculation should be performed by the inherited run() method.
+ */
public interface AlignCalcWorkerI extends Runnable
{
-
+ /**
+ * Answers true if this worker updates the given annotation (regardless of its
+ * current state)
+ *
+ * @param annot
+ * @return
+ */
public boolean involves(AlignmentAnnotation annot);
+ /**
+ * Updates the display of calculated annotation values (does not recalculate
+ * the values). This allows for quick redraw of annotations when display
+ * settings are changed.
+ */
public void updateAnnotation();
- void removeOurAnnotation();
+ /**
+ * Removes any annotation managed by this worker from the alignment
+ */
+ void removeAnnotation();
}
* @return true if operation affected state
*/
boolean markColumnsContainingFeatures(boolean invert,
- boolean extendCurrent, boolean clearColumns, String featureType);
+ boolean extendCurrent, boolean toggle, String featureType);
/**
* sort the alignment or current selection by average score over the given set
import jalview.datamodel.Mapping;
+//JBPComment: this is a datamodel API - so it should be in datamodel (it's a peer of SequenceI)
public interface DBRefEntryI
{
List<SequenceFeature> findFeaturesAtRes(SequenceI sequence, int res);
/**
- *
- * @return true if the rendering platform supports transparency
- */
- boolean isTransparencyAvailable();
-
- /**
* get current displayed types, in ordering of rendering (on top last)
*
* @return a (possibly empty) list of feature types
import java.util.HashMap;
import java.util.HashSet;
+// JBPComment: this isn't a top-level Jalview API - should be in its own package api
+
public interface SiftsClientI
{
/**
{
super();
this.av = av;
-
- setTransparencyAvailable(!System.getProperty("java.version")
- .startsWith("1.1"));
}
static String lastFeatureAdded;
start.setText(features[0].getBegin() + "");
end.setText(features[0].getEnd() + "");
description.setText(features[0].getDescription());
- Color col = getColour(name.getText());
- if (col == null)
- {
- col = new jalview.schemes.UserColourScheme()
- .createColourFromName(name.getText());
- }
Object fcol = getFeatureStyle(name.getText());
// simply display the feature color in a box
colourPanel.updateColor(fcol);
import java.awt.event.WindowEvent;
import java.util.Arrays;
import java.util.Enumeration;
-import java.util.Hashtable;
import java.util.List;
+import java.util.Map;
import java.util.Vector;
public class FeatureSettings extends Panel implements ItemListener,
transparency = new Scrollbar(Scrollbar.HORIZONTAL,
100 - (int) (fr.getTransparency() * 100), 1, 1, 100);
- if (fr.isTransparencyAvailable())
- {
- transparency.addAdjustmentListener(this);
- }
- else
- {
- transparency.setEnabled(false);
- }
+ transparency.addAdjustmentListener(this);
java.net.URL url = getClass().getResource("/images/link.gif");
if (url != null)
Panel tPanel = new Panel(new BorderLayout());
- if (fr.isTransparencyAvailable())
- {
- tPanel.add(transparency, BorderLayout.CENTER);
- tPanel.add(new Label("Transparency"), BorderLayout.EAST);
- }
- else
- {
- tPanel.add(
- new Label("Transparency not available in this web browser"),
- BorderLayout.CENTER);
- }
+ tPanel.add(transparency, BorderLayout.CENTER);
+ tPanel.add(new Label("Transparency"), BorderLayout.EAST);
lowerPanel.add(tPanel, BorderLayout.SOUTH);
60);
}
- protected void popupSort(final MyCheckbox check, final Hashtable minmax,
+ protected void popupSort(final MyCheckbox check,
+ final Map<String, float[][]> minmax,
int x, int y)
{
final String type = check.type;
});
men.add(dens);
+
if (minmax != null)
{
- final Object typeMinMax = minmax.get(type);
+ final float[][] typeMinMax = minmax.get(type);
/*
* final java.awt.CheckboxMenuItem chb = new
* java.awt.CheckboxMenuItem("Vary Height"); // this is broken at the
*
* }); men.add(chb);
*/
- if (typeMinMax != null && ((float[][]) typeMinMax)[0] != null)
+ if (typeMinMax != null && typeMinMax[0] != null)
{
// graduated colourschemes for those where minmax exists for the
// positional features
});
}
}
+
+ MenuItem selectContaining = new MenuItem(
+ MessageManager.getString("label.select_columns_containing"));
+ selectContaining.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ me.ap.alignFrame.avc.markColumnsContainingFeatures(false, false,
+ false, type);
+ }
+ });
+ men.add(selectContaining);
+
+ MenuItem selectNotContaining = new MenuItem(
+ MessageManager.getString("label.select_columns_not_containing"));
+ selectNotContaining.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ me.ap.alignFrame.avc.markColumnsContainingFeatures(true, false,
+ false, type);
+ }
+ });
+ men.add(selectNotContaining);
+
+ MenuItem hideContaining = new MenuItem(
+ MessageManager.getString("label.hide_columns_containing"));
+ hideContaining.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ hideFeatureColumns(type, true);
+ }
+ });
+ men.add(hideContaining);
+
+ MenuItem hideNotContaining = new MenuItem(
+ MessageManager.getString("label.hide_columns_not_containing"));
+ hideNotContaining.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ hideFeatureColumns(type, false);
+ }
+ });
+ men.add(hideNotContaining);
+
this.featurePanel.add(men);
men.show(this.featurePanel, x, y);
}
{
SequenceFeature[] tmpfeatures;
String group = null, type;
- Vector visibleChecks = new Vector();
+ Vector<String> visibleChecks = new Vector<String>();
AlignmentI alignment = av.getAlignment();
for (int i = 0; i < alignment.getHeight(); i++)
{
// now add checkboxes which should be visible,
// if they have not already been added
- Enumeration en = visibleChecks.elements();
+ Enumeration<String> en = visibleChecks.elements();
while (en.hasMoreElements())
{
{
}
+ /**
+ * Hide columns containing (or not containing) a given feature type
+ *
+ * @param type
+ * @param columnsContaining
+ */
+ void hideFeatureColumns(final String type,
+ boolean columnsContaining)
+ {
+ if (ap.alignFrame.avc.markColumnsContainingFeatures(
+ columnsContaining, false, false, type))
+ {
+ if (ap.alignFrame.avc.markColumnsContainingFeatures(
+ !columnsContaining, false, false, type))
+ {
+ ap.alignFrame.viewport.hideSelectedColumns();
+ }
+ }
+ }
+
}
repaint();
}
+ @Override
public void update(Graphics g)
{
paint(g);
}
+ @Override
public void paint(Graphics g)
{
if (getSize().height < 0 || getSize().width < 0)
Font bold = new Font(av.getFont().getName(), Font.BOLD, av.getFont()
.getSize());
- if (av.isHiddenRepSequence(seq))
+ if (av.isReferenceSeq(seq) || av.isHiddenRepSequence(seq))
{
gg.setFont(bold);
return true;
ColumnSelection cs = MappingUtils.mapColumnSelection(colsel, sourceAv,
av);
av.setColumnSelection(cs);
- av.isColSelChanged(true);
ap.scalePanelHolder.repaint();
ap.repaint();
System.out
.println("Jalview Version: " + codeVersion + codeInstallation);
- Pdb.setCurrentDefaultFomart(jalview.bin.Cache.getDefault(
+ Pdb.setCurrentDefaultFormat(jalview.bin.Cache.getDefault(
"DEFAULT_STRUCTURE_FORMAT", DEFAULT_STRUCTURE_FORMAT));
// jnlpVersion will be null if we're using InstallAnywhere
// Dont do this check if running in headless mode
import java.util.Vector;
import javax.swing.UIManager;
-import javax.swing.UnsupportedLookAndFeelException;
/**
* Main class for Jalview Application <br>
// grab all the rights we can the JVM
Policy.setPolicy(new Policy()
{
+ @Override
public PermissionCollection getPermissions(CodeSource codesource)
{
Permissions perms = new Permissions();
return (perms);
}
+ @Override
public void refresh()
{
}
*/
public static void main(String[] args)
{
+ System.setSecurityManager(null);
System.out.println("Java version: "
+ System.getProperty("java.version"));
System.out.println(System.getProperty("os.arch") + " "
} catch (Exception ex)
{
}
- if (new Platform().isAMac())
+ if (Platform.isAMac())
{
System.setProperty("com.apple.mrj.application.apple.menu.about.name",
"Jalview");
{
UIManager.setLookAndFeel(ch.randelshofer.quaqua.QuaquaManager
.getLookAndFeel());
- } catch (UnsupportedLookAndFeelException e)
+ } catch (Throwable e)
{
- // TODO Auto-generated catch block
- e.printStackTrace();
+ System.err.println("Failed to set QuaQua look and feel: "
+ + e.toString());
}
}
{
// Execute the groovy script after we've done all the rendering stuff
// and before any images or figures are generated.
- if (jalview.bin.Cache.groovyJarsPresent())
- {
- System.out.println("Executing script " + groovyscript);
- executeGroovyScript(groovyscript, new Object[] { desktop, af });
-
- System.out.println("CMD groovy[" + groovyscript
- + "] executed successfully!");
- }
- else
- {
- System.err
- .println("Sorry. Groovy Support is not available, so ignoring the provided groovy script "
- + groovyscript);
- }
+ System.out.println("Executing script " + groovyscript);
+ executeGroovyScript(groovyscript, new Object[] { desktop, af });
+ System.out.println("CMD groovy[" + groovyscript
+ + "] executed successfully!");
groovyscript = null;
}
String imageName = "unnamed.png";
+ "\n\n(you can enable or disable usage tracking in the preferences)",
new Runnable()
{
+ @Override
public void run()
{
Cache.log
}
}, new Runnable()
{
+ @Override
public void run()
{
Cache.log.debug("Not enabling Google Tracking.");
class rnabuttonlistener implements ActionListener
{
+ @Override
public void actionPerformed(ActionEvent arg0)
{
System.out.println("Good idea ! ");
class pbuttonlistener implements ActionListener
{
+ @Override
public void actionPerformed(ActionEvent arg0)
{
new Thread(new Runnable()
{
+ @Override
public void run()
{
synchronized (us)
ColumnSelection cs = viewport.getColumnSelection();
if (bs.cardinality() > 0 || invert)
{
+ boolean changed = false;
if (cs == null)
{
cs = new ColumnSelection();
{
if (!extendCurrent)
{
+ changed = !cs.isEmpty();
cs.clear();
}
}
{
if (ibs < 0 || i < ibs)
{
+ changed = true;
if (toggle && cs.contains(i))
{
cs.removeElement(i++);
for (int i = bs.nextSetBit(alStart); i >= alStart; i = bs
.nextSetBit(i + 1))
{
+ changed = true;
if (toggle && cs.contains(i))
{
cs.removeElement(i);
}
}
}
- viewport.setColumnSelection(cs);
- alignPanel.paintAlignment(true);
- avcg.setStatus(MessageManager.formatMessage(
- "label.view_controller_toggled_marked",
- new String[] {
- (toggle ? MessageManager.getString("label.toggled")
- : MessageManager.getString("label.marked")),
- (invert ? (Integer.valueOf((alw - alStart)
- - bs.cardinality()).toString()) : (Integer
- .valueOf(bs.cardinality()).toString())),
- featureType, Integer.valueOf(nseq).toString() }));
- return true;
+ if (changed)
+ {
+ viewport.setColumnSelection(cs);
+ alignPanel.paintAlignment(true);
+ avcg.setStatus(MessageManager.formatMessage(
+ "label.view_controller_toggled_marked",
+ new String[] {
+ (toggle ? MessageManager.getString("label.toggled")
+ : MessageManager.getString("label.marked")),
+ (invert ? (Integer.valueOf((alw - alStart)
+ - bs.cardinality()).toString()) : (Integer
+ .valueOf(bs.cardinality()).toString())),
+ featureType, Integer.valueOf(nseq).toString() }));
+ return true;
+ }
}
else
{
cs.clear();
alignPanel.paintAlignment(true);
}
- return false;
}
+ return false;
}
@Override
}
return null;
}
+
+ @Override
+ public int[] getVisibleStartAndEndIndex(List<int[]> hiddenCols)
+ {
+ int[] alignmentStartEnd = new int[] { 0, getWidth() - 1 };
+ int startPos = alignmentStartEnd[0];
+ int endPos = alignmentStartEnd[1];
+
+ int[] lowestRange = new int[] { -1, -1 };
+ int[] higestRange = new int[] { -1, -1 };
+
+ for (int[] hiddenCol : hiddenCols)
+ {
+ lowestRange = (hiddenCol[0] <= startPos) ? hiddenCol : lowestRange;
+ higestRange = (hiddenCol[1] >= endPos) ? hiddenCol : higestRange;
+ }
+
+ if (lowestRange[0] == -1 && lowestRange[1] == -1)
+ {
+ startPos = alignmentStartEnd[0];
+ }
+ else
+ {
+ startPos = lowestRange[1] + 1;
+ }
+
+ if (higestRange[0] == -1 && higestRange[1] == -1)
+ {
+ endPos = alignmentStartEnd[1];
+ }
+ else
+ {
+ endPos = higestRange[0] - 1;
+ }
+ return new int[] { startPos, endPos };
+ }
}
* @return
*/
AlignedCodonFrame getMapping(SequenceI mapFrom, SequenceI mapTo);
+
+ /**
+ * Calculate the visible start and end index of an alignment. The result is
+ * returned an int array where: int[0] = startIndex, and int[1] = endIndex.
+ *
+ * @param hiddenCols
+ * @return
+ */
+ public int[] getVisibleStartAndEndIndex(List<int[]> hiddenCols);
}
*/
package jalview.datamodel;
+import jalview.util.Comparison;
import jalview.util.ShiftList;
import jalview.viewmodel.annotationfilter.AnnotationFilterParameter;
import jalview.viewmodel.annotationfilter.AnnotationFilterParameter.SearchableAnnotationField;
import java.util.Vector;
/**
- * NOTE: Columns are zero based.
+ * Data class holding the selected columns and hidden column ranges for a view.
+ * Ranges are base 1.
*/
public class ColumnSelection
{
+ /**
+ * A class to hold an efficient representation of selected columns
+ */
private class IntList
{
/*
}
return rlist;
}
+
+ @Override
+ public int hashCode()
+ {
+ // TODO Auto-generated method stub
+ return selected.hashCode();
+ }
+
+ @Override
+ public boolean equals(Object obj)
+ {
+ if (obj instanceof IntList)
+ {
+ return ((IntList) obj).selected.equals(selected);
+ }
+ return false;
+ }
}
- IntList selected = new IntList();
+ IntList selection = new IntList();
+
/*
* list of hidden column [start, end] ranges; the list is maintained in
* ascending start column order
*/
public void addElement(int col)
{
- selected.add(col);
+ selection.add(col);
}
/**
*/
public void clear()
{
- selected.clear();
+ selection.clear();
}
/**
*/
public void removeElement(int col)
{
- selected.remove(col);
+ selection.remove(col);
}
/**
for (int i = start; i < end; i++)
{
colInt = new Integer(i);
- if (selected.contains(colInt))
+ if (selection.contains(colInt))
{
- selected.remove(colInt);
+ selection.remove(colInt);
}
}
}
*/
public List<Integer> getSelected()
{
- return selected.getList();
+ return selection.getList();
}
/**
*/
public List<int[]> getSelectedRanges()
{
- return selected.getRanges();
+ return selection.getRanges();
}
/**
*/
public boolean contains(int col)
{
- return (col > -1) ? selected.isSelected(col) : false;
+ return (col > -1) ? selection.isSelected(col) : false;
}
/**
*/
public boolean isEmpty()
{
- return selected == null || selected.isEmpty();
+ return selection == null || selection.isEmpty();
}
/**
*/
public int getMax()
{
- if (selected.isEmpty())
+ if (selection.isEmpty())
{
return -1;
}
- return selected.getMaxColumn();
+ return selection.getMaxColumn();
}
/**
*/
public int getMin()
{
- if (selected.isEmpty())
+ if (selection.isEmpty())
{
return 1000000000;
}
- return selected.getMinColumn();
+ return selection.getMinColumn();
}
/**
public List<int[]> compensateForEdit(int start, int change)
{
List<int[]> deletedHiddenColumns = null;
- selected.compensateForEdits(start, change);
+ selection.compensateForEdits(start, change);
if (hiddenColumns != null)
{
private void compensateForDelEdits(int start, int change)
{
- selected.compensateForEdits(start, change);
+ selection.compensateForEdits(start, change);
if (hiddenColumns != null)
{
hiddenColumns = null;
}
}
- if (selected != null && selected.size() > 0)
+ if (selection != null && selection.size() > 0)
{
- selected.pruneColumnList(shifts);
- if (selected != null && selected.size() == 0)
+ selection.pruneColumnList(shifts);
+ if (selection != null && selection.size() == 0)
{
- selected = null;
+ selection = null;
}
}
// and shift the rest.
* Return absolute column index for a visible column index
*
* @param column
- * int column index in alignment view
+ * int column index in alignment view (count from zero)
* @return alignment column index for column
*/
public int adjustForHiddenColumns(int column)
public void hideSelectedColumns()
{
- synchronized (selected) {
- for (int[] selregions:selected.getRanges())
+ synchronized (selection)
+ {
+ for (int[] selregions : selection.getRanges())
{
hideColumns(selregions[0], selregions[1]);
}
- selected.clear();
+ selection.clear();
}
}
/*
* remaining case is that the new range follows everything else
*/
- hiddenColumns.addElement(new int[] { start, end });
+ hiddenColumns.addElement(new int[] { start, end });
}
/**
{
if (copy != null)
{
- if (copy.selected != null)
+ if (copy.selection != null)
{
- selected = new IntList();
- for (int i = 0, j = copy.selected.size(); i < j; i++)
+ selection = new IntList();
+ for (int i = 0, j = copy.selection.size(); i < j; i++)
{
- selected.add(copy.selected.elementAt(i));
+ selection.add(copy.selection.elementAt(i));
}
}
if (copy.hiddenColumns != null)
}
/**
+ * Locate the first and last position visible for this sequence. if seq isn't
+ * visible then return the position of the left and right of the hidden
+ * boundary region, and the corresponding alignment column indices for the
+ * extent of the sequence
+ *
+ * @param seq
+ * @return int[] { visible start, visible end, first seqpos, last seqpos,
+ * alignment index for seq start, alignment index for seq end }
+ */
+ public int[] locateVisibleBoundsOfSequence(SequenceI seq)
+ {
+ int fpos=seq.getStart(),lpos= seq.getEnd();
+ int start = 0;
+
+ if (hiddenColumns == null || hiddenColumns.size() == 0)
+ {
+ int ifpos = seq.findIndex(fpos) - 1, ilpos = seq.findIndex(lpos) - 1;
+ return new int[] { ifpos, ilpos, fpos, lpos, ifpos, ilpos };
+ }
+
+ // Simply walk along the sequence whilst watching for hidden column
+ // boundaries
+ List<int[]> regions = getHiddenColumns();
+ int spos = fpos, lastvispos = -1, rcount = 0, hideStart = seq
+ .getLength(), hideEnd = -1;
+ int visPrev = 0, visNext = 0, firstP = -1, lastP = -1;
+ boolean foundStart = false;
+ for (int p = 0, pLen = seq.getLength(); spos <= seq.getEnd()
+ && p < pLen; p++)
+ {
+ if (!Comparison.isGap(seq.getCharAt(p)))
+ {
+ // keep track of first/last column
+ // containing sequence data regardless of visibility
+ if (firstP == -1)
+ {
+ firstP = p;
+ }
+ lastP = p;
+ // update hidden region start/end
+ while (hideEnd < p && rcount < regions.size())
+ {
+ int[] region = regions.get(rcount++);
+ visPrev = visNext;
+ visNext += region[0] - visPrev;
+ hideStart = region[0];
+ hideEnd = region[1];
+ }
+ if (hideEnd < p)
+ {
+ hideStart = seq.getLength();
+ }
+ // update visible boundary for sequence
+ if (p < hideStart)
+ {
+ if (!foundStart)
+ {
+ fpos = spos;
+ start = p;
+ foundStart = true;
+ }
+ lastvispos = p;
+ lpos = spos;
+ }
+ // look for next sequence position
+ spos++;
+ }
+ }
+ if (foundStart)
+ {
+ return new int[] { findColumnPosition(start),
+ findColumnPosition(lastvispos), fpos, lpos, firstP, lastP };
+ }
+ // otherwise, sequence was completely hidden
+ return new int[] { visPrev, visNext, 0, 0, firstP, lastP };
+ }
+
+ /**
* delete any columns in alignmentAnnotation that are hidden (including
* sequence associated annotation).
*
{
if (hiddenColumns != null && isVisible(col.intValue()))
{
- selected.add(col);
+ selection.add(col);
}
}
}
*/
public void setElementsFrom(ColumnSelection colsel)
{
- selected = new IntList();
- if (colsel.selected != null && colsel.selected.size() > 0)
+ selection = new IntList();
+ if (colsel.selection != null && colsel.selection.size() > 0)
{
if (hiddenColumns != null && hiddenColumns.size() > 0)
{
*/
public boolean hasSelectedColumns()
{
- return (selected != null && selected.size() > 0);
+ return (selection != null && selection.size() > 0);
}
/**
public boolean filterAnnotations(Annotation[] annotations,
AnnotationFilterParameter filterParams)
{
+ // JBPNote - this method needs to be refactored to become independent of
+ // viewmodel package
this.revealAllHiddenColumns();
this.clear();
int count = 0;
} while (count < annotations.length);
return false;
}
+
+ /**
+ * Returns a hashCode built from selected columns and hidden column ranges
+ */
+ @Override
+ public int hashCode()
+ {
+ int hashCode = selection.hashCode();
+ if (hiddenColumns != null)
+ {
+ for (int[] hidden : hiddenColumns)
+ {
+ hashCode = 31 * hashCode + hidden[0];
+ hashCode = 31 * hashCode + hidden[1];
+ }
+ }
+ return hashCode;
+ }
+
+ @Override
+ public boolean equals(Object obj)
+ {
+ if (obj instanceof ColumnSelection)
+ {
+ return hashCode() == obj.hashCode();
+ }
+ return false;
+ }
+
}
*/
public static final String ENSEMBL = "ENSEMBL";
+ public static final String ENSEMBLGENOMES = "ENSEMBLGENOMES";
+
/**
* List of databases whose sequences might have coding regions annotated
*/
}
/**
+ *
+ * @param column
+ * @return position in sequence for column (or -1 if no match state exists)
+ */
+ public int findPosition(int column)
+ {
+ int w = 0, ew, p = refseq.findPosition(start);
+ if (column < 0)
+ {
+ return -1;
+ }
+ if (range != null)
+ {
+ for (int i = 0; i < length; i++)
+ {
+ if (operation[i] == M || operation[i] == D)
+ {
+ p += range[i];
+ }
+ if (operation[i] == M || operation[i] == I)
+ {
+ ew = w + range[i];
+ if (column < ew)
+ {
+ if (operation[i] == I)
+ {
+ return -1;
+ }
+ return p - (ew - column);
+ }
+ w = ew;
+ }
+ }
+ }
+ return -1;
+ }
+
+ /**
* Returns sequence as a string with cigar operations applied to it
*
* @return String
*/
+ @Override
public String getSequenceString(char GapChar)
{
return (length == 0) ? "" : (String) getSequenceAndDeletions(
import jalview.util.StringUtils;
import java.util.ArrayList;
+import java.util.Arrays;
import java.util.Enumeration;
import java.util.List;
import java.util.Vector;
}
/**
- * Creates a new Sequence object with new features, DBRefEntries,
- * AlignmentAnnotations, and PDBIds but inherits any existing dataset sequence
- * reference.
+ * Creates a new Sequence object with new AlignmentAnnotations but inherits
+ * any existing dataset sequence reference. If non exists, everything is
+ * copied.
*
* @param seq
- * DOCUMENT ME!
+ * if seq is a dataset sequence, behaves like a plain old copy
+ * constructor
*/
public Sequence(SequenceI seq)
{
}
+ /**
+ * does the heavy lifting when cloning a dataset sequence, or coping data from
+ * dataset to a new derived sequence.
+ *
+ * @param seq
+ * - source of attributes.
+ * @param alAnnotation
+ * - alignment annotation present on seq that should be copied onto
+ * this sequence
+ */
protected void initSeqFrom(SequenceI seq,
AlignmentAnnotation[] alAnnotation)
{
- initSeqAndName(seq.getName(), seq.getSequence(), seq.getStart(),
+ {
+ char[] oseq = seq.getSequence();
+ initSeqAndName(seq.getName(), Arrays.copyOf(oseq, oseq.length),
+ seq.getStart(),
seq.getEnd());
+ }
description = seq.getDescription();
sourceDBRef = seq.getSourceDBRef() == null ? null : new DBRefEntry(
seq.getSourceDBRef());
- if (seq.getSequenceFeatures() != null)
+ if (seq != datasetSequence)
{
- SequenceFeature[] sf = seq.getSequenceFeatures();
- for (int i = 0; i < sf.length; i++)
- {
- addSequenceFeature(new SequenceFeature(sf[i]));
- }
+ setDatasetSequence(seq.getDatasetSequence());
}
- setDatasetSequence(seq.getDatasetSequence());
if (datasetSequence == null && seq.getDBRefs() != null)
{
- // only copy DBRefs if we really are a dataset sequence
+ // only copy DBRefs and seqfeatures if we really are a dataset sequence
DBRefEntry[] dbr = seq.getDBRefs();
for (int i = 0; i < dbr.length; i++)
{
addDBRef(new DBRefEntry(dbr[i]));
}
+ if (seq.getSequenceFeatures() != null)
+ {
+ SequenceFeature[] sf = seq.getSequenceFeatures();
+ for (int i = 0; i < sf.length; i++)
+ {
+ addSequenceFeature(new SequenceFeature(sf[i]));
+ }
+ }
}
if (seq.getAnnotation() != null)
{
}
}
- /**
- * DOCUMENT ME!
- *
- * @param v
- * DOCUMENT ME!
- */
+
@Override
public void setSequenceFeatures(SequenceFeature[] features)
{
- sequenceFeatures = features;
+ if (datasetSequence == null)
+ {
+ sequenceFeatures = features;
+ }
+ else
+ {
+ System.err
+ .println("Warning: JAL-2046 side effect ? Possible implementation error: overwriting dataset sequence features by setting sequence features on alignment");
+ datasetSequence.setSequenceFeatures(features);
+ }
}
@Override
public synchronized void addSequenceFeature(SequenceFeature sf)
{
- // TODO add to dataset sequence instead if there is one?
+ if (sequenceFeatures==null && datasetSequence != null)
+ {
+ datasetSequence.addSequenceFeature(sf);
+ return;
+ }
if (sequenceFeatures == null)
{
sequenceFeatures = new SequenceFeature[0];
{
if (sequenceFeatures == null)
{
+ if (datasetSequence!=null) {
+ datasetSequence.deleteFeature(sf);
+ }
return;
}
@Override
public SequenceI deriveSequence()
{
- SequenceI seq = new Sequence(this);
- if (datasetSequence != null)
- {
- // duplicate current sequence with same dataset
- seq.setDatasetSequence(datasetSequence);
- }
- else
+ Sequence seq=null;
+ if (datasetSequence == null)
{
if (isValidDatasetSequence())
{
// Use this as dataset sequence
+ seq = new Sequence(getName(), "", 1, -1);
seq.setDatasetSequence(this);
+ seq.initSeqFrom(this, getAnnotation());
+ return seq;
}
else
{
// Create a new, valid dataset sequence
- SequenceI ds = seq;
- ds.setSequence(AlignSeq.extractGaps(
- jalview.util.Comparison.GapChars, new String(sequence)));
- setDatasetSequence(ds);
- ds.setSequenceFeatures(getSequenceFeatures());
- seq = this; // and return this sequence as the derived sequence.
+ createDatasetSequence();
}
}
- return seq;
+ return new Sequence(this);
}
/*
{
if (datasetSequence == null)
{
- datasetSequence = new Sequence(getName(), AlignSeq.extractGaps(
+ Sequence dsseq = new Sequence(getName(), AlignSeq.extractGaps(
jalview.util.Comparison.GapChars, getSequenceAsString()),
getStart(), getEnd());
- datasetSequence.setSequenceFeatures(getSequenceFeatures());
- datasetSequence.setDescription(getDescription());
- setSequenceFeatures(null);
- // move database references onto dataset sequence
- datasetSequence.setDBRefs(getDBRefs());
- setDBRefs(null);
- datasetSequence.setPDBId(getAllPDBEntries());
- setPDBId(null);
+
+ datasetSequence = dsseq;
+
+ dsseq.setDescription(description);
+ // move features and database references onto dataset sequence
+ dsseq.sequenceFeatures = sequenceFeatures;
+ sequenceFeatures=null;
+ dsseq.dbrefs = dbrefs;
+ dbrefs=null;
+ // TODO: search and replace any references to this sequence with
+ // references to the dataset sequence in Mappings on dbref
+ dsseq.pdbIds = pdbIds;
+ pdbIds = null;
datasetSequence.updatePDBIds();
if (annotation != null)
{
+ // annotation is cloned rather than moved, to preserve what's currently
+ // on the alignment
for (AlignmentAnnotation aa : annotation)
{
AlignmentAnnotation _aa = new AlignmentAnnotation(aa);
// private key for Phase designed not to conflict with real GFF data
private static final String PHASE = "!Phase";
+ /*
+ * ATTRIBUTES is reserved for the GFF 'column 9' data, formatted as
+ * name1=value1;name2=value2,value3;...etc
+ */
private static final String ATTRIBUTES = "ATTRIBUTES";
public int begin;
}
}
+ /**
+ * Constructor including a Status value
+ *
+ * @param type
+ * @param desc
+ * @param status
+ * @param begin
+ * @param end
+ * @param featureGroup
+ */
public SequenceFeature(String type, String desc, String status,
int begin, int end, String featureGroup)
{
+ this(type, desc, begin, end, featureGroup);
+ setStatus(status);
+ }
+
+ /**
+ * Constructor
+ *
+ * @param type
+ * @param desc
+ * @param begin
+ * @param end
+ * @param featureGroup
+ */
+ SequenceFeature(String type, String desc, int begin, int end,
+ String featureGroup)
+ {
this.type = type;
this.description = desc;
- setValue(STATUS, status);
this.begin = begin;
this.end = end;
this.featureGroup = featureGroup;
}
+ /**
+ * Constructor including a score value
+ *
+ * @param type
+ * @param desc
+ * @param begin
+ * @param end
+ * @param score
+ * @param featureGroup
+ */
public SequenceFeature(String type, String desc, int begin, int end,
float score, String featureGroup)
{
- this.type = type;
- this.description = desc;
- this.begin = begin;
- this.end = end;
+ this(type, desc, begin, end, featureGroup);
this.score = score;
- this.featureGroup = featureGroup;
}
/**
public void insertCharAt(int position, int count, char ch);
/**
- * DOCUMENT ME!
+ * Gets array holding sequence features associated with this sequence. The
+ * array may be held by the sequence's dataset sequence if that is defined.
*
- * @return DOCUMENT ME!
+ * @return hard reference to array
*/
public SequenceFeature[] getSequenceFeatures();
/**
- * DOCUMENT ME!
+ * Replaces the array of sequence features associated with this sequence with
+ * a new array reference. If this sequence has a dataset sequence, then this
+ * method will update the dataset sequence's feature array
*
- * @param v
- * DOCUMENT ME!
+ * @param features
+ * New array of sequence features
*/
public void setSequenceFeatures(SequenceFeature[] features);
*/
public PDBEntry getPDBEntry(String pdbId);
+ /**
+ * Set the distinct source database, and accession number from which a
+ * sequence and its start-end data were derived from. This is very important
+ * for SIFTS mappings and must be set prior to performing SIFTS mapping.
+ *
+ * @param dbRef
+ * the source dbRef for the sequence
+ */
public void setSourceDBRef(DBRefEntryI dbRef);
+ /**
+ * Get the distinct source database, and accession number from which a
+ * sequence and its start-end data were derived from.
+ *
+ * @return
+ */
public DBRefEntryI getSourceDBRef();
}
import jalview.schemes.FeatureColourAdapter;
import jalview.schemes.FeatureSettingsAdapter;
import jalview.util.MapList;
-import jalview.util.StringUtils;
import java.awt.Color;
import java.io.UnsupportedEncodingException;
* </ul>
*
* @param query
- * one or more identifiers separated by a space
- * @return an alignment containing one or more genes, and possibly
- * transcripts, or null
+ * a single gene or transcript identifier or gene name
+ * @return an alignment containing a gene, and possibly transcripts, or null
*/
@Override
public AlignmentI getSequenceRecords(String query) throws Exception
{
- // todo: tidy up handling of one or multiple accession ids
- String[] queries = query.split(getAccessionSeparator());
-
/*
- * if given a transcript id, look up its gene parent
+ * convert to a non-duplicated list of gene identifiers
*/
- if (isTranscriptIdentifier(query))
+ List<String> geneIds = getGeneIds(query);
+
+ AlignmentI al = null;
+ for (String geneId : geneIds)
{
- // we are assuming all transcripts have the same gene parent here
- query = new EnsemblLookup(getDomain()).getParent(queries[0]);
- if (query == null)
+ /*
+ * fetch the gene sequence(s) with features and xrefs
+ */
+ AlignmentI geneAlignment = super.getSequenceRecords(geneId);
+
+ if (geneAlignment.getHeight() == 1)
{
- return null;
+ getTranscripts(geneAlignment, geneId);
+ }
+ if (al == null)
+ {
+ al = geneAlignment;
+ }
+ else
+ {
+ al.append(geneAlignment);
}
}
+ return al;
+ }
- /*
- * if given a gene or other external name, lookup and fetch
- * the corresponding gene for all model organisms
- */
- if (!isGeneIdentifier(query))
+ /**
+ * Converts a query, which may contain one or more gene or transcript
+ * identifiers, into a non-redundant list of gene identifiers.
+ *
+ * @param accessions
+ * @return
+ */
+ List<String> getGeneIds(String accessions)
+ {
+ List<String> geneIds = new ArrayList<String>();
+
+ for (String acc : accessions.split(getAccessionSeparator()))
{
- List<String> geneIds = new EnsemblSymbol(getDomain()).getIds(query);
- if (geneIds.isEmpty())
+ if (isGeneIdentifier(acc))
{
- return null;
+ if (!geneIds.contains(acc))
+ {
+ geneIds.add(acc);
+ }
}
- String theIds = StringUtils.listToDelimitedString(geneIds,
- getAccessionSeparator());
- return getSequenceRecords(theIds);
- }
- /*
- * fetch the gene sequence(s) with features and xrefs
- */
- AlignmentI al = super.getSequenceRecords(query);
+ /*
+ * if given a transcript id, look up its gene parent
+ */
+ else if (isTranscriptIdentifier(acc))
+ {
+ String geneId = new EnsemblLookup(getDomain()).getParent(acc);
+ if (geneId != null && !geneIds.contains(geneId))
+ {
+ geneIds.add(geneId);
+ }
+ }
- /*
- * if we retrieved a single gene, get its transcripts as well
- */
- if (al.getHeight() == 1)
- {
- getTranscripts(al, query);
+ /*
+ * if given a gene or other external name, lookup and fetch
+ * the corresponding gene for all model organisms
+ */
+ else
+ {
+ List<String> ids = new EnsemblSymbol(getDomain()).getIds(acc);
+ for (String geneId : ids)
+ {
+ if (!geneIds.contains(geneId))
+ {
+ geneIds.add(geneId);
+ }
+ }
+ }
}
-
- return al;
+ return geneIds;
}
/**
--- /dev/null
+package jalview.ext.ensembl;
+
+/**
+ * A data class to model the data and rest version of one Ensembl domain,
+ * currently for rest.ensembl.org and rest.ensemblgenomes.org
+ *
+ * @author gmcarstairs
+ */
+class EnsemblInfo
+{
+ /*
+ * The http domain this object is holding data values for
+ */
+ String domain;
+
+ /*
+ * The latest version Jalview has tested for, e.g. "4.5"; a minor version change should be
+ * ok, a major version change may break stuff
+ */
+ String expectedRestVersion;
+
+ /*
+ * Major / minor / point version e.g. "4.5.1"
+ * @see http://rest.ensembl.org/info/rest/?content-type=application/json
+ */
+ String restVersion;
+
+ /*
+ * data version
+ * @see http://rest.ensembl.org/info/data/?content-type=application/json
+ */
+ String dataVersion;
+
+ /*
+ * true when http://rest.ensembl.org/info/ping/?content-type=application/json
+ * returns response code 200
+ */
+ boolean restAvailable;
+
+ /*
+ * absolute time when availability was last checked
+ */
+ long lastAvailableCheckTime;
+
+ /*
+ * absolute time when version numbers were last checked
+ */
+ long lastVersionCheckTime;
+
+ // flag set to true if REST major version is not the one expected
+ boolean restMajorVersionMismatch;
+
+ /*
+ * absolute time to wait till if we overloaded the REST service
+ */
+ long retryAfter;
+
+ /**
+ * Constructor given expected REST version number e.g 4.5 or 3.4.3
+ *
+ * @param restExpected
+ */
+ EnsemblInfo(String theDomain, String restExpected)
+ {
+ domain = theDomain;
+ expectedRestVersion = restExpected;
+ lastAvailableCheckTime = -1;
+ lastVersionCheckTime = -1;
+ }
+
+}
package jalview.ext.ensembl;
import jalview.io.FileParse;
+import jalview.util.StringUtils;
import java.io.BufferedReader;
import java.io.DataOutputStream;
import java.net.HttpURLConnection;
import java.net.MalformedURLException;
import java.net.URL;
+import java.util.HashMap;
import java.util.List;
+import java.util.Map;
import javax.ws.rs.HttpMethod;
+import org.json.simple.JSONArray;
+import org.json.simple.JSONObject;
+import org.json.simple.parser.JSONParser;
+
import com.stevesoft.pat.Regex;
/**
*/
abstract class EnsemblRestClient extends EnsemblSequenceFetcher
{
- private final static String ENSEMBL_REST = "http://rest.ensembl.org";
+ /*
+ * update these constants when Jalview has been checked / updated for
+ * changes to Ensembl REST API
+ * @see https://github.com/Ensembl/ensembl-rest/wiki/Change-log
+ */
+ private static final String LATEST_ENSEMBLGENOMES_REST_VERSION = "4.4";
- protected final static String ENSEMBL_GENOMES_REST = "http://rest.ensemblgenomes.org";
+ private static final String LATEST_ENSEMBL_REST_VERSION = "4.5";
+
+ private static Map<String, EnsemblInfo> domainData;
// @see https://github.com/Ensembl/ensembl-rest/wiki/Output-formats
private static final String PING_URL = "http://rest.ensembl.org/info/ping.json";
- private final static long RETEST_INTERVAL = 10000L; // 10 seconds
+ private final static long AVAILABILITY_RETEST_INTERVAL = 10000L; // 10 seconds
+
+ private final static long VERSION_RETEST_INTERVAL = 1000L * 3600; // 1 hr
private static final Regex TRANSCRIPT_REGEX = new Regex(
"(ENS)([A-Z]{3}|)T[0-9]{11}$");
private static final Regex GENE_REGEX = new Regex(
"(ENS)([A-Z]{3}|)G[0-9]{11}$");
- private String domain = ENSEMBL_REST;
-
- private static boolean ensemblRestAvailable = false;
-
- private static long lastCheck = -1;
-
- /*
- * absolute time to wait till if we overloaded the REST service
- */
- private static long retryAfter;
+ static
+ {
+ domainData = new HashMap<String, EnsemblInfo>();
+ domainData.put(ENSEMBL_REST, new EnsemblInfo(ENSEMBL_REST,
+ LATEST_ENSEMBL_REST_VERSION));
+ domainData.put(ENSEMBL_GENOMES_REST, new EnsemblInfo(
+ ENSEMBL_GENOMES_REST, LATEST_ENSEMBLGENOMES_REST_VERSION));
+ }
protected volatile boolean inProgress = false;
*/
public EnsemblRestClient(String d)
{
- domain = d;
- }
-
- String getDomain()
- {
- return domain;
- }
-
- void setDomain(String d)
- {
- domain = d;
+ setDomain(d);
}
+ /**
+ * Answers true if the query matches the regular expression pattern for an
+ * Ensembl transcript stable identifier
+ *
+ * @param query
+ * @return
+ */
public boolean isTranscriptIdentifier(String query)
{
return query == null ? false : TRANSCRIPT_REGEX.search(query);
}
+ /**
+ * Answers true if the query matches the regular expression pattern for an
+ * Ensembl gene stable identifier
+ *
+ * @param query
+ * @return
+ */
public boolean isGeneIdentifier(String query)
{
return query == null ? false : GENE_REGEX.search(query);
* POST method allows multiple queries in one request; it is supported for
* sequence queries, but not for overlap
*/
- boolean multipleIds = ids.size() > 1;// useGetRequest();
+ boolean multipleIds = ids != null && ids.size() > 1;
connection.setRequestMethod(multipleIds ? HttpMethod.POST
: HttpMethod.GET);
connection.setRequestProperty("Content-Type",
// to test:
// retryDelay = "5";
+ EnsemblInfo info = domainData.get(getDomain());
if (retryDelay != null)
{
System.err.println("Ensembl REST service rate limit exceeded, wait "
+ retryDelay + " seconds before retrying");
try
{
- retryAfter = System.currentTimeMillis()
+ info.retryAfter = System.currentTimeMillis()
+ (1000 * Integer.valueOf(retryDelay));
} catch (NumberFormatException e)
{
}
else
{
- retryAfter = 0;
+ info.retryAfter = 0;
// debug:
// System.out.println(String.format(
// "%s Ensembl requests remaining of %s (reset in %ss)",
// remaining, limit, reset));
}
}
+
/**
* Rechecks if Ensembl is responding, unless the last check was successful and
* the retest interval has not yet elapsed. Returns true if Ensembl is up,
- * else false.
+ * else false. Also retrieves and saves the current version of Ensembl data
+ * and REST services at intervals.
*
* @return
*/
protected boolean isEnsemblAvailable()
{
+ EnsemblInfo info = domainData.get(getDomain());
+
long now = System.currentTimeMillis();
/*
* check if we are waiting for 'Retry-After' to expire
*/
- if (retryAfter > now)
+ if (info.retryAfter > now)
{
- System.err.println("Still " + (1 + (retryAfter - now) / 1000)
+ System.err.println("Still " + (1 + (info.retryAfter - now) / 1000)
+ " secs to wait before retrying Ensembl");
return false;
}
else
{
- retryAfter = 0;
+ info.retryAfter = 0;
}
- boolean retest = now - lastCheck > RETEST_INTERVAL;
- if (ensemblRestAvailable && !retest)
+ /*
+ * recheck if Ensembl is up if it was down, or the recheck period has elapsed
+ */
+ boolean retestAvailability = (now - info.lastAvailableCheckTime) > AVAILABILITY_RETEST_INTERVAL;
+ if (!info.restAvailable || retestAvailability)
{
- return true;
+ info.restAvailable = checkEnsembl();
+ info.lastAvailableCheckTime = now;
}
- ensemblRestAvailable = checkEnsembl();
- lastCheck = now;
- return ensemblRestAvailable;
+
+ /*
+ * refetch Ensembl versions if the recheck period has elapsed
+ */
+ boolean refetchVersion = (now - info.lastVersionCheckTime) > VERSION_RETEST_INTERVAL;
+ if (refetchVersion)
+ {
+ checkEnsemblRestVersion();
+ checkEnsemblDataVersion();
+ info.lastVersionCheckTime = now;
+ }
+
+ return info.restAvailable;
}
/**
wr.close();
}
+ /**
+ * Fetches and checks Ensembl's REST version number
+ *
+ * @return
+ */
+ private void checkEnsemblRestVersion()
+ {
+ EnsemblInfo info = domainData.get(getDomain());
+
+ JSONParser jp = new JSONParser();
+ URL url = null;
+ try
+ {
+ url = new URL(getDomain()
+ + "/info/rest?content-type=application/json");
+ BufferedReader br = getHttpResponse(url, null);
+ JSONObject val = (JSONObject) jp.parse(br);
+ String version = val.get("release").toString();
+ String majorVersion = version.substring(0, version.indexOf("."));
+ String expected = info.expectedRestVersion;
+ String expectedMajorVersion = expected.substring(0,
+ expected.indexOf("."));
+ info.restMajorVersionMismatch = false;
+ try
+ {
+ /*
+ * if actual REST major version is ahead of what we expect,
+ * record this in case we want to warn the user
+ */
+ if (Float.valueOf(majorVersion) > Float
+ .valueOf(expectedMajorVersion))
+ {
+ info.restMajorVersionMismatch = true;
+ }
+ } catch (NumberFormatException e)
+ {
+ System.err.println("Error in REST version: " + e.toString());
+ }
+
+ /*
+ * check if REST version is later than what Jalview has tested against,
+ * if so warn; we don't worry if it is earlier (this indicates Jalview has
+ * been tested in advance against the next pending REST version)
+ */
+ boolean laterVersion = StringUtils.compareVersions(version, expected) == 1;
+ if (laterVersion)
+ {
+ System.err.println(String.format(
+ "Expected %s REST version %s but found %s", getDbSource(),
+ expected,
+ version));
+ }
+ info.restVersion = version;
+ } catch (Throwable t)
+ {
+ System.err.println("Error checking Ensembl REST version: "
+ + t.getMessage());
+ }
+ }
+
+ public boolean isRestMajorVersionMismatch()
+ {
+ return domainData.get(getDomain()).restMajorVersionMismatch;
+ }
+
+ /**
+ * Fetches and checks Ensembl's data version number
+ *
+ * @return
+ */
+ private void checkEnsemblDataVersion()
+ {
+ JSONParser jp = new JSONParser();
+ URL url = null;
+ try
+ {
+ url = new URL(getDomain()
+ + "/info/data?content-type=application/json");
+ BufferedReader br = getHttpResponse(url, null);
+ JSONObject val = (JSONObject) jp.parse(br);
+ JSONArray versions = (JSONArray) val.get("releases");
+ domainData.get(getDomain()).dataVersion = versions.get(0).toString();
+ } catch (Throwable t)
+ {
+ System.err.println("Error checking Ensembl data version: "
+ + t.getMessage());
+ }
+ }
+
+ public String getEnsemblDataVersion()
+ {
+ return domainData.get(getDomain()).dataVersion;
+ }
+
+ @Override
+ public String getDbVersion()
+ {
+ return getEnsemblDataVersion();
+ }
+
}
import jalview.io.FileParse;
import jalview.io.gff.SequenceOntologyFactory;
import jalview.io.gff.SequenceOntologyI;
+import jalview.util.Comparison;
import jalview.util.DBRefUtils;
import jalview.util.MapList;
{
private static final String ALLELES = "alleles";
- protected static final String CONSEQUENCE_TYPE = "consequence_type";
-
protected static final String PARENT = "Parent";
protected static final String ID = "ID";
GENOMIC("genomic"),
/**
- * type=cdna to fetch dna including UTRs
+ * type=cdna to fetch coding dna including UTRs
*/
CDNA("cdna"),
ds.setSourceDBRef(proteinSeq.getSourceDBRef());
Mapping map = new Mapping(ds, mapList);
- DBRefEntry dbr = new DBRefEntry(getDbSource(), getDbVersion(),
- proteinSeq.getName(), map);
+ DBRefEntry dbr = new DBRefEntry(getDbSource(),
+ getEnsemblDataVersion(), proteinSeq.getName(), map);
querySeq.getDatasetSequence().addDBRef(dbr);
/*
/*
* and add a reference to itself
*/
- DBRefEntry self = new DBRefEntry(getDbSource(), "0", seq.getName());
+ DBRefEntry self = new DBRefEntry(getDbSource(),
+ getEnsemblDataVersion(), seq.getName());
seq.addDBRef(self);
}
if (ids.contains(name)
|| ids.contains(name.replace("ENSP", "ENST")))
{
- DBRefUtils.parseToDbRef(sq, DBRefSource.ENSEMBL, "0", name);
+ DBRefUtils.parseToDbRef(sq, getDbSource(),
+ getEnsemblDataVersion(), name);
}
}
if (alignment == null)
{
complement.append(",");
}
- if ("HGMD_MUTATION".equalsIgnoreCase(allele))
+
+ /*
+ * some 'alleles' are actually descriptive terms
+ * e.g. HGMD_MUTATION, PhenCode_variation
+ * - we don't want to 'reverse complement' these
+ */
+ if (!Comparison.isNucleotideSequence(allele, true))
{
complement.append(allele);
}
else
{
- char[] alleles = allele.toCharArray();
- for (int i = alleles.length - 1; i >= 0; i--)
+ for (int i = allele.length() - 1; i >= 0; i--)
{
- complement.append(Dna.getComplement(alleles[i]));
+ complement.append(Dna.getComplement(allele.charAt(i)));
}
}
}
private static final Regex ACCESSION_REGEX = new Regex(
"(ENS([A-Z]{3}|)[GTEP]{1}[0-9]{11}$)" + "|" + "(CCDS[0-9.]{3,}$)");
+ protected static final String ENSEMBL_GENOMES_REST = "http://rest.ensemblgenomes.org";
+
+ protected static final String ENSEMBL_REST = "http://rest.ensembl.org";
+
/*
* possible values for the 'feature' parameter of the /overlap REST service
* @see http://rest.ensembl.org/documentation/info/overlap_id
constrained, regulatory
}
+ private String domain = ENSEMBL_REST;
+
@Override
public String getDbSource()
{
// NB ensure Uniprot xrefs are canonicalised from "Ensembl" to "ENSEMBL"
- return DBRefSource.ENSEMBL; // "ENSEMBL"
- }
-
- @Override
- public String getDbVersion()
- {
- return "0";
+ if (ENSEMBL_GENOMES_REST.equals(getDomain()))
+ {
+ return DBRefSource.ENSEMBLGENOMES;
+ }
+ return DBRefSource.ENSEMBL;
}
@Override
{
return true;
}
+
+ /**
+ * Returns the domain name to query e.g. http://rest.ensembl.org or
+ * http://rest.ensemblgenomes.org
+ *
+ * @return
+ */
+ protected String getDomain()
+ {
+ return domain;
+ }
+
+ protected void setDomain(String d)
+ {
+ domain = d;
+ }
}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.api;
+
+/**
+ * This interface provides a model for the summary data;
+ *
+ * @author tcnofoegbu
+ *
+ */
+public interface FTSData
+{
+
+ /**
+ * Return an array of Objects representing the retrieved FTS data
+ *
+ * @return
+ */
+ public Object[] getSummaryData();
+
+ /**
+ * The primary key object for the retrieved FTS data
+ *
+ * @return
+ */
+ public Object getPrimaryKey();
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.api;
+
+/**
+ * This interface provides a model for the dynamic data column configuration
+ *
+ * @author tcnofoegbu
+ *
+ */
+public interface FTSDataColumnI
+{
+ /**
+ * Returns the name of the data column
+ *
+ * @return the data column's name
+ */
+ public String getName();
+
+ /**
+ * Returns the code of the data column
+ *
+ * @return the data column's code
+ */
+ public String getCode();
+
+ /**
+ * Returns the alternative code value for the data column
+ *
+ * @return the data column's code
+ */
+ public String getAltCode();
+
+ /**
+ * Returns the minimum width of the data column
+ *
+ * @return the data column's minimum width
+ */
+ public int getMinWidth();
+
+ /**
+ * Returns the maximum width of the data column
+ *
+ * @return the data column's maximum width
+ */
+ public int getMaxWidth();
+
+ /**
+ * Returns the preferred width of the data column
+ *
+ * @return the data column's preferred width
+ */
+ public int getPreferredWidth();
+
+ /**
+ * Determines if the data column is the primary key column
+ *
+ * @return true if data column is the primary key column, otherwise false
+ */
+ public boolean isPrimaryKeyColumn();
+
+ /**
+ * Checks if the data column field can be used to perform a search query
+ *
+ * @return true means the data column is searchable
+ */
+ public boolean isSearchable();
+
+ /**
+ * Checks if the data column is displayed by default
+ *
+ * @return true means the data column is shown by default
+ */
+ public boolean isVisibleByDefault();
+
+ /**
+ * Returns the data column's FTS data column group
+ *
+ * @return the FTSDataColumnGroupI for the column
+ */
+ public FTSDataColumnGroupI getGroup();
+
+ /**
+ * Returns the data columns data type POJO
+ *
+ * @return the DataTypeI for the column
+ */
+ public DataTypeI getDataType();
+
+ /**
+ * This interface provides a model for the dynamic data column group
+ *
+ */
+ public interface FTSDataColumnGroupI
+ {
+ /**
+ * Returns the Id of the data column's group
+ *
+ * @return the data column's group Id
+ */
+ public String getID();
+
+ /**
+ * Returns the name of the group
+ *
+ * @return the group's name
+ */
+ public String getName();
+
+ /**
+ * Returns the sort order of the group
+ *
+ * @return the group's sort order
+ */
+ public int getSortOrder();
+ }
+
+ public interface DataTypeI
+ {
+ /**
+ * Returns the data column's data type class
+ *
+ * @return the Class for the data column's data type
+ */
+ public Class getDataTypeClass();
+
+ /**
+ * Checks if the numeric data column's data will be formated
+ *
+ * @return true means the numeric data column shall be formatted
+ */
+ public boolean isFormtted();
+
+ /**
+ * Returns the number of significant figure to be used for the numeric value
+ * formatting
+ *
+ * @return the number of significant figures
+ */
+ public int getSignificantFigures();
+ }
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.api;
+
+import jalview.fts.api.FTSDataColumnI.FTSDataColumnGroupI;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+
+import java.util.Collection;
+
+/**
+ * Methods for FTS Rest client.
+ *
+ * @author tcnofoegbu
+ */
+public interface FTSRestClientI
+{
+
+ /**
+ * Execute a given FTS request, process the response and return it as an
+ * FTSRestResponse object
+ *
+ * @param ftsRestRequest
+ * the FTS request to execute
+ * @return FTSRestResponse - the response after executing an FTS request
+ * @throws Exception
+ */
+ public FTSRestResponse executeRequest(FTSRestRequest ftsRequest)
+ throws Exception;
+
+ /**
+ * Return the resource file path for the data columns configuration file
+ *
+ * @return
+ */
+ public String getColumnDataConfigFileName();
+
+ /**
+ * Fetch FTSDataColumnGroupI by the group's Id
+ *
+ * @param groupId
+ * @return FTSDataColumnGroupI
+ * @throws Exception
+ */
+ public FTSDataColumnGroupI getDataColumnGroupById(String groupId)
+ throws Exception;
+
+ /**
+ * Fetch FTSDataColumnI by name or code
+ *
+ * @param nameOrCode
+ * @return FTSDataColumnI
+ * @throws Exception
+ */
+ public FTSDataColumnI getDataColumnByNameOrCode(String nameOrCode)
+ throws Exception;
+
+
+ /**
+ * Convert collection of FTSDataColumnI objects to a comma delimited string of
+ * the 'code' values
+ *
+ * @param wantedFields
+ * the collection of FTSDataColumnI to process
+ * @return the generated comma delimited string from the supplied
+ * FTSDataColumnI collection
+ */
+ public String getDataColumnsFieldsAsCommaDelimitedString(
+ Collection<FTSDataColumnI> wantedFields);
+
+
+ /**
+ * Fetch index of the primary key column for the dynamic table
+ *
+ * @param wantedFields
+ * the available table columns
+ * @param hasRefSeq
+ * true if the data columns has an additional column for reference
+ * sequence
+ * @return index of the primary key column
+ * @throws Exception
+ */
+ public int getPrimaryKeyColumIndex(
+ Collection<FTSDataColumnI> wantedFields, boolean hasRefSeq)
+ throws Exception;
+
+ /**
+ * Fetch the primary key data column object
+ *
+ * @return the FTSDataColumnI object for the primary key column
+ */
+ public FTSDataColumnI getPrimaryKeyColumn();
+
+ /**
+ * Returns list of FTSDataColumnI objects to be displayed by default
+ *
+ * @return list of columns to display by default
+ */
+ public Collection<FTSDataColumnI> getAllDefaulDisplayedDataColumns();
+
+ /**
+ * Return list of FTSDataColumnI objects that can be used to perform a search
+ * query
+ *
+ * @return list of searchable FTSDataColumnI object
+ */
+ public Collection<FTSDataColumnI> getSearchableDataColumns();
+
+ /**
+ * Return list of all available FTSDataColumnI object
+ *
+ * @return list of all FTSColumnI objcet
+ */
+ public Collection<FTSDataColumnI> getAllFTSDataColumns();
+
+ /**
+ * Return the default response page limit
+ *
+ * @return the default response page size
+ */
+ public int getDefaultResponsePageSize();
+}
+
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.api;
+
+import javax.swing.JTable;
+
+/**
+ *
+ * @author tcnofoegbu
+ *
+ */
+public interface GFTSPanelI
+{
+
+ /**
+ * Action performed when a text is entered in the search field.
+ *
+ * @param isFreshSearch
+ * if true a fresh search is executed else a pagination search is
+ * executed
+ */
+ public void searchAction(boolean isFreshSearch);
+
+ /**
+ * Action performed when search results are selected and the 'ok' button is
+ * pressed.
+ */
+ public void okAction();
+
+ /**
+ * Return the entered text
+ *
+ * @return the entered text
+ */
+ public String getTypedText();
+
+ /**
+ * The JTable for presenting the query result
+ *
+ * @return JTable
+ */
+ public JTable getResultTable();
+
+ /**
+ * Return the title to display on the search interface main panel
+ *
+ * @return String - the title
+ */
+ public String getFTSFrameTitle();
+
+ /**
+ * Return a singleton instance of FTSRestClientI
+ *
+ * @return FTSRestClientI
+ */
+ public FTSRestClientI getFTSRestClient();
+
+ /**
+ * Set error message when one occurs
+ *
+ * @param message
+ * the error message to set
+ */
+ public void setErrorMessage(String message);
+
+ /**
+ * Updates the title displayed on the search interface's main panel
+ *
+ * @param newTitle
+ */
+ public void updateSearchFrameTitle(String newTitle);
+
+ /**
+ * Controls the progress spinner, set to 'true' while search operation is in
+ * progress and 'false' after it completes
+ *
+ * @param isSearchInProgress
+ */
+ public void setSearchInProgress(Boolean isSearchInProgress);
+
+ /**
+ * Action performed when previous page (<<) button is pressed pressed.
+ */
+ public void prevPageAction();
+
+ /**
+ * Action performed when next page (>>) button is pressed pressed.
+ */
+ public void nextPageAction();
+
+ /**
+ * Checks if the current service's search result is paginate-able
+ *
+ * @return true means the service provides paginated results
+ */
+ public boolean isPaginationEnabled();
+
+ /**
+ * Updates the 'enabled' state for the previous page button
+ *
+ * @param isEnabled
+ */
+ public void setPrevPageButtonEnabled(boolean isEnabled);
+
+ /**
+ * Updates the 'enabled' state for the next page button
+ *
+ * @param isEnabled
+ */
+ public void setNextPageButtonEnabled(boolean isEnabled);
+}
--- /dev/null
+package jalview.fts.core;
+
+import java.awt.Component;
+import java.text.DecimalFormat;
+
+import javax.swing.JLabel;
+import javax.swing.JTable;
+import javax.swing.table.DefaultTableCellRenderer;
+
+/**
+ * The class to handle the formatting of the double values for JTable cells.
+ */
+public class DecimalFormatTableCellRenderer extends
+ DefaultTableCellRenderer
+{
+ private DecimalFormat formatter;
+
+ public DecimalFormatTableCellRenderer(boolean isFormated,
+ int significantFigures)
+ {
+ String integerFormater = isFormated ? "###,##0" : "0";
+ String fractionFormater = isFormated ? "###,##0." : "0.";
+ if (significantFigures > 0)
+ {
+ StringBuilder significantFigureBuilder = new StringBuilder();
+ for (int x = 1; x <= significantFigures; ++x)
+ {
+ significantFigureBuilder.append("0");
+ }
+ formatter = new DecimalFormat(fractionFormater
+ + significantFigureBuilder.toString());
+ }
+ else
+ {
+ formatter = new DecimalFormat(integerFormater);
+ }
+ super.setHorizontalAlignment(JLabel.RIGHT);
+ }
+
+ public DecimalFormatTableCellRenderer()
+ {
+ super.setHorizontalAlignment(JLabel.RIGHT);
+ }
+
+ @Override
+ public Component getTableCellRendererComponent(JTable table,
+ Object value, boolean isSelected, boolean hasFocus, int row,
+ int column)
+ {
+ if (value == null)
+ {
+ return null;
+ }
+
+ value = formatter.format(value);
+
+ return super.getTableCellRendererComponent(table, value, isSelected,
+ hasFocus, row, column);
+ }
+}
\ No newline at end of file
* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
-package jalview.jbgui;
+package jalview.fts.core;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField.Group;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSDataColumnI.FTSDataColumnGroupI;
+import jalview.fts.api.FTSRestClientI;
import java.util.ArrayList;
import java.util.Collection;
@SuppressWarnings("serial")
-public class PDBDocFieldPreferences extends JScrollPane
+public class FTSDataColumnPreferences extends JScrollPane
{
- protected JTable tbl_pdbDocFieldConfig = new JTable();
+ protected JTable tbl_FTSDataColumnPrefs = new JTable();
protected JScrollPane scrl_pdbDocFieldConfig = new JScrollPane(
- tbl_pdbDocFieldConfig);
+ tbl_FTSDataColumnPrefs);
- private HashMap<String, PDBDocField> map = new HashMap<String, PDBDocField>();
+ private HashMap<String, FTSDataColumnI> map = new HashMap<String, FTSDataColumnI>();
- private static Collection<PDBDocField> searchSummaryFields = new LinkedHashSet<PDBDocField>();
+ private Collection<FTSDataColumnI> structSummaryColumns = new LinkedHashSet<FTSDataColumnI>();
- private static Collection<PDBDocField> structureSummaryFields = new LinkedHashSet<PDBDocField>();
+ private Collection<FTSDataColumnI> allFTSDataColumns = new LinkedHashSet<FTSDataColumnI>();
public enum PreferenceSource
{
private PreferenceSource currentSource;
- static
- {
- searchSummaryFields.add(PDBDocField.PDB_ID);
- searchSummaryFields.add(PDBDocField.TITLE);
- searchSummaryFields.add(PDBDocField.RESOLUTION);
-
- structureSummaryFields.add(PDBDocField.PDB_ID);
- structureSummaryFields.add(PDBDocField.TITLE);
- structureSummaryFields.add(PDBDocField.RESOLUTION);
- }
+ private FTSRestClientI ftsRestClient;
- public PDBDocFieldPreferences(PreferenceSource source)
+ public FTSDataColumnPreferences(PreferenceSource source,
+ FTSRestClientI ftsRestClient)
{
- tbl_pdbDocFieldConfig.setAutoCreateRowSorter(true);
+ this.ftsRestClient = ftsRestClient;
+ Collection<FTSDataColumnI> defaultCols = ftsRestClient
+ .getAllDefaulDisplayedDataColumns();
+ structSummaryColumns.addAll(defaultCols);
+ allFTSDataColumns.addAll(ftsRestClient.getAllFTSDataColumns());
- this.getViewport().add(tbl_pdbDocFieldConfig);
+ tbl_FTSDataColumnPrefs.setAutoCreateRowSorter(true);
+ this.getViewport().add(tbl_FTSDataColumnPrefs);
this.currentSource = source;
String[] columnNames = null;
break;
}
- Object[][] data = new Object[PDBDocField.values().length - 1][3];
+ Object[][] data = new Object[allFTSDataColumns.size() - 1][3];
+
int x = 0;
- for (PDBDocField field : PDBDocField.values())
+ for (FTSDataColumnI field : allFTSDataColumns)
{
if (field.getName().equalsIgnoreCase("all"))
{
switch (source)
{
case SEARCH_SUMMARY:
- data[x++] = new Object[] { searchSummaryFields.contains(field),
+ data[x++] = new Object[] {
+ ftsRestClient.getAllDefaulDisplayedDataColumns()
+ .contains(field),
field.getName(), field.getGroup() };
break;
case STRUCTURE_CHOOSER:
- data[x++] = new Object[] { structureSummaryFields.contains(field),
+ data[x++] = new Object[] { structSummaryColumns.contains(field),
field.getName(), field.getGroup() };
break;
case PREFERENCES:
data[x++] = new Object[] { field.getName(),
- searchSummaryFields.contains(field),
- structureSummaryFields.contains(field) };
+ ftsRestClient.getAllDefaulDisplayedDataColumns()
+ .contains(field),
+ structSummaryColumns.contains(field) };
break;
default:
break;
map.put(field.getName(), field);
}
- PDBFieldTableModel model = new PDBFieldTableModel(columnNames, data);
- tbl_pdbDocFieldConfig.setModel(model);
+ FTSDataColumnPrefsTableModel model = new FTSDataColumnPrefsTableModel(columnNames, data);
+ tbl_FTSDataColumnPrefs.setModel(model);
switch (source)
{
case SEARCH_SUMMARY:
case STRUCTURE_CHOOSER:
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(0)
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(0)
.setPreferredWidth(30);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(0).setMinWidth(20);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(0).setMaxWidth(40);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(1)
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(0).setMinWidth(20);
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(0).setMaxWidth(40);
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(1)
.setPreferredWidth(150);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(1).setMinWidth(150);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(2)
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(1).setMinWidth(150);
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(2)
.setPreferredWidth(150);
- tbl_pdbDocFieldConfig.getColumnModel().getColumn(2)
+ tbl_FTSDataColumnPrefs.getColumnModel().getColumn(2)
.setMinWidth(150);
TableRowSorter<TableModel> sorter = new TableRowSorter<>(
- tbl_pdbDocFieldConfig.getModel());
- tbl_pdbDocFieldConfig.setRowSorter(sorter);
+ tbl_FTSDataColumnPrefs.getModel());
+ tbl_FTSDataColumnPrefs.setRowSorter(sorter);
List<RowSorter.SortKey> sortKeys = new ArrayList<>();
int columnIndexToSort = 2;
sortKeys.add(new RowSorter.SortKey(columnIndexToSort,
sorter.setSortKeys(sortKeys);
sorter.setComparator(
columnIndexToSort,
- new Comparator<jalview.ws.dbsources.PDBRestClient.PDBDocField.Group>()
+ new Comparator<FTSDataColumnGroupI>()
{
@Override
- public int compare(Group o1, Group o2)
+ public int compare(FTSDataColumnGroupI o1,
+ FTSDataColumnGroupI o2)
{
return o1.getSortOrder() - o2.getSortOrder();
}
});
sorter.sort();
- tbl_pdbDocFieldConfig
+ tbl_FTSDataColumnPrefs
.setAutoResizeMode(JTable.AUTO_RESIZE_NEXT_COLUMN);
break;
case PREFERENCES:
}
- public static Collection<PDBDocField> getSearchSummaryFields()
+ public Collection<FTSDataColumnI> getStructureSummaryFields()
{
- return searchSummaryFields;
+ return structSummaryColumns;
}
- public static void setSearchSummaryFields(
- Collection<PDBDocField> searchSummaryFields)
+ class FTSDataColumnPrefsTableModel extends AbstractTableModel
{
- PDBDocFieldPreferences.searchSummaryFields = searchSummaryFields;
- }
-
- public static Collection<PDBDocField> getStructureSummaryFields()
- {
- return structureSummaryFields;
- }
- public static void setStructureSummaryFields(
- Collection<PDBDocField> structureSummaryFields)
- {
- PDBDocFieldPreferences.structureSummaryFields = structureSummaryFields;
- }
-
- class PDBFieldTableModel extends AbstractTableModel
- {
-
- public PDBFieldTableModel(String[] columnNames, Object[][] data)
+ public FTSDataColumnPrefsTableModel(String[] columnNames, Object[][] data)
{
this.data = data;
this.columnNames = columnNames;
{
case SEARCH_SUMMARY:
case STRUCTURE_CHOOSER:
- return (col == 0) && !isPDBID(row, 1);
+ return (col == 0) && !isPrimaryKeyCell(row, 1);
case PREFERENCES:
- return (col == 1 || col == 2) && !isPDBID(row, 0);
+ return (col == 1 || col == 2) && !isPrimaryKeyCell(row, 0);
default:
return false;
}
* @return
*/
- public boolean isPDBID(int row, int col)
+ public boolean isPrimaryKeyCell(int row, int col)
{
- boolean matched = false;
String name = getValueAt(row, col).toString();
- PDBDocField pdbField = map.get(name);
- if (pdbField == PDBDocField.PDB_ID)
- {
- matched = true;
- }
- return matched;
+ FTSDataColumnI pdbField = map.get(name);
+ return pdbField.isPrimaryKeyColumn();
}
/*
}
boolean selected = ((Boolean) value).booleanValue();
- PDBDocField pdbField = map.get(name);
+ FTSDataColumnI ftsDataColumn = map.get(name);
if (currentSource == PreferenceSource.SEARCH_SUMMARY)
{
- updatePrefs(searchSummaryFields, pdbField, selected);
+ updatePrefs(ftsRestClient
+ .getAllDefaulDisplayedDataColumns(), ftsDataColumn,
+ selected);
}
else if (currentSource == PreferenceSource.STRUCTURE_CHOOSER)
{
- updatePrefs(structureSummaryFields, pdbField, selected);
+ updatePrefs(structSummaryColumns, ftsDataColumn, selected);
}
else if (currentSource == PreferenceSource.PREFERENCES)
{
if (col == 1)
{
- updatePrefs(searchSummaryFields, pdbField, selected);
+ updatePrefs(ftsRestClient
+ .getAllDefaulDisplayedDataColumns(), ftsDataColumn,
+ selected);
}
else if (col == 2)
{
- updatePrefs(structureSummaryFields, pdbField, selected);
+ updatePrefs(structSummaryColumns, ftsDataColumn, selected);
}
}
}
- private void updatePrefs(Collection<PDBDocField> prefConfig,
- PDBDocField pdbField, boolean selected)
+ private void updatePrefs(
+ Collection<FTSDataColumnI> prefConfig,
+ FTSDataColumnI dataColumn, boolean selected)
{
- if (prefConfig.contains(pdbField) && !selected)
+ if (prefConfig.contains(dataColumn) && !selected)
{
- prefConfig.remove(pdbField);
+ prefConfig.remove(dataColumn);
}
- if (!prefConfig.contains(pdbField) && selected)
+ if (!prefConfig.contains(dataColumn) && selected)
{
- prefConfig.add(pdbField);
+ prefConfig.add(dataColumn);
}
}
--- /dev/null
+package jalview.fts.core;
+
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSDataColumnI.FTSDataColumnGroupI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.util.MessageManager;
+
+import java.io.BufferedReader;
+import java.io.IOException;
+import java.io.InputStream;
+import java.io.InputStreamReader;
+import java.util.ArrayList;
+import java.util.Collection;
+import java.util.Objects;
+
+/**
+ * Base class providing implementation for common methods defined in
+ * FTSRestClientI
+ *
+ * @author tcnofoegbu
+ *
+ * @note implementations MUST be accessed as a singleton.
+ */
+public abstract class FTSRestClient implements FTSRestClientI
+{
+ protected Collection<FTSDataColumnI> dataColumns = new ArrayList<FTSDataColumnI>();
+
+ protected Collection<FTSDataColumnGroupI> dataColumnGroups = new ArrayList<FTSDataColumnGroupI>();
+
+ protected Collection<FTSDataColumnI> searchableDataColumns = new ArrayList<FTSDataColumnI>();
+
+ protected Collection<FTSDataColumnI> defaulDisplayedDataColumns = new ArrayList<FTSDataColumnI>();
+
+ protected FTSDataColumnI primaryKeyColumn;
+
+ private String primaryKeyColumnCode = null;
+
+ private int defaultResponsePageSize = 100;
+
+ protected FTSRestClient()
+ {
+
+ }
+
+ public void parseDataColumnsConfigFile()
+ {
+ String fileName = getColumnDataConfigFileName();
+
+ InputStream in = getClass().getResourceAsStream(fileName);
+
+ try (BufferedReader br = new BufferedReader(new InputStreamReader(in)))
+ {
+ String line;
+ while ((line = br.readLine()) != null)
+ {
+ final String[] lineData = line.split(";");
+ try
+ {
+ if (lineData.length == 2)
+ {
+ if (lineData[0].equalsIgnoreCase("_data_column.primary_key"))
+ {
+ primaryKeyColumnCode = lineData[1];
+ }
+ if (lineData[0]
+ .equalsIgnoreCase("_data_column.default_response_page_size"))
+ {
+ defaultResponsePageSize = Integer.valueOf(lineData[1]);
+ }
+ }
+ else if (lineData.length == 3)
+ {
+ dataColumnGroups.add(new FTSDataColumnGroupI()
+ {
+ @Override
+ public String getID()
+ {
+ return lineData[0];
+ }
+
+ @Override
+ public String getName()
+ {
+ return lineData[1];
+ }
+
+ @Override
+ public int getSortOrder()
+ {
+ return Integer.valueOf(lineData[2]);
+ }
+
+ @Override
+ public String toString()
+ {
+ return lineData[1];
+ }
+
+ @Override
+ public int hashCode()
+ {
+ return Objects.hash(this.getID(), this.getName(),
+ this.getSortOrder());
+ }
+
+ @Override
+ public boolean equals(Object otherObject)
+ {
+ FTSDataColumnGroupI that = (FTSDataColumnGroupI) otherObject;
+ return this.getID().equals(that.getID())
+ && this.getName().equals(that.getName())
+ && this.getSortOrder() == that.getSortOrder();
+ }
+ });
+ }
+ else if (lineData.length > 6)
+ {
+ FTSDataColumnI dataCol = new FTSDataColumnI()
+ {
+ @Override
+ public String toString()
+ {
+ return lineData[0];
+ }
+
+ @Override
+ public String getName()
+ {
+ return lineData[0];
+ }
+
+ @Override
+ public String getCode()
+ {
+ return lineData[1].split("\\|")[0];
+ }
+
+ @Override
+ public String getAltCode()
+ {
+ return lineData[1].split("\\|").length > 1 ? lineData[1]
+ .split("\\|")[1] : getCode();
+ }
+
+ @Override
+ public DataTypeI getDataType()
+ {
+ final String[] dataTypeString = lineData[2].split("\\|");
+ final String classString = dataTypeString[0].toUpperCase();
+
+ return new DataTypeI()
+ {
+
+ @Override
+ public boolean isFormtted()
+ {
+ if (dataTypeString.length > 1
+ && dataTypeString[1] != null)
+ {
+ switch (dataTypeString[1].toUpperCase())
+ {
+ case "T":
+ case "TRUE":
+ return true;
+ case "F":
+ case "False":
+ default:
+ return false;
+ }
+ }
+ return false;
+ }
+
+ @Override
+ public int getSignificantFigures()
+ {
+ if (dataTypeString.length > 2
+ && dataTypeString[2] != null)
+ {
+ return Integer.valueOf(dataTypeString[2]);
+ }
+ return 0;
+ }
+
+ @Override
+ public Class getDataTypeClass()
+ {
+ switch (classString)
+ {
+ case "INT":
+ case "INTEGER":
+ return Integer.class;
+ case "DOUBLE":
+ return Double.class;
+ case "STRING":
+ default:
+ return String.class;
+ }
+ }
+ };
+
+ }
+
+ @Override
+ public FTSDataColumnGroupI getGroup()
+ {
+ FTSDataColumnGroupI group = null;
+ try
+ {
+ group = getDataColumnGroupById(lineData[3]);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ return group;
+ }
+
+ @Override
+ public int getMinWidth()
+ {
+ return Integer.valueOf(lineData[4]);
+ }
+
+ @Override
+ public int getMaxWidth()
+ {
+ return Integer.valueOf(lineData[5]);
+ }
+
+ @Override
+ public int getPreferredWidth()
+ {
+ return Integer.valueOf(lineData[6]);
+ }
+
+ @Override
+ public boolean isPrimaryKeyColumn()
+ {
+ return getName().equalsIgnoreCase(primaryKeyColumnCode)
+ || getCode().equalsIgnoreCase(primaryKeyColumnCode);
+ }
+
+ @Override
+ public boolean isVisibleByDefault()
+ {
+ return Boolean.valueOf(lineData[7]);
+ }
+
+ @Override
+ public boolean isSearchable()
+ {
+ return Boolean.valueOf(lineData[8]);
+ }
+
+ @Override
+ public int hashCode()
+ {
+ return Objects.hash(this.getName(), this.getCode(),
+ this.getGroup());
+ }
+
+
+ @Override
+ public boolean equals(Object otherObject)
+ {
+ FTSDataColumnI that = (FTSDataColumnI) otherObject;
+ return this.getCode().equals(that.getCode())
+ && this.getName().equals(that.getName())
+ && this.getGroup().equals(that.getGroup());
+ }
+
+
+ };
+ dataColumns.add(dataCol);
+
+ if (dataCol.isSearchable())
+ {
+ searchableDataColumns.add(dataCol);
+ }
+
+ if (dataCol.isVisibleByDefault())
+ {
+ defaulDisplayedDataColumns.add(dataCol);
+ }
+
+ }
+ else
+ {
+ continue;
+ }
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ }
+ try
+ {
+ this.primaryKeyColumn = getDataColumnByNameOrCode(primaryKeyColumnCode);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ } catch (IOException e)
+ {
+ e.printStackTrace();
+ }
+ }
+
+ @Override
+ public int getPrimaryKeyColumIndex(
+ Collection<FTSDataColumnI> wantedFields, boolean hasRefSeq)
+ throws Exception
+ {
+
+ // If a reference sequence is attached then start counting from 1 else
+ // start from zero
+ int pdbFieldIndexCounter = hasRefSeq ? 1 : 0;
+
+ for (FTSDataColumnI field : wantedFields)
+ {
+ if (field.isPrimaryKeyColumn())
+ {
+ break; // Once PDB Id index is determined exit iteration
+ }
+ ++pdbFieldIndexCounter;
+ }
+ return pdbFieldIndexCounter;
+ }
+
+ @Override
+ public String getDataColumnsFieldsAsCommaDelimitedString(
+ Collection<FTSDataColumnI> dataColumnFields)
+ {
+ String result = "";
+ if (dataColumnFields != null && !dataColumnFields.isEmpty())
+ {
+ StringBuilder returnedFields = new StringBuilder();
+ for (FTSDataColumnI field : dataColumnFields)
+ {
+ returnedFields.append(",").append(field.getCode());
+ }
+ returnedFields.deleteCharAt(0);
+ result = returnedFields.toString();
+ }
+ return result;
+ }
+
+
+ @Override
+ public Collection<FTSDataColumnI> getAllFTSDataColumns()
+ {
+ if (dataColumns == null || dataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ return dataColumns;
+ }
+
+ @Override
+ public Collection<FTSDataColumnI> getSearchableDataColumns()
+ {
+ if (searchableDataColumns == null || searchableDataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ return searchableDataColumns;
+ }
+
+ @Override
+ public Collection<FTSDataColumnI> getAllDefaulDisplayedDataColumns()
+ {
+ if (defaulDisplayedDataColumns == null
+ || defaulDisplayedDataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ return defaulDisplayedDataColumns;
+ }
+
+ @Override
+ public FTSDataColumnI getPrimaryKeyColumn()
+ {
+ if (defaulDisplayedDataColumns == null
+ || defaulDisplayedDataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ return primaryKeyColumn;
+ }
+
+ @Override
+ public FTSDataColumnI getDataColumnByNameOrCode(String nameOrCode)
+ throws Exception
+ {
+ if (dataColumns == null || dataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ for (FTSDataColumnI column : dataColumns)
+ {
+ if (column.getName().equalsIgnoreCase(nameOrCode)
+ || column.getCode().equalsIgnoreCase(nameOrCode))
+ {
+ return column;
+ }
+ }
+ throw new Exception("Couldn't find data column with name : "
+ + nameOrCode);
+ }
+
+ @Override
+ public FTSDataColumnGroupI getDataColumnGroupById(String id)
+ throws Exception
+ {
+ if (dataColumns == null || dataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ for (FTSDataColumnGroupI columnGroup : dataColumnGroups)
+ {
+ if (columnGroup.getID().equalsIgnoreCase(id))
+ {
+ return columnGroup;
+ }
+ }
+ throw new Exception("Couldn't find data column group with id : " + id);
+ }
+
+ public String getMessageByHTTPStatusCode(int code, String service)
+ {
+ String message = "";
+ switch (code)
+ {
+ case 400:
+ message = MessageManager
+ .getString("exception.bad_request");
+ break;
+
+ case 410:
+ message = MessageManager.formatMessage(
+ "exception.fts_rest_service_no_longer_available", service);
+ break;
+ case 403:
+ case 404:
+ message = MessageManager.getString("exception.resource_not_be_found");
+ break;
+ case 408:
+ case 409:
+ case 500:
+ case 501:
+ case 502:
+ case 504:
+ case 505:
+ message = MessageManager.getString("exception.fts_server_error");
+ break;
+ case 503:
+ message = MessageManager.getString("exception.service_not_available");
+ break;
+ default:
+ break;
+ }
+ return message;
+ }
+
+ protected String getResourceFile(String fileName)
+ {
+ String result = "";
+ try
+ {
+ result = getClass().getResource(fileName).getFile();
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ return result;
+
+ }
+
+ @Override
+ public int getDefaultResponsePageSize()
+ {
+ if (dataColumns == null || dataColumns.isEmpty())
+ {
+ parseDataColumnsConfigFile();
+ }
+ return defaultResponsePageSize;
+ }
+
+}
/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2)
- * Copyright (C) 2014 The Jalview Authors
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
-package jalview.ws.uimodel;
+package jalview.fts.core;
import jalview.bin.Cache;
import jalview.datamodel.SequenceI;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
+import jalview.fts.api.FTSDataColumnI;
import java.util.Collection;
/**
- * Represents the PDB request to be consumed by the PDBRestClient
+ * Represents the FTS request to be consumed by the FTSRestClient
*
* @author tcnofoegbu
*
*/
-public class PDBRestRequest
+public class FTSRestRequest
{
private String fieldToSearchBy;
private int responseSize;
+ private int offSet;
+
private boolean isSortAscending;
- private Collection<PDBDocField> wantedFields;
+ private Collection<FTSDataColumnI> wantedFields;
public String getFieldToSearchBy()
{
this.responseSize = responseSize;
}
- public Collection<PDBDocField> getWantedFields()
+ public Collection<FTSDataColumnI> getWantedFields()
{
return wantedFields;
}
- public void setWantedFields(Collection<PDBDocField> wantedFields)
+ public void setWantedFields(
+ Collection<FTSDataColumnI> wantedFields)
{
this.wantedFields = wantedFields;
}
this.associatedSequence = associatedSequence;
}
- public String getQuery()
- {
- return fieldToSearchBy + searchTerm
- + (isAllowEmptySeq() ? "" : " AND molecule_sequence:['' TO *]")
- + (isAllowUnpublishedEntries() ? "" : " AND status:REL");
- }
-
- @Override
- public String toString()
- {
- return "Query : " + getQuery() + " sort field: " + fieldToSortBy
- + " isAsc: " + isAscending() + " Associated Seq : "
- + associatedSequence;
- }
-
public boolean isAllowUnpublishedEntries()
{
return allowUnpublishedEntries;
{
this.facetPivotMinCount = facetPivotMinCount;
}
+
+ public int getOffSet()
+ {
+ return offSet;
+ }
+
+ public void setOffSet(int offSet)
+ {
+ this.offSet = offSet;
+ }
}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.core;
+
+import jalview.fts.api.FTSData;
+import jalview.fts.api.FTSDataColumnI;
+
+import java.util.Collection;
+
+import javax.swing.JTable;
+import javax.swing.table.DefaultTableModel;
+
+/**
+ * Represents the response model generated by the FTSRestClient upon successful
+ * execution of a given FTS request
+ *
+ * @author tcnofoegbu
+ *
+ */
+public class FTSRestResponse
+{
+ private int numberOfItemsFound;
+
+ private String responseTime;
+
+ private Collection<FTSData> searchSummary;
+
+ public int getNumberOfItemsFound()
+ {
+ return numberOfItemsFound;
+ }
+
+ public void setNumberOfItemsFound(int itemFound)
+ {
+ this.numberOfItemsFound = itemFound;
+ }
+
+ public String getResponseTime()
+ {
+ return responseTime;
+ }
+
+ public void setResponseTime(String responseTime)
+ {
+ this.responseTime = responseTime;
+ }
+
+ public Collection<FTSData> getSearchSummary()
+ {
+ return searchSummary;
+ }
+
+ public void setSearchSummary(Collection<FTSData> searchSummary)
+ {
+ this.searchSummary = searchSummary;
+ }
+
+ /**
+ * Convenience method to obtain a Table model for a given summary List based
+ * on the request parameters
+ *
+ * @param request
+ * the FTSRestRequest object which holds useful information for
+ * creating a table model
+ * @param summariesList
+ * the summary list which contains the data for populating the
+ * table's rows
+ * @return the table model which was dynamically generated
+ */
+ public static DefaultTableModel getTableModel(FTSRestRequest request,
+ Collection<FTSData> summariesList)
+ {
+ final FTSDataColumnI[] cols = request.getWantedFields()
+ .toArray(new FTSDataColumnI[0]);
+ final int colOffset = request.getAssociatedSequence() == null ? 0 : 1;
+ DefaultTableModel tableModel = new DefaultTableModel()
+ {
+ @Override
+ public boolean isCellEditable(int row, int column)
+ {
+ return false;
+ }
+
+ @Override
+ public Class<?> getColumnClass(int columnIndex)
+ {
+ if (colOffset == 1 && columnIndex == 0)
+ {
+ return String.class;
+ }
+ return cols[columnIndex - colOffset].getDataType()
+ .getDataTypeClass();
+ }
+
+ };
+ if (request.getAssociatedSequence() != null)
+ {
+ tableModel.addColumn("Ref Sequence"); // Create sequence column header if
+ // exists in the request
+ }
+ for (FTSDataColumnI field : request
+ .getWantedFields())
+ {
+ tableModel.addColumn(field.getName()); // Create sequence column header if
+ // exists in the request
+ }
+
+ for (FTSData res : summariesList)
+ {
+ tableModel.addRow(res.getSummaryData()); // Populate table rows with
+ // summary list
+ }
+
+ return tableModel;
+ }
+
+ public static void configureTableColumn(JTable tbl_summary,
+ Collection<FTSDataColumnI> wantedFields)
+ {
+ for (FTSDataColumnI wantedField : wantedFields)
+ {
+ try
+ {
+ tbl_summary.getColumn(wantedField.getName()).setMinWidth(
+ wantedField.getMinWidth());
+ tbl_summary.getColumn(wantedField.getName()).setMaxWidth(
+ wantedField.getMaxWidth());
+ tbl_summary.getColumn(wantedField.getName()).setPreferredWidth(
+ wantedField.getPreferredWidth());
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ if (wantedField.getDataType().getDataTypeClass() == Double.class)
+ {
+ DecimalFormatTableCellRenderer dfr = new DecimalFormatTableCellRenderer(
+ wantedField.getDataType().isFormtted(),
+ wantedField.getDataType().getSignificantFigures());
+ tbl_summary.getColumn(wantedField.getName()).setCellRenderer(dfr);
+ }
+ else if (wantedField.getDataType().getDataTypeClass() == Integer.class)
+ {
+ DecimalFormatTableCellRenderer dfr = new DecimalFormatTableCellRenderer(
+ wantedField.getDataType().isFormtted(),
+ wantedField.getDataType().getSignificantFigures());
+ tbl_summary.getColumn(wantedField.getName()).setCellRenderer(dfr);
+ }
+ }
+ }
+
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.core;
+
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.GFTSPanelI;
+import jalview.fts.core.FTSDataColumnPreferences.PreferenceSource;
+import jalview.gui.Desktop;
+import jalview.gui.IProgressIndicator;
+import jalview.gui.JvSwingUtils;
+import jalview.gui.SequenceFetcher;
+import jalview.util.MessageManager;
+
+import java.awt.BorderLayout;
+import java.awt.CardLayout;
+import java.awt.Dimension;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.FocusEvent;
+import java.awt.event.FocusListener;
+import java.awt.event.KeyAdapter;
+import java.awt.event.KeyEvent;
+import java.awt.event.MouseAdapter;
+import java.awt.event.MouseEvent;
+import java.text.DecimalFormat;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Collection;
+import java.util.Collections;
+import java.util.Comparator;
+import java.util.HashSet;
+import java.util.List;
+
+import javax.swing.ImageIcon;
+import javax.swing.JButton;
+import javax.swing.JComboBox;
+import javax.swing.JFrame;
+import javax.swing.JInternalFrame;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JScrollPane;
+import javax.swing.JTabbedPane;
+import javax.swing.JTable;
+import javax.swing.JTextField;
+import javax.swing.Timer;
+import javax.swing.event.ChangeEvent;
+import javax.swing.event.ChangeListener;
+import javax.swing.event.DocumentEvent;
+import javax.swing.event.DocumentListener;
+import javax.swing.table.DefaultTableModel;
+import javax.swing.table.TableColumn;
+
+/**
+ * This class provides the swing GUI layout for FTS Panel and implements most of
+ * the contracts defined in GFSPanelI
+ *
+ * @author tcnofoegbu
+ *
+ */
+
+@SuppressWarnings("serial")
+public abstract class GFTSPanel extends JPanel implements GFTSPanelI
+{
+ protected JInternalFrame mainFrame = new JInternalFrame(
+ getFTSFrameTitle());
+
+ protected IProgressIndicator progressIdicator;
+
+ protected JComboBox<FTSDataColumnI> cmb_searchTarget = new JComboBox<FTSDataColumnI>();
+
+ protected JButton btn_ok = new JButton();
+
+ protected JButton btn_back = new JButton();
+
+ protected JButton btn_cancel = new JButton();
+
+ protected JTextField txt_search = new JTextField(30);
+
+ protected SequenceFetcher seqFetcher;
+
+ protected Collection<FTSDataColumnI> wantedFields;
+
+ private String lastSearchTerm = "";
+
+ protected JButton btn_next_page = new JButton();
+
+ protected JButton btn_prev_page = new JButton();
+
+ protected StringBuilder errorWarning = new StringBuilder();
+
+ protected ImageIcon warningImage = new ImageIcon(getClass().getResource(
+ "/images/warning.gif"));
+
+ protected ImageIcon loadingImage = new ImageIcon(getClass().getResource(
+ "/images/loading.gif"));
+
+ protected ImageIcon balnkPlaceholderImage = new ImageIcon(getClass()
+ .getResource("/images/blank_16x16_placeholder.png"));
+
+ protected JLabel lbl_warning = new JLabel(warningImage);
+
+ protected JLabel lbl_loading = new JLabel(loadingImage);
+
+ protected JLabel lbl_blank = new JLabel(balnkPlaceholderImage);
+
+ private JTabbedPane tabbedPane = new JTabbedPane();
+
+ private JPanel pnl_actions = new JPanel();
+
+ private JPanel pnl_results = new JPanel(new CardLayout());
+
+ private JPanel pnl_inputs = new JPanel();
+
+ private BorderLayout mainLayout = new BorderLayout();
+
+ protected Object[] previousWantedFields;
+
+ protected int resultSetCount;
+
+ protected int totalResultSetCount;
+
+ protected int offSet;
+
+ protected int pageLimit;
+
+ protected HashSet<String> paginatorCart = new HashSet<String>();
+
+ protected static final DecimalFormat totalNumberformatter = new DecimalFormat(
+ "###,###");
+
+ private JTable tbl_summary = new JTable()
+ {
+ private boolean inLayout;
+
+ @Override
+ public boolean getScrollableTracksViewportWidth()
+ {
+ return hasExcessWidth();
+
+ }
+
+ @Override
+ public void doLayout()
+ {
+ if (hasExcessWidth())
+ {
+ autoResizeMode = AUTO_RESIZE_SUBSEQUENT_COLUMNS;
+ }
+ inLayout = true;
+ super.doLayout();
+ inLayout = false;
+ autoResizeMode = AUTO_RESIZE_OFF;
+ }
+
+ protected boolean hasExcessWidth()
+ {
+ return getPreferredSize().width < getParent().getWidth();
+ }
+
+ @Override
+ public void columnMarginChanged(ChangeEvent e)
+ {
+ if (isEditing())
+ {
+ removeEditor();
+ }
+ TableColumn resizingColumn = getTableHeader().getResizingColumn();
+ // Need to do this here, before the parent's
+ // layout manager calls getPreferredSize().
+ if (resizingColumn != null && autoResizeMode == AUTO_RESIZE_OFF
+ && !inLayout)
+ {
+ resizingColumn.setPreferredWidth(resizingColumn.getWidth());
+ }
+ resizeAndRepaint();
+ }
+
+ @Override
+ public String getToolTipText(MouseEvent evt)
+ {
+ String toolTipText = null;
+ java.awt.Point pnt = evt.getPoint();
+ int rowIndex = rowAtPoint(pnt);
+ int colIndex = columnAtPoint(pnt);
+
+ try
+ {
+ if (getValueAt(rowIndex, colIndex) == null)
+ {
+ return null;
+ }
+ toolTipText = getValueAt(rowIndex, colIndex).toString();
+
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ toolTipText = (toolTipText == null ? null
+ : (toolTipText.length() > 500 ? JvSwingUtils.wrapTooltip(
+ true, toolTipText.subSequence(0, 500) + "...")
+ : JvSwingUtils.wrapTooltip(true, toolTipText)));
+
+ return toolTipText;
+ }
+ };
+ protected JScrollPane scrl_searchResult = new JScrollPane(tbl_summary);
+
+ public GFTSPanel()
+ {
+ try
+ {
+ jbInit();
+ mainFrame.invalidate();
+ mainFrame.pack();
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ }
+
+ /**
+ * Initializes the GUI default properties
+ *
+ * @throws Exception
+ */
+ private void jbInit() throws Exception
+ {
+ lbl_warning.setVisible(false);
+ lbl_warning.setFont(new java.awt.Font("Verdana", 0, 12));
+ lbl_loading.setVisible(false);
+ lbl_loading.setFont(new java.awt.Font("Verdana", 0, 12));
+ lbl_blank.setVisible(true);
+ lbl_blank.setFont(new java.awt.Font("Verdana", 0, 12));
+
+ tbl_summary.setAutoCreateRowSorter(true);
+ tbl_summary.getTableHeader().setReorderingAllowed(false);
+ tbl_summary.addMouseListener(new MouseAdapter()
+ {
+ @Override
+ public void mouseClicked(MouseEvent e)
+ {
+ validateSelection();
+ }
+
+ @Override
+ public void mouseReleased(MouseEvent e)
+ {
+ validateSelection();
+ }
+ });
+ tbl_summary.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ validateSelection();
+ switch (evt.getKeyCode())
+ {
+ case KeyEvent.VK_ESCAPE: // escape key
+ btn_back_ActionPerformed();
+ break;
+ case KeyEvent.VK_ENTER: // enter key
+ if (btn_ok.isEnabled())
+ {
+ okAction();
+ }
+ evt.consume();
+ break;
+ case KeyEvent.VK_TAB: // tab key
+ if (evt.isShiftDown())
+ {
+ tabbedPane.requestFocus();
+ }
+ else
+ {
+ btn_back.requestFocus();
+ }
+ evt.consume();
+ break;
+ default:
+ return;
+ }
+ }
+ });
+
+ btn_back.setFont(new java.awt.Font("Verdana", 0, 12));
+ btn_back.setText(MessageManager.getString("action.back"));
+ btn_back.addActionListener(new java.awt.event.ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ btn_back_ActionPerformed();
+ }
+ });
+ btn_back.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ if (evt.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ btn_back_ActionPerformed();
+ }
+ }
+ });
+
+ btn_ok.setEnabled(false);
+ btn_ok.setFont(new java.awt.Font("Verdana", 0, 12));
+ btn_ok.setText(MessageManager.getString("action.ok"));
+ btn_ok.addActionListener(new java.awt.event.ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ okAction();
+ }
+ });
+ btn_ok.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ if (evt.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ okAction();
+ }
+ }
+ });
+ btn_next_page.setEnabled(false);
+ btn_next_page.setToolTipText(MessageManager
+ .getString("label.next_page_tooltop"));
+ btn_next_page.setFont(new java.awt.Font("Verdana", 0, 12));
+ btn_next_page.setText(MessageManager.getString("action.next_page"));
+ btn_next_page.addActionListener(new java.awt.event.ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ nextPageAction();
+ }
+ });
+ btn_next_page.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ if (evt.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ nextPageAction();
+ }
+ }
+ });
+
+ btn_prev_page.setEnabled(false);
+ btn_prev_page.setToolTipText(MessageManager
+ .getString("label.prev_page_tooltop"));
+ btn_prev_page.setFont(new java.awt.Font("Verdana", 0, 12));
+ btn_prev_page.setText(MessageManager.getString("action.prev_page"));
+ btn_prev_page.addActionListener(new java.awt.event.ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ prevPageAction();
+ }
+ });
+ btn_prev_page.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ if (evt.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ prevPageAction();
+ }
+ }
+ });
+
+ if (isPaginationEnabled())
+ {
+ btn_prev_page.setVisible(true);
+ btn_next_page.setVisible(true);
+ }
+ else
+ {
+ btn_prev_page.setVisible(false);
+ btn_next_page.setVisible(false);
+ }
+
+ btn_cancel.setFont(new java.awt.Font("Verdana", 0, 12));
+ btn_cancel.setText(MessageManager.getString("action.cancel"));
+ btn_cancel.addActionListener(new java.awt.event.ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ btn_cancel_ActionPerformed();
+ }
+ });
+ btn_cancel.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent evt)
+ {
+ if (evt.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ btn_cancel_ActionPerformed();
+ }
+ }
+ });
+ scrl_searchResult.setPreferredSize(new Dimension(800, 400));
+
+ cmb_searchTarget.setFont(new java.awt.Font("Verdana", 0, 12));
+ cmb_searchTarget.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ String tooltipText;
+ if ("all".equalsIgnoreCase(getCmbSearchTarget().getSelectedItem()
+ .toString()))
+ {
+ tooltipText = MessageManager.getString("label.search_all");
+ }
+ else if ("pdb id".equalsIgnoreCase(getCmbSearchTarget()
+ .getSelectedItem().toString()))
+ {
+ tooltipText = MessageManager
+ .getString("label.separate_multiple_accession_ids");
+ }
+ else
+ {
+ tooltipText = MessageManager.formatMessage(
+ "label.separate_multiple_query_values",
+ new Object[] { getCmbSearchTarget().getSelectedItem()
+ .toString() });
+ }
+ txt_search.setToolTipText(JvSwingUtils.wrapTooltip(true,
+ tooltipText));
+ searchAction(true);
+ }
+ });
+
+ populateCmbSearchTargetOptions();
+
+ txt_search.setFont(new java.awt.Font("Verdana", 0, 12));
+
+ txt_search.addKeyListener(new KeyAdapter()
+ {
+ @Override
+ public void keyPressed(KeyEvent e)
+ {
+ if (e.getKeyCode() == KeyEvent.VK_ENTER)
+ {
+ if (txt_search.getText() == null
+ || txt_search.getText().isEmpty())
+ {
+ return;
+ }
+ String primaryKeyName = getFTSRestClient().getPrimaryKeyColumn()
+ .getName();
+ if (primaryKeyName.equalsIgnoreCase(getCmbSearchTarget()
+ .getSelectedItem().toString()))
+ {
+ transferToSequenceFetcher(txt_search.getText());
+ }
+ }
+ }
+ });
+
+ final DeferredTextInputListener listener = new DeferredTextInputListener(
+ 1500,
+ new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ if (!getTypedText().equalsIgnoreCase(lastSearchTerm))
+ {
+ searchAction(true);
+ paginatorCart.clear();
+ lastSearchTerm = getTypedText();
+ }
+ }
+ }, false);
+ txt_search.getDocument().addDocumentListener(listener);
+ txt_search.addFocusListener(new FocusListener()
+ {
+ @Override
+ public void focusGained(FocusEvent e)
+ {
+ listener.start();
+ }
+
+ @Override
+ public void focusLost(FocusEvent e)
+ {
+// listener.stop();
+ }
+ });
+
+ final String searchTabTitle = MessageManager
+ .getString("label.search_result");
+ final String configureCols = MessageManager
+ .getString("label.configure_displayed_columns");
+ ChangeListener changeListener = new ChangeListener()
+ {
+ @Override
+ public void stateChanged(ChangeEvent changeEvent)
+ {
+ JTabbedPane sourceTabbedPane = (JTabbedPane) changeEvent
+ .getSource();
+ int index = sourceTabbedPane.getSelectedIndex();
+
+ btn_back.setVisible(true);
+ btn_cancel.setVisible(true);
+ btn_ok.setVisible(true);
+ if (sourceTabbedPane.getTitleAt(index).equals(configureCols))
+ {
+ btn_back.setVisible(false);
+ btn_cancel.setVisible(false);
+ btn_ok.setVisible(false);
+ btn_back.setEnabled(false);
+ btn_cancel.setEnabled(false);
+ btn_ok.setEnabled(false);
+ btn_next_page.setEnabled(false);
+ btn_prev_page.setEnabled(false);
+ txt_search.setEnabled(false);
+ cmb_searchTarget.setEnabled(false);
+ previousWantedFields = getFTSRestClient()
+ .getAllDefaulDisplayedDataColumns()
+ .toArray(new Object[0]);
+ }
+ if (sourceTabbedPane.getTitleAt(index).equals(searchTabTitle))
+ {
+ btn_back.setEnabled(true);
+ btn_cancel.setEnabled(true);
+ refreshPaginatorState();
+ txt_search.setEnabled(true);
+ cmb_searchTarget.setEnabled(true);
+ if (wantedFieldsUpdated())
+ {
+ searchAction(true);
+ paginatorCart.clear();
+ }
+ else
+ {
+ validateSelection();
+ }
+ }
+ }
+ };
+ tabbedPane.addChangeListener(changeListener);
+ tabbedPane.setPreferredSize(new Dimension(800, 400));
+ tabbedPane.add(searchTabTitle, scrl_searchResult);
+ tabbedPane.add(configureCols, new FTSDataColumnPreferences(
+ PreferenceSource.SEARCH_SUMMARY, getFTSRestClient()));
+
+ pnl_actions.add(btn_back);
+ pnl_actions.add(btn_ok);
+ pnl_actions.add(btn_cancel);
+
+ pnl_results.add(tabbedPane);
+ pnl_inputs.add(cmb_searchTarget);
+ pnl_inputs.add(txt_search);
+ pnl_inputs.add(lbl_loading);
+ pnl_inputs.add(lbl_warning);
+ pnl_inputs.add(lbl_blank);
+ pnl_inputs.add(btn_prev_page);
+ pnl_inputs.add(btn_next_page);
+
+ this.setLayout(mainLayout);
+ this.add(pnl_inputs, java.awt.BorderLayout.NORTH);
+ this.add(pnl_results, java.awt.BorderLayout.CENTER);
+ this.add(pnl_actions, java.awt.BorderLayout.SOUTH);
+ mainFrame.setVisible(true);
+ mainFrame.setContentPane(this);
+ mainFrame.setDefaultCloseOperation(JFrame.DISPOSE_ON_CLOSE);
+ Desktop.addInternalFrame(mainFrame, getFTSFrameTitle(), 900, 500);
+ }
+
+ public class DeferredTextInputListener implements DocumentListener
+ {
+ private final Timer swingTimer;
+
+ public DeferredTextInputListener(int timeOut, ActionListener listener,
+ boolean repeats)
+ {
+ swingTimer = new Timer(timeOut, listener);
+ swingTimer.setRepeats(repeats);
+ }
+
+ public void start()
+ {
+ swingTimer.start();
+ }
+
+ public void stop()
+ {
+ swingTimer.stop();
+ }
+
+ @Override
+ public void insertUpdate(DocumentEvent e)
+ {
+ swingTimer.restart();
+ }
+
+ @Override
+ public void removeUpdate(DocumentEvent e)
+ {
+ swingTimer.restart();
+ }
+
+ @Override
+ public void changedUpdate(DocumentEvent e)
+ {
+ swingTimer.restart();
+ }
+
+ }
+
+ public boolean wantedFieldsUpdated()
+ {
+ if (previousWantedFields == null)
+ {
+ return true;
+ }
+
+ return Arrays.equals(getFTSRestClient()
+ .getAllDefaulDisplayedDataColumns()
+ .toArray(new Object[0]), previousWantedFields) ? false
+ : true;
+
+ }
+
+ public void validateSelection()
+ {
+ if (tbl_summary.getSelectedRows().length > 0
+ || !paginatorCart.isEmpty())
+ {
+ btn_ok.setEnabled(true);
+ }
+ else
+ {
+ btn_ok.setEnabled(false);
+ }
+ }
+
+ public JComboBox<FTSDataColumnI> getCmbSearchTarget()
+ {
+ return cmb_searchTarget;
+ }
+
+ public JTextField getTxtSearch()
+ {
+ return txt_search;
+ }
+
+ public JInternalFrame getMainFrame()
+ {
+ return mainFrame;
+ }
+
+ protected void delayAndEnableActionButtons()
+ {
+ new Thread()
+ {
+ @Override
+ public void run()
+ {
+ try
+ {
+ Thread.sleep(1500);
+ } catch (InterruptedException e)
+ {
+ e.printStackTrace();
+ }
+ btn_ok.setEnabled(true);
+ btn_back.setEnabled(true);
+ btn_cancel.setEnabled(true);
+ }
+ }.start();
+ }
+
+ protected void checkForErrors()
+ {
+ lbl_warning.setVisible(false);
+ lbl_blank.setVisible(true);
+ if (errorWarning.length() > 0)
+ {
+ lbl_loading.setVisible(false);
+ lbl_blank.setVisible(false);
+ lbl_warning.setToolTipText(JvSwingUtils.wrapTooltip(true,
+ errorWarning.toString()));
+ lbl_warning.setVisible(true);
+ }
+ }
+
+ protected void btn_back_ActionPerformed()
+ {
+ mainFrame.dispose();
+ new SequenceFetcher(progressIdicator);
+ }
+
+ protected void disableActionButtons()
+ {
+ btn_ok.setEnabled(false);
+ btn_back.setEnabled(false);
+ btn_cancel.setEnabled(false);
+ }
+
+ protected void btn_cancel_ActionPerformed()
+ {
+ mainFrame.dispose();
+ }
+
+ /**
+ * Populates search target combo-box options
+ */
+ public void populateCmbSearchTargetOptions()
+ {
+ List<FTSDataColumnI> searchableTargets = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ Collection<FTSDataColumnI> foundFTSTargets = getFTSRestClient()
+ .getSearchableDataColumns();
+ searchableTargets.addAll(foundFTSTargets);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+
+ Collections.sort(searchableTargets, new Comparator<FTSDataColumnI>()
+ {
+ @Override
+ public int compare(FTSDataColumnI o1, FTSDataColumnI o2)
+ {
+ return o1.getName().compareTo(o2.getName());
+ }
+ });
+
+ for (FTSDataColumnI searchTarget : searchableTargets)
+ {
+ cmb_searchTarget.addItem(searchTarget);
+ }
+ }
+
+
+ public void transferToSequenceFetcher(String ids)
+ {
+ // mainFrame.dispose();
+ seqFetcher.getTextArea().setText(ids);
+ Thread worker = new Thread(seqFetcher);
+ worker.start();
+ }
+
+ @Override
+ public String getTypedText()
+ {
+ return txt_search.getText().trim();
+ }
+
+ @Override
+ public JTable getResultTable()
+ {
+ return tbl_summary;
+ }
+
+ public void reset()
+ {
+ lbl_loading.setVisible(false);
+ errorWarning.setLength(0);
+ lbl_warning.setVisible(false);
+ lbl_blank.setVisible(true);
+ btn_ok.setEnabled(false);
+ mainFrame.setTitle(getFTSFrameTitle());
+ referesh();
+ tbl_summary.setModel(new DefaultTableModel());
+ tbl_summary.setVisible(false);
+ }
+
+ @Override
+ public void setPrevPageButtonEnabled(boolean isEnabled)
+ {
+ btn_prev_page.setEnabled(isEnabled);
+ }
+
+ @Override
+ public void setNextPageButtonEnabled(boolean isEnabled)
+ {
+ btn_next_page.setEnabled(isEnabled);
+ }
+
+ @Override
+ public void setErrorMessage(String message)
+ {
+ errorWarning.append(message);
+ }
+
+ @Override
+ public void updateSearchFrameTitle(String title)
+ {
+ mainFrame.setTitle(title);
+ }
+
+ @Override
+ public void setSearchInProgress(Boolean isSearchInProgress)
+ {
+ lbl_blank.setVisible(!isSearchInProgress);
+ lbl_loading.setVisible(isSearchInProgress);
+ }
+
+ @Override
+ public void prevPageAction()
+ {
+ updatePaginatorCart();
+ if (offSet >= pageLimit)
+ {
+ offSet = offSet - pageLimit;
+ searchAction(false);
+ }
+ else
+ {
+ refreshPaginatorState();
+ }
+ }
+
+ @Override
+ public void nextPageAction()
+ {
+ updatePaginatorCart();
+ offSet = offSet + pageLimit;
+ searchAction(false);
+ }
+
+ public void updatePaginatorCart()
+ {
+ int primaryKeyColIndex = 0;
+ JTable resultTable = getResultTable();
+ int totalRows = resultTable.getRowCount();
+ try
+ {
+ primaryKeyColIndex = getFTSRestClient().getPrimaryKeyColumIndex(
+ wantedFields, false);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+
+ for (int row = 0; row < totalRows; row++)
+ {
+ String id = (String) resultTable.getValueAt(row, primaryKeyColIndex);
+ if (paginatorCart.contains(id))
+ {
+ paginatorCart.remove(id);
+ }
+ }
+ int[] selectedRows = resultTable.getSelectedRows();
+ for (int summaryRow : selectedRows)
+ {
+ String idStr = resultTable.getValueAt(summaryRow,
+ primaryKeyColIndex).toString();
+ paginatorCart.add(idStr);
+ }
+ // System.out.println("Paginator shopping cart size : "
+ // + paginatorCart.size());
+ }
+
+ public void updateSummaryTableSelections()
+ {
+ JTable resultTable = getResultTable();
+ if (paginatorCart.isEmpty())
+ {
+ return;
+ }
+ int primaryKeyColIndex = 0;
+ try
+ {
+ primaryKeyColIndex = getFTSRestClient().getPrimaryKeyColumIndex(
+ wantedFields, false);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ // System.out.println(">>>>>> got here : 1");
+ int totalRows = resultTable.getRowCount();
+ // resultTable.clearSelection();
+ for (int row = 0; row < totalRows; row++)
+ {
+ String id = (String) resultTable.getValueAt(row, primaryKeyColIndex);
+ if (paginatorCart.contains(id))
+ {
+ resultTable.addRowSelectionInterval(row, row);
+ }
+ }
+ validateSelection();
+ }
+ public void refreshPaginatorState()
+ {
+ // System.out.println("resultSet count : " + resultSetCount);
+ // System.out.println("offSet : " + offSet);
+ // System.out.println("page limit : " + pageLimit);
+ setPrevPageButtonEnabled(false);
+ setNextPageButtonEnabled(false);
+ if (resultSetCount == 0 && pageLimit == 0)
+ {
+ return;
+ }
+ if (resultSetCount >= pageLimit)
+ {
+ setNextPageButtonEnabled(true);
+ }
+ if (offSet >= pageLimit)
+ {
+ setPrevPageButtonEnabled(true);
+ }
+ }
+ public void referesh()
+ {
+ mainFrame.setTitle(getFTSFrameTitle());
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.service.pdb;
+
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+import jalview.fts.core.GFTSPanel;
+import jalview.gui.SequenceFetcher;
+import jalview.util.MessageManager;
+
+import java.util.HashSet;
+
+@SuppressWarnings("serial")
+public class PDBFTSPanel extends GFTSPanel
+{
+ private static String defaultFTSFrameTitle = MessageManager
+ .getString("label.pdb_sequence_fetcher");
+
+ private String ftsFrameTitle = defaultFTSFrameTitle;
+
+ public PDBFTSPanel(SequenceFetcher seqFetcher)
+ {
+ pageLimit = PDBFTSRestClient.getInstance().getDefaultResponsePageSize();
+ this.seqFetcher = seqFetcher;
+ this.progressIdicator = (seqFetcher == null) ? null : seqFetcher
+ .getProgressIndicator();
+ }
+
+
+ @Override
+ public void searchAction(boolean isFreshSearch)
+ {
+ if (isFreshSearch)
+ {
+ offSet = 0;
+ }
+ new Thread()
+ {
+ @Override
+ public void run()
+ {
+ ftsFrameTitle = defaultFTSFrameTitle;
+ reset();
+ boolean allowEmptySequence = false;
+ if (getTypedText().length() > 0)
+ {
+ setSearchInProgress(true);
+ long startTime = System.currentTimeMillis();
+
+ String searchTarget = ((FTSDataColumnI) cmb_searchTarget
+ .getSelectedItem()).getCode();
+ wantedFields = PDBFTSRestClient.getInstance()
+ .getAllDefaulDisplayedDataColumns();
+ String searchTerm = decodeSearchTerm(txt_search.getText(),
+ searchTarget);
+
+ FTSRestRequest request = new FTSRestRequest();
+ request.setAllowEmptySeq(allowEmptySequence);
+ request.setResponseSize(100);
+ request.setFieldToSearchBy("(" + searchTarget + ":");
+ request.setSearchTerm(searchTerm + ")");
+ request.setOffSet(offSet);
+ request.setWantedFields(wantedFields);
+ FTSRestClientI pdbRestCleint = PDBFTSRestClient.getInstance();
+ FTSRestResponse resultList;
+ try
+ {
+ resultList = pdbRestCleint.executeRequest(request);
+ } catch (Exception e)
+ {
+ setErrorMessage(e.getMessage());
+ checkForErrors();
+ return;
+ }
+
+ if (resultList.getSearchSummary() != null
+ && resultList.getSearchSummary().size() > 0)
+ {
+ getResultTable().setModel(
+ FTSRestResponse.getTableModel(request,
+ resultList.getSearchSummary()));
+ FTSRestResponse.configureTableColumn(getResultTable(),
+ wantedFields);
+ getResultTable().setVisible(true);
+ }
+
+ long endTime = System.currentTimeMillis();
+ totalResultSetCount = resultList.getNumberOfItemsFound();
+ resultSetCount = resultList.getSearchSummary() == null ? 0
+ : resultList.getSearchSummary().size();
+ String result = (resultSetCount > 0) ? MessageManager
+ .getString("label.results") : MessageManager
+ .getString("label.result");
+
+ if (isPaginationEnabled() && resultSetCount > 0)
+ {
+ updateSearchFrameTitle(defaultFTSFrameTitle + " - " + result
+ + " "
+ + totalNumberformatter.format((Number) (offSet + 1))
+ + " to "
+ + totalNumberformatter
+ .format((Number) (offSet + resultSetCount))
+ + " of "
+ + totalNumberformatter
+ .format((Number) totalResultSetCount)
+ + " " + " (" + (endTime - startTime) + " milli secs)");
+ }
+ else
+ {
+ updateSearchFrameTitle(defaultFTSFrameTitle + " - "
+ + resultSetCount + " " + result + " ("
+ + (endTime - startTime) + " milli secs)");
+ }
+
+ setSearchInProgress(false);
+ refreshPaginatorState();
+ updateSummaryTableSelections();
+ }
+ }
+ }.start();
+ }
+
+ public static String decodeSearchTerm(String enteredText,
+ String targetField)
+ {
+ String foundSearchTerms = enteredText;
+ StringBuilder foundSearchTermsBuilder = new StringBuilder();
+ if (enteredText.contains(";"))
+ {
+ String[] searchTerms = enteredText.split(";");
+ for (String searchTerm : searchTerms)
+ {
+ if (searchTerm.contains(":"))
+ {
+ foundSearchTermsBuilder.append(targetField).append(":")
+ .append(searchTerm.split(":")[0]).append(" OR ");
+ }
+ else
+ {
+ foundSearchTermsBuilder.append(targetField).append(":")
+ .append(searchTerm).append(" OR ");
+ }
+ }
+ int endIndex = foundSearchTermsBuilder.lastIndexOf(" OR ");
+ foundSearchTerms = foundSearchTermsBuilder.toString();
+ if (foundSearchTerms.contains(" OR "))
+ {
+ foundSearchTerms = foundSearchTerms.substring(
+ targetField.length() + 1, endIndex);
+ }
+ }
+ else if (enteredText.contains(":"))
+ {
+ foundSearchTerms = foundSearchTerms.split(":")[0];
+ }
+ return foundSearchTerms;
+ }
+
+ @Override
+ public void okAction()
+ {
+ // mainFrame.dispose();
+ disableActionButtons();
+ StringBuilder selectedIds = new StringBuilder();
+ HashSet<String> selectedIdsSet = new HashSet<String>();
+ int primaryKeyColIndex = 0;
+ try
+ {
+ primaryKeyColIndex = getFTSRestClient().getPrimaryKeyColumIndex(
+ wantedFields,
+ false);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ int[] selectedRows = getResultTable().getSelectedRows();
+ String searchTerm = txt_search.getText();
+ for (int summaryRow : selectedRows)
+ {
+ String idStr = getResultTable().getValueAt(summaryRow,
+ primaryKeyColIndex)
+ .toString();
+ selectedIdsSet.add(getPDBIdwithSpecifiedChain(idStr, searchTerm));
+ }
+
+ for (String idStr : paginatorCart)
+ {
+ selectedIdsSet.add(getPDBIdwithSpecifiedChain(idStr, searchTerm));
+ }
+
+ for (String selectedId : selectedIdsSet)
+ {
+ selectedIds.append(selectedId).append(";");
+ }
+
+ String ids = selectedIds.toString();
+ // System.out.println(">>>>>>>>>>>>>>>> selected Ids: " + ids);
+ seqFetcher.getTextArea().setText(ids);
+ Thread worker = new Thread(seqFetcher);
+ worker.start();
+ delayAndEnableActionButtons();
+ }
+
+
+ public static String getPDBIdwithSpecifiedChain(String pdbId,
+ String searchTerm)
+ {
+ String pdbIdWithChainCode = "";
+ if (searchTerm.contains(";"))
+ {
+ String[] foundTerms = searchTerm.split(";");
+ for (String foundTerm : foundTerms)
+ {
+ if (foundTerm.contains(pdbId))
+ {
+ pdbIdWithChainCode = foundTerm;
+ }
+ }
+ }
+ else if (searchTerm.contains(pdbId))
+ {
+ pdbIdWithChainCode = searchTerm;
+ }
+ else
+ {
+ pdbIdWithChainCode = pdbId;
+ }
+ return pdbIdWithChainCode;
+ }
+
+ @Override
+ public FTSRestClientI getFTSRestClient()
+ {
+ return PDBFTSRestClient.getInstance();
+ }
+
+ @Override
+ public String getFTSFrameTitle()
+ {
+ return ftsFrameTitle;
+ }
+
+ @Override
+ public boolean isPaginationEnabled()
+ {
+ return true;
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.fts.service.pdb;
+
+import jalview.datamodel.SequenceI;
+import jalview.fts.api.FTSData;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.fts.core.FTSRestClient;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+import jalview.util.MessageManager;
+
+import java.util.ArrayList;
+import java.util.Collection;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Objects;
+
+import javax.ws.rs.core.MediaType;
+
+import org.json.simple.JSONArray;
+import org.json.simple.JSONObject;
+import org.json.simple.parser.JSONParser;
+import org.json.simple.parser.ParseException;
+
+import com.sun.jersey.api.client.Client;
+import com.sun.jersey.api.client.ClientResponse;
+import com.sun.jersey.api.client.WebResource;
+import com.sun.jersey.api.client.config.ClientConfig;
+import com.sun.jersey.api.client.config.DefaultClientConfig;
+
+/**
+ * A rest client for querying the Search endpoint of the PDB API
+ *
+ * @author tcnofoegbu
+ *
+ */
+public class PDBFTSRestClient extends FTSRestClient
+{
+
+ private static FTSRestClientI instance = null;
+
+ public static final String PDB_SEARCH_ENDPOINT = "http://www.ebi.ac.uk/pdbe/search/pdb/select?";
+
+ protected PDBFTSRestClient()
+ {
+ }
+
+ /**
+ * Takes a PDBRestRequest object and returns a response upon execution
+ *
+ * @param pdbRestRequest
+ * the PDBRestRequest instance to be processed
+ * @return the pdbResponse object for the given request
+ * @throws Exception
+ */
+ @Override
+ public FTSRestResponse executeRequest(FTSRestRequest pdbRestRequest)
+ throws Exception
+ {
+ try
+ {
+ ClientConfig clientConfig = new DefaultClientConfig();
+ Client client = Client.create(clientConfig);
+
+ String wantedFields = getDataColumnsFieldsAsCommaDelimitedString(pdbRestRequest
+ .getWantedFields());
+ int responseSize = (pdbRestRequest.getResponseSize() == 0) ? getDefaultResponsePageSize()
+ : pdbRestRequest.getResponseSize();
+ int offSet = pdbRestRequest.getOffSet();
+ String sortParam = null;
+ if (pdbRestRequest.getFieldToSortBy() == null
+ || pdbRestRequest.getFieldToSortBy().trim().isEmpty())
+ {
+ sortParam = "";
+ }
+ else
+ {
+ if (pdbRestRequest.getFieldToSortBy()
+ .equalsIgnoreCase("Resolution"))
+ {
+ sortParam = pdbRestRequest.getFieldToSortBy()
+ + (pdbRestRequest.isAscending() ? " asc" : " desc");
+ }
+ else
+ {
+ sortParam = pdbRestRequest.getFieldToSortBy()
+ + (pdbRestRequest.isAscending() ? " desc" : " asc");
+ }
+ }
+
+ String facetPivot = (pdbRestRequest.getFacetPivot() == null || pdbRestRequest
+ .getFacetPivot().isEmpty()) ? "" : pdbRestRequest
+ .getFacetPivot();
+ String facetPivotMinCount = String.valueOf(pdbRestRequest
+ .getFacetPivotMinCount());
+
+ String query = pdbRestRequest.getFieldToSearchBy()
+ + pdbRestRequest.getSearchTerm()
+ + (pdbRestRequest.isAllowEmptySeq() ? ""
+ : " AND molecule_sequence:['' TO *]")
+ + (pdbRestRequest.isAllowUnpublishedEntries() ? ""
+ : " AND status:REL");
+
+ // Build request parameters for the REST Request
+ WebResource webResource = null;
+ if (pdbRestRequest.isFacet())
+ {
+ webResource = client.resource(PDB_SEARCH_ENDPOINT)
+ .queryParam("wt", "json").queryParam("fl", wantedFields)
+ .queryParam("rows", String.valueOf(responseSize))
+ .queryParam("q", query)
+ .queryParam("start", String.valueOf(offSet))
+ .queryParam("sort", sortParam).queryParam("facet", "true")
+ .queryParam("facet.pivot", facetPivot)
+ .queryParam("facet.pivot.mincount", facetPivotMinCount);
+ }
+ else
+ {
+ webResource = client.resource(PDB_SEARCH_ENDPOINT)
+ .queryParam("wt", "json").queryParam("fl", wantedFields)
+ .queryParam("rows", String.valueOf(responseSize))
+ .queryParam("start", String.valueOf(offSet))
+ .queryParam("q", query)
+ .queryParam("sort", sortParam);
+ }
+ // Execute the REST request
+ ClientResponse clientResponse = webResource.accept(
+ MediaType.APPLICATION_JSON).get(ClientResponse.class);
+
+ // Get the JSON string from the response object
+ String responseString = clientResponse.getEntity(String.class);
+ // System.out.println("query >>>>>>> " + pdbRestRequest.toString());
+
+ // Check the response status and report exception if one occurs
+ if (clientResponse.getStatus() != 200)
+ {
+ String errorMessage = "";
+ if (clientResponse.getStatus() == 400)
+ {
+ errorMessage = parseJsonExceptionString(responseString);
+ throw new Exception(errorMessage);
+ }
+ else
+ {
+ errorMessage = getMessageByHTTPStatusCode(clientResponse
+.getStatus(), "PDB");
+ throw new Exception(errorMessage);
+ }
+ }
+
+ // Make redundant objects eligible for garbage collection to conserve
+ // memory
+ clientResponse = null;
+ client = null;
+
+ // Process the response and return the result to the caller.
+ return parsePDBJsonResponse(responseString, pdbRestRequest);
+ } catch (Exception e)
+ {
+ String exceptionMsg = e.getMessage();
+ if (exceptionMsg.contains("SocketException"))
+ {
+ // No internet connection
+ throw new Exception(
+ MessageManager
+ .getString("exception.unable_to_detect_internet_connection"));
+ }
+ else if (exceptionMsg.contains("UnknownHostException"))
+ {
+ // The server 'www.ebi.ac.uk' is unreachable
+ throw new Exception(MessageManager.formatMessage(
+ "exception.fts_server_unreachable", "PDB Solr"));
+ }
+ else
+ {
+ throw e;
+ }
+ }
+ }
+
+
+ /**
+ * Process error response from PDB server if/when one occurs.
+ *
+ * @param jsonResponse
+ * the JSON string containing error message from the server
+ * @return the processed error message from the JSON string
+ */
+ public static String parseJsonExceptionString(String jsonErrorResponse)
+ {
+ StringBuilder errorMessage = new StringBuilder(
+ "\n============= PDB Rest Client RunTime error =============\n");
+
+ try
+ {
+ JSONParser jsonParser = new JSONParser();
+ JSONObject jsonObj = (JSONObject) jsonParser.parse(jsonErrorResponse);
+ JSONObject errorResponse = (JSONObject) jsonObj.get("error");
+
+ JSONObject responseHeader = (JSONObject) jsonObj
+ .get("responseHeader");
+ JSONObject paramsObj = (JSONObject) responseHeader.get("params");
+ String status = responseHeader.get("status").toString();
+ String message = errorResponse.get("msg").toString();
+ String query = paramsObj.get("q").toString();
+ String fl = paramsObj.get("fl").toString();
+
+ errorMessage.append("Status: ").append(status).append("\n");
+ errorMessage.append("Message: ").append(message).append("\n");
+ errorMessage.append("query: ").append(query).append("\n");
+ errorMessage.append("fl: ").append(fl).append("\n");
+
+ } catch (ParseException e)
+ {
+ e.printStackTrace();
+ }
+ return errorMessage.toString();
+ }
+
+ /**
+ * Parses the JSON response string from PDB REST API. The response is dynamic
+ * hence, only fields specifically requested for in the 'wantedFields'
+ * parameter is fetched/processed
+ *
+ * @param pdbJsonResponseString
+ * the JSON string to be parsed
+ * @param pdbRestRequest
+ * the request object which contains parameters used to process the
+ * JSON string
+ * @return
+ */
+ @SuppressWarnings("unchecked")
+ public static FTSRestResponse parsePDBJsonResponse(
+ String pdbJsonResponseString, FTSRestRequest pdbRestRequest)
+ {
+ FTSRestResponse searchResult = new FTSRestResponse();
+ List<FTSData> result = null;
+ try
+ {
+ JSONParser jsonParser = new JSONParser();
+ JSONObject jsonObj = (JSONObject) jsonParser
+ .parse(pdbJsonResponseString);
+
+ JSONObject pdbResponse = (JSONObject) jsonObj.get("response");
+ String queryTime = ((JSONObject) jsonObj.get("responseHeader")).get(
+ "QTime").toString();
+ int numFound = Integer
+ .valueOf(pdbResponse.get("numFound").toString());
+ if (numFound > 0)
+ {
+ result = new ArrayList<FTSData>();
+ JSONArray docs = (JSONArray) pdbResponse.get("docs");
+ for (Iterator<JSONObject> docIter = docs.iterator(); docIter
+ .hasNext();)
+ {
+ JSONObject doc = docIter.next();
+ result.add(getFTSData(doc, pdbRestRequest));
+ }
+ searchResult.setNumberOfItemsFound(numFound);
+ searchResult.setResponseTime(queryTime);
+ searchResult.setSearchSummary(result);
+ }
+ } catch (ParseException e)
+ {
+ e.printStackTrace();
+ }
+ return searchResult;
+ }
+
+ public static FTSData getFTSData(JSONObject pdbJsonDoc,
+ FTSRestRequest request)
+ {
+
+ String primaryKey = null;
+
+ Object[] summaryRowData;
+
+ SequenceI associatedSequence;
+
+ Collection<FTSDataColumnI> diplayFields = request.getWantedFields();
+ SequenceI associatedSeq = request.getAssociatedSequence();
+ int colCounter = 0;
+ summaryRowData = new Object[(associatedSeq != null) ? diplayFields
+ .size() + 1 : diplayFields.size()];
+ if (associatedSeq != null)
+ {
+ associatedSequence = associatedSeq;
+ summaryRowData[0] = associatedSequence;
+ colCounter = 1;
+ }
+
+ for (FTSDataColumnI field : diplayFields)
+ {
+ String fieldData = (pdbJsonDoc.get(field.getCode()) == null) ? ""
+ : pdbJsonDoc.get(field.getCode()).toString();
+ if (field.isPrimaryKeyColumn())
+ {
+ primaryKey = fieldData;
+ summaryRowData[colCounter++] = primaryKey;
+ }
+ else if (fieldData == null || fieldData.isEmpty())
+ {
+ summaryRowData[colCounter++] = null;
+ }
+ else
+ {
+ try
+ {
+ summaryRowData[colCounter++] = (field.getDataType()
+ .getDataTypeClass() == Integer.class) ? Integer
+ .valueOf(fieldData)
+ : (field.getDataType()
+ .getDataTypeClass() == Double.class) ? Double
+ .valueOf(fieldData)
+ : sanitiseData(fieldData);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ System.out.println("offending value:" + fieldData);
+ }
+ }
+ }
+
+ final String primaryKey1 = primaryKey;
+
+ final Object[] summaryRowData1 = summaryRowData;
+ return new FTSData()
+ {
+ @Override
+ public Object[] getSummaryData()
+ {
+ return summaryRowData1;
+ }
+
+ @Override
+ public Object getPrimaryKey()
+ {
+ return primaryKey1;
+ }
+
+ /**
+ * Returns a string representation of this object;
+ */
+ @Override
+ public String toString()
+ {
+ StringBuilder summaryFieldValues = new StringBuilder();
+ for (Object summaryField : summaryRowData1)
+ {
+ summaryFieldValues.append(
+ summaryField == null ? " " : summaryField.toString())
+ .append("\t");
+ }
+ return summaryFieldValues.toString();
+ }
+
+ /**
+ * Returns hash code value for this object
+ */
+ @Override
+ public int hashCode()
+ {
+ return Objects.hash(primaryKey1, this.toString());
+ }
+
+ @Override
+ public boolean equals(Object that)
+ {
+ return this.toString().equals(that.toString());
+ }
+ };
+ }
+
+ private static String sanitiseData(String data)
+ {
+ String cleanData = data.replaceAll("\\[\"", "").replaceAll("\\]\"", "")
+ .replaceAll("\\[", "").replaceAll("\\]", "")
+ .replaceAll("\",\"", ", ").replaceAll("\"", "");
+ return cleanData;
+ }
+
+ @Override
+ public String getColumnDataConfigFileName()
+ {
+ return "/fts/pdb_data_columns.txt";
+ }
+
+
+ public static FTSRestClientI getInstance()
+ {
+ if (instance == null)
+ {
+ instance = new PDBFTSRestClient();
+ }
+ return instance;
+ }
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.service.uniprot;
+
+import jalview.fts.api.FTSData;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.fts.core.FTSRestClient;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+import jalview.util.MessageManager;
+
+import java.util.ArrayList;
+import java.util.Collection;
+import java.util.List;
+import java.util.Objects;
+
+import javax.ws.rs.core.MediaType;
+
+import com.sun.jersey.api.client.Client;
+import com.sun.jersey.api.client.ClientResponse;
+import com.sun.jersey.api.client.WebResource;
+import com.sun.jersey.api.client.config.ClientConfig;
+import com.sun.jersey.api.client.config.DefaultClientConfig;
+
+public class UniProtFTSRestClient extends FTSRestClient
+{
+ private static FTSRestClientI instance = null;
+
+ public static final String UNIPROT_SEARCH_ENDPOINT = "http://www.uniprot.org/uniprot/?";
+
+ @Override
+ public FTSRestResponse executeRequest(FTSRestRequest uniportRestRequest)
+ throws Exception
+ {
+ try
+ {
+ ClientConfig clientConfig = new DefaultClientConfig();
+ Client client = Client.create(clientConfig);
+
+ String wantedFields = getDataColumnsFieldsAsCommaDelimitedString(uniportRestRequest
+ .getWantedFields());
+ int responseSize = (uniportRestRequest.getResponseSize() == 0) ? getDefaultResponsePageSize()
+ : uniportRestRequest.getResponseSize();
+
+ int offSet = uniportRestRequest.getOffSet();
+ String query;
+ if (isAdvancedQuery(uniportRestRequest.getSearchTerm()))
+ {
+ query = uniportRestRequest.getSearchTerm();
+ }
+ else
+ {
+ query = uniportRestRequest.getFieldToSearchBy().equalsIgnoreCase(
+ "Search All") ? uniportRestRequest.getSearchTerm()
+ + " or mnemonic:" + uniportRestRequest.getSearchTerm()
+ : uniportRestRequest.getFieldToSearchBy() + ":"
+ + uniportRestRequest.getSearchTerm();
+ }
+
+ WebResource webResource = null;
+ webResource = client.resource(UNIPROT_SEARCH_ENDPOINT)
+ .queryParam("format", "tab")
+ .queryParam("columns", wantedFields)
+ .queryParam("limit", String.valueOf(responseSize))
+ .queryParam("offset", String.valueOf(offSet))
+ .queryParam("sort", "score").queryParam("query", query);
+ // Execute the REST request
+ ClientResponse clientResponse = webResource.accept(
+ MediaType.TEXT_PLAIN).get(ClientResponse.class);
+ String uniProtTabDelimittedResponseString = clientResponse
+ .getEntity(String.class);
+ // Make redundant objects eligible for garbage collection to conserve
+ // memory
+ // System.out.println(">>>>> response : "
+ // + uniProtTabDelimittedResponseString);
+ if (clientResponse.getStatus() != 200)
+ {
+ String errorMessage = getMessageByHTTPStatusCode(
+ clientResponse.getStatus(), "Uniprot");
+ throw new Exception(errorMessage);
+
+ }
+ int xTotalResults = Integer.valueOf(clientResponse.getHeaders()
+ .get("X-Total-Results").get(0));
+ clientResponse = null;
+ client = null;
+ return parseUniprotResponse(uniProtTabDelimittedResponseString,
+ uniportRestRequest, xTotalResults);
+ } catch (Exception e)
+ {
+ String exceptionMsg = e.getMessage();
+ if (exceptionMsg.contains("SocketException"))
+ {
+ // No internet connection
+ throw new Exception(
+ MessageManager
+ .getString("exception.unable_to_detect_internet_connection"));
+ }
+ else if (exceptionMsg.contains("UnknownHostException"))
+ {
+ // The server 'http://www.uniprot.org' is unreachable
+ throw new Exception(MessageManager.formatMessage(
+ "exception.fts_server_unreachable", "Uniprot"));
+ }
+ else
+ {
+ throw e;
+ }
+ }
+ }
+
+ public boolean isAdvancedQuery(String query)
+ {
+ if (query.contains(" AND ") || query.contains(" OR ")
+ || query.contains(" NOT ") || query.contains(" ! ")
+ || query.contains(" || ") || query.contains(" && ")
+ || query.contains(":") || query.contains("-"))
+ {
+ return true;
+ }
+ return false;
+ }
+
+ public FTSRestResponse parseUniprotResponse(
+ String uniProtTabDelimittedResponseString,
+ FTSRestRequest uniprotRestRequest, int xTotalResults)
+ {
+ FTSRestResponse searchResult = new FTSRestResponse();
+ List<FTSData> result = null;
+ if (uniProtTabDelimittedResponseString == null
+ || uniProtTabDelimittedResponseString.trim().isEmpty())
+ {
+ searchResult.setNumberOfItemsFound(0);
+ return searchResult;
+ }
+ String[] foundDataRow = uniProtTabDelimittedResponseString.split("\n");
+ if (foundDataRow != null && foundDataRow.length > 0)
+ {
+ result = new ArrayList<FTSData>();
+ String titleRow = getDataColumnsFieldsAsTabDelimitedString(uniprotRestRequest
+ .getWantedFields());
+ // System.out.println(">>>>Title row : " + titleRow);
+ for (String dataRow : foundDataRow)
+ {
+ if (dataRow.equalsIgnoreCase(titleRow))
+ {
+ // System.out.println(">>>>>>>>>> matched!!!");
+ continue;
+ }
+ // System.out.println(dataRow);
+ result.add(getFTSData(dataRow, uniprotRestRequest));
+ }
+ searchResult.setNumberOfItemsFound(xTotalResults);
+ searchResult.setSearchSummary(result);
+ }
+ return searchResult;
+ }
+
+ /**
+ * Takes a collection of FTSDataColumnI and converts its 'code' values into a
+ * tab delimited string.
+ *
+ * @param dataColumnFields
+ * the collection of FTSDataColumnI to process
+ * @return the generated comma delimited string from the supplied
+ * FTSDataColumnI collection
+ */
+ private String getDataColumnsFieldsAsTabDelimitedString(
+ Collection<FTSDataColumnI> dataColumnFields)
+ {
+ String result = "";
+ if (dataColumnFields != null && !dataColumnFields.isEmpty())
+ {
+ StringBuilder returnedFields = new StringBuilder();
+ for (FTSDataColumnI field : dataColumnFields)
+ {
+ if (field.getName().equalsIgnoreCase("Uniprot Id"))
+ {
+ returnedFields.append("\t").append("Entry");
+ }
+ else
+ {
+ returnedFields.append("\t").append(field.getName());
+ }
+ }
+ returnedFields.deleteCharAt(0);
+ result = returnedFields.toString();
+ }
+ return result;
+ }
+
+ public static FTSData getFTSData(String tabDelimittedDataStr,
+ FTSRestRequest request)
+ {
+ String primaryKey = null;
+
+ Object[] summaryRowData;
+
+ Collection<FTSDataColumnI> diplayFields = request.getWantedFields();
+ int colCounter = 0;
+ summaryRowData = new Object[diplayFields.size()];
+ String[] columns = tabDelimittedDataStr.split("\t");
+ for (FTSDataColumnI field : diplayFields)
+ {
+ try
+ {
+ String fieldData = columns[colCounter];
+ if (field.isPrimaryKeyColumn())
+ {
+ primaryKey = fieldData;
+ summaryRowData[colCounter++] = primaryKey;
+ }
+ else if (fieldData == null || fieldData.isEmpty())
+ {
+ summaryRowData[colCounter++] = null;
+ }
+ else
+ {
+ try
+ {
+ summaryRowData[colCounter++] = (field.getDataType()
+ .getDataTypeClass() == Integer.class) ? Integer
+ .valueOf(fieldData)
+ : (field.getDataType()
+ .getDataTypeClass() == Double.class) ? Double
+ .valueOf(fieldData) : fieldData;
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ System.out.println("offending value:" + fieldData);
+ }
+ }
+ } catch (Exception e)
+ {
+ // e.printStackTrace();
+ }
+ }
+
+ final String primaryKey1 = primaryKey;
+
+ final Object[] summaryRowData1 = summaryRowData;
+ return new FTSData()
+ {
+ @Override
+ public Object[] getSummaryData()
+ {
+ return summaryRowData1;
+ }
+
+ @Override
+ public Object getPrimaryKey()
+ {
+ return primaryKey1;
+ }
+
+ /**
+ * Returns a string representation of this object;
+ */
+ @Override
+ public String toString()
+ {
+ StringBuilder summaryFieldValues = new StringBuilder();
+ for (Object summaryField : summaryRowData1)
+ {
+ summaryFieldValues.append(
+ summaryField == null ? " " : summaryField.toString())
+ .append("\t");
+ }
+ return summaryFieldValues.toString();
+ }
+
+ /**
+ * Returns hash code value for this object
+ */
+ @Override
+ public int hashCode()
+ {
+ return Objects.hash(primaryKey1, this.toString());
+ }
+
+ @Override
+ public boolean equals(Object that)
+ {
+ return this.toString().equals(that.toString());
+ }
+ };
+ }
+
+
+ public static FTSRestClientI getInstance()
+ {
+ if (instance == null)
+ {
+ instance = new UniProtFTSRestClient();
+ }
+ return instance;
+ }
+
+ @Override
+ public String getColumnDataConfigFileName()
+ {
+ return "/fts/uniprot_data_columns.txt";
+ }
+
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+
+package jalview.fts.service.uniprot;
+
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+import jalview.fts.core.GFTSPanel;
+import jalview.gui.SequenceFetcher;
+import jalview.util.MessageManager;
+
+import java.util.HashSet;
+
+@SuppressWarnings("serial")
+public class UniprotFTSPanel extends GFTSPanel
+{
+
+ private static String defaultFTSFrameTitle = MessageManager
+ .getString("label.uniprot_sequence_fetcher");
+
+ private String ftsFrameTitle = defaultFTSFrameTitle;
+
+
+
+ public UniprotFTSPanel(SequenceFetcher seqFetcher)
+ {
+ pageLimit = UniProtFTSRestClient.getInstance()
+ .getDefaultResponsePageSize();
+ this.seqFetcher = seqFetcher;
+ this.progressIdicator = (seqFetcher == null) ? null : seqFetcher
+ .getProgressIndicator();
+ }
+
+ @Override
+ public void searchAction(boolean isFreshSearch)
+ {
+ if (isFreshSearch)
+ {
+ offSet = 0;
+ }
+ new Thread()
+ {
+ @Override
+ public void run()
+ {
+ ftsFrameTitle = defaultFTSFrameTitle;
+ reset();
+ if (getTypedText().length() > 0)
+ {
+ setSearchInProgress(true);
+ long startTime = System.currentTimeMillis();
+
+ String searchTarget = ((FTSDataColumnI) cmb_searchTarget
+ .getSelectedItem()).getAltCode();
+
+ wantedFields = UniProtFTSRestClient.getInstance()
+ .getAllDefaulDisplayedDataColumns();
+ String searchTerm = decodeSearchTerm(txt_search.getText(),
+ searchTarget);
+
+ FTSRestRequest request = new FTSRestRequest();
+ request.setFieldToSearchBy(searchTarget);
+ request.setSearchTerm(searchTerm);
+ request.setOffSet(offSet);
+ request.setWantedFields(wantedFields);
+ FTSRestClientI uniProtRestCleint = UniProtFTSRestClient
+ .getInstance();
+ FTSRestResponse resultList;
+ try
+ {
+ resultList = uniProtRestCleint.executeRequest(request);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ setErrorMessage(e.getMessage());
+ checkForErrors();
+ return;
+ }
+
+ if (resultList.getSearchSummary() != null
+ && resultList.getSearchSummary().size() > 0)
+ {
+ getResultTable().setModel(
+ FTSRestResponse.getTableModel(request,
+ resultList.getSearchSummary()));
+ FTSRestResponse.configureTableColumn(getResultTable(),
+ wantedFields);
+ getResultTable().setVisible(true);
+ }
+
+ long endTime = System.currentTimeMillis();
+ totalResultSetCount = resultList.getNumberOfItemsFound();
+ resultSetCount = resultList.getSearchSummary() == null ? 0
+ : resultList.getSearchSummary().size();
+ String result = (resultSetCount > 0) ? MessageManager
+ .getString("label.results") : MessageManager
+ .getString("label.result");
+ if (isPaginationEnabled() && resultSetCount > 0)
+ {
+ updateSearchFrameTitle(defaultFTSFrameTitle + " - " + result
+ + " "
+ + totalNumberformatter.format((Number) (offSet + 1))
+ + " to "
+ + totalNumberformatter
+ .format((Number) (offSet + resultSetCount))
+ + " of "
+ + totalNumberformatter
+ .format((Number) totalResultSetCount)
+ + " " + " (" + (endTime - startTime) + " milli secs)");
+ }
+ else
+ {
+ updateSearchFrameTitle(defaultFTSFrameTitle + " - "
+ + resultSetCount + " " + result + " ("
+ + (endTime - startTime) + " milli secs)");
+ }
+ setSearchInProgress(false);
+ refreshPaginatorState();
+ updateSummaryTableSelections();
+ }
+ }
+ }.start();
+
+ }
+
+ public String decodeSearchTerm(String enteredText, String targetField)
+ {
+ int searchTargetLength = targetField.equalsIgnoreCase("Search All") ? 0
+ : targetField.length() + 1;
+ String searchTarget = targetField.equalsIgnoreCase("Search All") ? ""
+ : targetField + ":";
+ String foundSearchTerms = enteredText;
+ StringBuilder foundSearchTermsBuilder = new StringBuilder();
+ if (enteredText.contains(";"))
+ {
+ String[] searchTerms = enteredText.split(";");
+ for (String searchTerm : searchTerms)
+ {
+ foundSearchTermsBuilder.append(searchTarget).append(searchTerm)
+ .append(" OR ");
+ }
+ int endIndex = foundSearchTermsBuilder.lastIndexOf(" OR ");
+ foundSearchTerms = foundSearchTermsBuilder.toString();
+ if (foundSearchTerms.contains(" OR "))
+ {
+ foundSearchTerms = foundSearchTerms.substring(searchTargetLength,
+ endIndex);
+ }
+ }
+ return foundSearchTerms;
+ }
+
+
+ @Override
+ public boolean isPaginationEnabled()
+ {
+ return true;
+ }
+
+ @Override
+ public void okAction()
+ {
+ disableActionButtons();
+ StringBuilder selectedIds = new StringBuilder();
+ HashSet<String> selectedIdsSet = new HashSet<String>();
+ int primaryKeyColIndex = 0;
+ try
+ {
+ primaryKeyColIndex = getFTSRestClient().getPrimaryKeyColumIndex(
+ wantedFields, false);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ int[] selectedRows = getResultTable().getSelectedRows();
+ for (int summaryRow : selectedRows)
+ {
+ String idStr = getResultTable().getValueAt(summaryRow,
+ primaryKeyColIndex).toString();
+ selectedIdsSet.add(idStr);
+ }
+ selectedIdsSet.addAll(paginatorCart);
+ for (String selectedId : selectedIdsSet)
+ {
+ selectedIds.append(selectedId).append(";");
+ }
+
+ String ids = selectedIds.toString();
+ // System.out.println(">>>>>>>>>>>>>>>> selected Ids: " + ids);
+ seqFetcher.getTextArea().setText(ids);
+ Thread worker = new Thread(seqFetcher);
+ worker.start();
+ delayAndEnableActionButtons();
+ }
+
+ @Override
+ public FTSRestClientI getFTSRestClient()
+ {
+ return UniProtFTSRestClient.getInstance();
+ }
+
+ @Override
+ public String getFTSFrameTitle()
+ {
+ return ftsFrameTitle;
+ }
+
+}
import jalview.io.JnetAnnotationMaker;
import jalview.io.NewickFile;
import jalview.io.TCoffeeScoreFile;
+import jalview.io.gff.SequenceOntologyI;
import jalview.jbgui.GAlignFrame;
import jalview.schemes.Blosum62ColourScheme;
import jalview.schemes.BuriedColourScheme;
import java.awt.datatransfer.DataFlavor;
import java.awt.datatransfer.StringSelection;
import java.awt.datatransfer.Transferable;
-import java.awt.dnd.DnDConstants;
import java.awt.dnd.DropTargetDragEvent;
import java.awt.dnd.DropTargetDropEvent;
import java.awt.dnd.DropTargetEvent;
import java.awt.dnd.DropTargetListener;
import java.awt.event.ActionEvent;
import java.awt.event.ActionListener;
+import java.awt.event.FocusAdapter;
+import java.awt.event.FocusEvent;
import java.awt.event.ItemEvent;
import java.awt.event.ItemListener;
import java.awt.event.KeyAdapter;
{
formatMenu.add(vsel);
}
+ addFocusListener(new FocusAdapter()
+ {
+ @Override
+ public void focusGained(FocusEvent e)
+ {
+ Desktop.setCurrentAlignFrame(AlignFrame.this);
+ }
+ });
}
.setSelected(av.getGlobalColourScheme() instanceof jalview.schemes.RNAHelicesColour);
showProducts.setEnabled(canShowProducts());
+ setGroovyEnabled(Desktop.getGroovyConsole() != null);
updateEditMenuBar();
}
+ /**
+ * Set the enabled state of the 'Run Groovy' option in the Calculate menu
+ *
+ * @param b
+ */
+ public void setGroovyEnabled(boolean b)
+ {
+ runGroovy.setEnabled(b);
+ }
+
private IProgressIndicator progressBar;
/*
AlignmentI alignmentToExport = null;
AlignExportSettingI settings = exportSettings;
String[] omitHidden = null;
- int[] alignmentStartEnd = new int[2];
HiddenSequences hiddenSeqs = viewport.getAlignment()
.getHiddenSequences();
alignmentToExport = viewport.getAlignment();
- alignmentStartEnd = new int[] { 0, alignmentToExport.getWidth() - 1 };
boolean hasHiddenSeqs = hiddenSeqs.getSize() > 0;
if (settings == null)
omitHidden = viewport.getViewAsString(false);
}
+ int[] alignmentStartEnd = new int[2];
if (hasHiddenSeqs && settings.isExportHiddenSequences())
{
alignmentToExport = hiddenSeqs.getFullAlignment();
else
{
alignmentToExport = viewport.getAlignment();
- alignmentStartEnd = getStartEnd(alignmentStartEnd, viewport
- .getColumnSelection().getHiddenColumns());
+ alignmentStartEnd = viewport.getAlignment()
+ .getVisibleStartAndEndIndex(
+ viewport.getColumnSelection().getHiddenColumns());
}
AlignmentExportData ed = new AlignmentExportData(alignmentToExport,
omitHidden, alignmentStartEnd, settings);
return ed;
}
- public static int[] getStartEnd(int[] aligmentStartEnd,
- List<int[]> hiddenCols)
- {
- int startPos = aligmentStartEnd[0];
- int endPos = aligmentStartEnd[1];
-
- int[] lowestRange = new int[] { -1, -1 };
- int[] higestRange = new int[] { -1, -1 };
-
- for (int[] hiddenCol : hiddenCols)
- {
- lowestRange = (hiddenCol[0] <= startPos) ? hiddenCol : lowestRange;
- higestRange = (hiddenCol[1] >= endPos) ? hiddenCol : higestRange;
- }
-
- if (lowestRange[0] == -1 && lowestRange[1] == -1)
- {
- startPos = aligmentStartEnd[0];
- }
- else
- {
- startPos = lowestRange[1] + 1;
- }
-
- if (higestRange[0] == -1 && higestRange[1] == -1)
- {
- endPos = aligmentStartEnd[1];
- }
- else
- {
- endPos = higestRange[0] - 1;
- }
-
- // System.out.println("Export range : " + startPos + " - " + endPos);
- return new int[] { startPos, endPos };
- }
-
- public static void main(String[] args)
- {
- ArrayList<int[]> hiddenCols = new ArrayList<int[]>();
- hiddenCols.add(new int[] { 0, 0 });
- hiddenCols.add(new int[] { 6, 9 });
- hiddenCols.add(new int[] { 11, 12 });
- hiddenCols.add(new int[] { 33, 33 });
- hiddenCols.add(new int[] { 50, 50 });
-
- int[] x = getStartEnd(new int[] { 0, 50 }, hiddenCols);
- // System.out.println("Export range : " + x[0] + " - " + x[1]);
- }
-
/**
* DOCUMENT ME!
*
@Override
public void mousePressed(MouseEvent evt)
{
- if (evt.isControlDown()
- || SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
radioItem.removeActionListener(radioItem.getActionListeners()[0]);
{
JMenuItem tm = new JMenuItem();
ScoreModelI sm = ResidueProperties.scoreMatrices.get(pwtype);
- if (sm.isProtein() == !viewport.getAlignment().isNucleotide())
+ if (sm.isDNA() == viewport.getAlignment().isNucleotide()
+ || sm.isProtein() == !viewport.getAlignment()
+ .isNucleotide())
{
String smn = MessageManager.getStringOrReturn(
"label.score_model_", sm.getName());
AlignFrame newFrame = new AlignFrame(al, DEFAULT_WIDTH,
DEFAULT_HEIGHT);
+ if (Cache.getDefault("HIDE_INTRONS", true))
+ {
+ newFrame.hideFeatureColumns(SequenceOntologyI.EXON, false);
+ }
String newtitle = String.format("%s %s %s",
MessageManager.getString(dna ? "label.proteins"
: "label.nucleotides"), MessageManager
}
} catch (Exception e)
{
- Cache.log.error(
- "Exception when finding crossreferences", e);
+ Cache.log.error("Exception when finding crossreferences", e);
} catch (OutOfMemoryError e)
{
new OOMWarning("whilst fetching crossreferences", e);
} catch (Throwable e)
{
- Cache.log.error("Error when finding crossreferences",
- e);
+ Cache.log.error("Error when finding crossreferences", e);
} finally
{
AlignFrame.this.setProgressBar(MessageManager.formatMessage(
public void drop(DropTargetDropEvent evt)
{
Transferable t = evt.getTransferable();
- java.util.List files = null;
+ java.util.List<String> files = new ArrayList<String>(), protocols = new ArrayList<String>();
try
{
- DataFlavor uriListFlavor = new DataFlavor(
- "text/uri-list;class=java.lang.String");
- if (t.isDataFlavorSupported(DataFlavor.javaFileListFlavor))
- {
- // Works on Windows and MacOSX
- evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
- files = (java.util.List) t
- .getTransferData(DataFlavor.javaFileListFlavor);
- }
- else if (t.isDataFlavorSupported(uriListFlavor))
- {
- // This is used by Unix drag system
- evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
- String data = (String) t.getTransferData(uriListFlavor);
- files = new java.util.ArrayList(1);
- for (java.util.StringTokenizer st = new java.util.StringTokenizer(
- data, "\r\n"); st.hasMoreTokens();)
- {
- String s = st.nextToken();
- if (s.startsWith("#"))
- {
- // the line is a comment (as per the RFC 2483)
- continue;
- }
-
- java.net.URI uri = new java.net.URI(s);
- // check to see if we can handle this kind of URI
- if (uri.getScheme().toLowerCase().startsWith("http"))
- {
- files.add(uri.toString());
- }
- else
- {
- // otherwise preserve old behaviour: catch all for file objects
- java.io.File file = new java.io.File(uri);
- files.add(file.toString());
- }
- }
- }
+ Desktop.transferFromDropTarget(files, protocols, evt, t);
} catch (Exception e)
{
e.printStackTrace();
@Override
public void tabbedPane_mousePressed(MouseEvent e)
{
- if (SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
String msg = MessageManager.getString("label.enter_view_name");
String reply = JOptionPane.showInternalInputDialog(this, msg, msg,
AlignFrame.this.setMenusForViewport();
}
});
- dbRefFetcher
- .fetchDBRefs(false);
+ dbRefFetcher.fetchDBRefs(false);
}
}).start();
try
{
Dna dna = new Dna(viewport, viewport.getViewAsVisibleContigs(true));
-
al = dna.reverseCdna(complement);
viewport.addAlignment(al, "");
+ addHistoryItem(new EditCommand(
+ MessageManager.getString("label.add_sequences"),
+ Action.PASTE, al.getSequencesArray(), 0, al.getWidth(),
+ viewport.getAlignment()));
} catch (Exception ex)
{
System.err.println(ex.getMessage());
return;
}
}
+
+ /**
+ * Try to run a script in the Groovy console, having first ensured that this
+ * AlignFrame is set as currentAlignFrame in Desktop, to allow the script to
+ * be targeted at this alignment.
+ */
+ @Override
+ protected void runGroovy_actionPerformed()
+ {
+ Desktop.setCurrentAlignFrame(this);
+ groovy.ui.Console console = Desktop.getGroovyConsole();
+ if (console != null)
+ {
+ try
+ {
+ console.runScript();
+ } catch (Exception ex)
+ {
+ System.err.println((ex.toString()));
+ JOptionPane
+ .showInternalMessageDialog(Desktop.desktop, MessageManager
+ .getString("label.couldnt_run_groovy_script"),
+ MessageManager
+ .getString("label.groovy_support_failed"),
+ JOptionPane.ERROR_MESSAGE);
+ }
+ }
+ else
+ {
+ System.err.println("Can't run Groovy script as console not found");
+ }
+ }
+
+ /**
+ * Hides columns containing (or not containing) a specified feature, provided
+ * that would not leave all columns hidden
+ *
+ * @param featureType
+ * @param columnsContaining
+ * @return
+ */
+ public boolean hideFeatureColumns(String featureType,
+ boolean columnsContaining)
+ {
+ boolean notForHiding = avc.markColumnsContainingFeatures(
+ columnsContaining, false, false, featureType);
+ if (notForHiding)
+ {
+ if (avc.markColumnsContainingFeatures(!columnsContaining, false,
+ false, featureType))
+ {
+ getViewport().hideSelectedColumns();
+ return true;
+ }
+ }
+ return false;
+ }
}
class PrintThread extends Thread
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void actionPerformed(ActionEvent evt)
{
AlignmentAnnotation[] aa = ap.av.getAlignment()
return true;
}
- /**
- * DOCUMENT ME!
- *
- * @param evt
- * DOCUMENT ME!
- */
+ @Override
public void mousePressed(MouseEvent evt)
{
getSelectedRow(evt.getY() - getScrollOffset());
oldY = evt.getY();
+ if (!evt.isPopupTrigger())
+ {
+ return;
+ }
+ evt.consume();
+ // handle popup menu event
+ final AlignmentAnnotation[] aa = ap.av.getAlignment()
+ .getAlignmentAnnotation();
+
+ JPopupMenu pop = new JPopupMenu(
+ MessageManager.getString("label.annotations"));
+ JMenuItem item = new JMenuItem(ADDNEW);
+ item.addActionListener(this);
+ pop.add(item);
+ if (selectedRow < 0)
+ {
+ if (hasHiddenRows)
+ { // let the user make everything visible again
+ item = new JMenuItem(SHOWALL);
+ item.addActionListener(this);
+ pop.add(item);
+ }
+ pop.show(this, evt.getX(), evt.getY());
+ return;
+ }
+ item = new JMenuItem(EDITNAME);
+ item.addActionListener(this);
+ pop.add(item);
+ item = new JMenuItem(HIDE);
+ item.addActionListener(this);
+ pop.add(item);
+ // JAL-1264 hide all sequence-specific annotations of this type
+ if (selectedRow < aa.length)
+ {
+ if (aa[selectedRow].sequenceRef != null)
+ {
+ final String label = aa[selectedRow].label;
+ JMenuItem hideType = new JMenuItem();
+ String text = MessageManager.getString("label.hide_all") + " "
+ + label;
+ hideType.setText(text);
+ hideType.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ AlignmentUtils.showOrHideSequenceAnnotations(
+ ap.av.getAlignment(), Collections.singleton(label),
+ null, false, false);
+ // for (AlignmentAnnotation ann : ap.av.getAlignment()
+ // .getAlignmentAnnotation())
+ // {
+ // if (ann.sequenceRef != null && ann.label != null
+ // && ann.label.equals(label))
+ // {
+ // ann.visible = false;
+ // }
+ // }
+ refresh();
+ }
+ });
+ pop.add(hideType);
+ }
+ }
+ item = new JMenuItem(DELETE);
+ item.addActionListener(this);
+ pop.add(item);
+ if (hasHiddenRows)
+ {
+ item = new JMenuItem(SHOWALL);
+ item.addActionListener(this);
+ pop.add(item);
+ }
+ item = new JMenuItem(OUTPUT_TEXT);
+ item.addActionListener(this);
+ pop.add(item);
+ // TODO: annotation object should be typed for autocalculated/derived
+ // property methods
+ if (selectedRow < aa.length)
+ {
+ final String label = aa[selectedRow].label;
+ if (!aa[selectedRow].autoCalculated)
+ {
+ if (aa[selectedRow].graph == AlignmentAnnotation.NO_GRAPH)
+ {
+ // display formatting settings for this row.
+ pop.addSeparator();
+ // av and sequencegroup need to implement same interface for
+ item = new JCheckBoxMenuItem(TOGGLE_LABELSCALE,
+ aa[selectedRow].scaleColLabel);
+ item.addActionListener(this);
+ pop.add(item);
+ }
+ }
+ else if (label.indexOf("Consensus") > -1)
+ {
+ pop.addSeparator();
+ // av and sequencegroup need to implement same interface for
+ final JCheckBoxMenuItem cbmi = new JCheckBoxMenuItem(
+ MessageManager.getString("label.ignore_gaps_consensus"),
+ (aa[selectedRow].groupRef != null) ? aa[selectedRow].groupRef
+ .getIgnoreGapsConsensus() : ap.av
+ .isIgnoreGapsConsensus());
+ final AlignmentAnnotation aaa = aa[selectedRow];
+ cbmi.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ if (aaa.groupRef != null)
+ {
+ // TODO: pass on reference to ap so the view can be updated.
+ aaa.groupRef.setIgnoreGapsConsensus(cbmi.getState());
+ ap.getAnnotationPanel().paint(
+ ap.getAnnotationPanel().getGraphics());
+ }
+ else
+ {
+ ap.av.setIgnoreGapsConsensus(cbmi.getState(), ap);
+ }
+ }
+ });
+ pop.add(cbmi);
+ // av and sequencegroup need to implement same interface for
+ if (aaa.groupRef != null)
+ {
+ final JCheckBoxMenuItem chist = new JCheckBoxMenuItem(
+ MessageManager.getString("label.show_group_histogram"),
+ aa[selectedRow].groupRef.isShowConsensusHistogram());
+ chist.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ aaa.groupRef.setShowConsensusHistogram(chist.getState());
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(chist);
+ final JCheckBoxMenuItem cprofl = new JCheckBoxMenuItem(
+ MessageManager.getString("label.show_group_logo"),
+ aa[selectedRow].groupRef.isShowSequenceLogo());
+ cprofl.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ aaa.groupRef.setshowSequenceLogo(cprofl.getState());
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(cprofl);
+ final JCheckBoxMenuItem cproflnorm = new JCheckBoxMenuItem(
+ MessageManager.getString("label.normalise_group_logo"),
+ aa[selectedRow].groupRef.isNormaliseSequenceLogo());
+ cproflnorm.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ aaa.groupRef.setNormaliseSequenceLogo(cproflnorm.getState());
+ // automatically enable logo display if we're clicked
+ aaa.groupRef.setshowSequenceLogo(true);
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(cproflnorm);
+ }
+ else
+ {
+ final JCheckBoxMenuItem chist = new JCheckBoxMenuItem(
+ MessageManager.getString("label.show_histogram"),
+ av.isShowConsensusHistogram());
+ chist.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ av.setShowConsensusHistogram(chist.getState());
+ ap.alignFrame.setMenusForViewport();
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(chist);
+ final JCheckBoxMenuItem cprof = new JCheckBoxMenuItem(
+ MessageManager.getString("label.show_logo"),
+ av.isShowSequenceLogo());
+ cprof.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ av.setShowSequenceLogo(cprof.getState());
+ ap.alignFrame.setMenusForViewport();
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(cprof);
+ final JCheckBoxMenuItem cprofnorm = new JCheckBoxMenuItem(
+ MessageManager.getString("label.normalise_logo"),
+ av.isNormaliseSequenceLogo());
+ cprofnorm.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ // TODO: pass on reference
+ // to ap
+ // so the
+ // view
+ // can be
+ // updated.
+ av.setShowSequenceLogo(true);
+ av.setNormaliseSequenceLogo(cprofnorm.getState());
+ ap.alignFrame.setMenusForViewport();
+ ap.repaint();
+ // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
+ }
+ });
+ pop.add(cprofnorm);
+ }
+ final JMenuItem consclipbrd = new JMenuItem(COPYCONS_SEQ);
+ consclipbrd.addActionListener(this);
+ pop.add(consclipbrd);
+ }
+ }
+ pop.show(this, evt.getX(), evt.getY());
+
}
/**
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void mouseReleased(MouseEvent evt)
{
int start = selectedRow;
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void mouseEntered(MouseEvent evt)
{
if (evt.getY() < 10)
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void mouseExited(MouseEvent evt)
{
if (dragEvent == null)
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void mouseDragged(MouseEvent evt)
{
dragEvent = evt;
* @param evt
* DOCUMENT ME!
*/
+ @Override
public void mouseMoved(MouseEvent evt)
{
resizePanel = evt.getY() < 10;
}
}
- /**
- * DOCUMENT ME!
- *
- * @param evt
- * DOCUMENT ME!
- */
+ @Override
public void mouseClicked(MouseEvent evt)
{
final AlignmentAnnotation[] aa = ap.av.getAlignment()
.getAlignmentAnnotation();
- if (SwingUtilities.isLeftMouseButton(evt))
+ if (!evt.isPopupTrigger() && SwingUtilities.isLeftMouseButton(evt))
{
if (selectedRow > -1 && selectedRow < aa.length)
{
}
}
- }
- if (!SwingUtilities.isRightMouseButton(evt))
- {
- return;
- }
-
- JPopupMenu pop = new JPopupMenu(
- MessageManager.getString("label.annotations"));
- JMenuItem item = new JMenuItem(ADDNEW);
- item.addActionListener(this);
- pop.add(item);
- if (selectedRow < 0)
- {
- if (hasHiddenRows)
- { // let the user make everything visible again
- item = new JMenuItem(SHOWALL);
- item.addActionListener(this);
- pop.add(item);
- }
- pop.show(this, evt.getX(), evt.getY());
return;
}
- item = new JMenuItem(EDITNAME);
- item.addActionListener(this);
- pop.add(item);
- item = new JMenuItem(HIDE);
- item.addActionListener(this);
- pop.add(item);
- // JAL-1264 hide all sequence-specific annotations of this type
- if (selectedRow < aa.length)
- {
- if (aa[selectedRow].sequenceRef != null)
- {
- final String label = aa[selectedRow].label;
- JMenuItem hideType = new JMenuItem();
- String text = MessageManager.getString("label.hide_all") + " "
- + label;
- hideType.setText(text);
- hideType.addActionListener(new ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- AlignmentUtils.showOrHideSequenceAnnotations(
- ap.av.getAlignment(), Collections.singleton(label),
- null, false, false);
- // for (AlignmentAnnotation ann : ap.av.getAlignment()
- // .getAlignmentAnnotation())
- // {
- // if (ann.sequenceRef != null && ann.label != null
- // && ann.label.equals(label))
- // {
- // ann.visible = false;
- // }
- // }
- refresh();
- }
- });
- pop.add(hideType);
- }
- }
- item = new JMenuItem(DELETE);
- item.addActionListener(this);
- pop.add(item);
- if (hasHiddenRows)
- {
- item = new JMenuItem(SHOWALL);
- item.addActionListener(this);
- pop.add(item);
- }
- item = new JMenuItem(OUTPUT_TEXT);
- item.addActionListener(this);
- pop.add(item);
- // TODO: annotation object should be typed for autocalculated/derived
- // property methods
- if (selectedRow < aa.length)
- {
- final String label = aa[selectedRow].label;
- if (!aa[selectedRow].autoCalculated)
- {
- if (aa[selectedRow].graph == AlignmentAnnotation.NO_GRAPH)
- {
- // display formatting settings for this row.
- pop.addSeparator();
- // av and sequencegroup need to implement same interface for
- item = new JCheckBoxMenuItem(TOGGLE_LABELSCALE,
- aa[selectedRow].scaleColLabel);
- item.addActionListener(this);
- pop.add(item);
- }
- }
- else if (label.indexOf("Consensus") > -1)
- {
- pop.addSeparator();
- // av and sequencegroup need to implement same interface for
- final JCheckBoxMenuItem cbmi = new JCheckBoxMenuItem(
- MessageManager.getString("label.ignore_gaps_consensus"),
- (aa[selectedRow].groupRef != null) ? aa[selectedRow].groupRef
- .getIgnoreGapsConsensus() : ap.av
- .isIgnoreGapsConsensus());
- final AlignmentAnnotation aaa = aa[selectedRow];
- cbmi.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- if (aaa.groupRef != null)
- {
- // TODO: pass on reference to ap so the view can be updated.
- aaa.groupRef.setIgnoreGapsConsensus(cbmi.getState());
- ap.getAnnotationPanel().paint(
- ap.getAnnotationPanel().getGraphics());
- }
- else
- {
- ap.av.setIgnoreGapsConsensus(cbmi.getState(), ap);
- }
- }
- });
- pop.add(cbmi);
- // av and sequencegroup need to implement same interface for
- if (aaa.groupRef != null)
- {
- final JCheckBoxMenuItem chist = new JCheckBoxMenuItem(
- MessageManager.getString("label.show_group_histogram"),
- aa[selectedRow].groupRef.isShowConsensusHistogram());
- chist.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- aaa.groupRef.setShowConsensusHistogram(chist.getState());
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(chist);
- final JCheckBoxMenuItem cprofl = new JCheckBoxMenuItem(
- MessageManager.getString("label.show_group_logo"),
- aa[selectedRow].groupRef.isShowSequenceLogo());
- cprofl.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- aaa.groupRef.setshowSequenceLogo(cprofl.getState());
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(cprofl);
- final JCheckBoxMenuItem cproflnorm = new JCheckBoxMenuItem(
- MessageManager.getString("label.normalise_group_logo"),
- aa[selectedRow].groupRef.isNormaliseSequenceLogo());
- cproflnorm.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
-
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- aaa.groupRef.setNormaliseSequenceLogo(cproflnorm.getState());
- // automatically enable logo display if we're clicked
- aaa.groupRef.setshowSequenceLogo(true);
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(cproflnorm);
- }
- else
- {
- final JCheckBoxMenuItem chist = new JCheckBoxMenuItem(
- MessageManager.getString("label.show_histogram"),
- av.isShowConsensusHistogram());
- chist.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- av.setShowConsensusHistogram(chist.getState());
- ap.alignFrame.setMenusForViewport();
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(chist);
- final JCheckBoxMenuItem cprof = new JCheckBoxMenuItem(
- MessageManager.getString("label.show_logo"),
- av.isShowSequenceLogo());
- cprof.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- av.setShowSequenceLogo(cprof.getState());
- ap.alignFrame.setMenusForViewport();
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(cprof);
- final JCheckBoxMenuItem cprofnorm = new JCheckBoxMenuItem(
- MessageManager.getString("label.normalise_logo"),
- av.isNormaliseSequenceLogo());
- cprofnorm.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- // TODO: pass on reference
- // to ap
- // so the
- // view
- // can be
- // updated.
- av.setShowSequenceLogo(true);
- av.setNormaliseSequenceLogo(cprofnorm.getState());
- ap.alignFrame.setMenusForViewport();
- ap.repaint();
- // ap.annotationPanel.paint(ap.annotationPanel.getGraphics());
- }
- });
- pop.add(cprofnorm);
- }
- final JMenuItem consclipbrd = new JMenuItem(COPYCONS_SEQ);
- consclipbrd.addActionListener(this);
- pop.add(consclipbrd);
- }
- }
- pop.show(this, evt.getX(), evt.getY());
}
/**
List<int[]> hiddenCols = av.getColumnSelection().getHiddenColumns();
if (hiddenCols != null)
{
- alignmentStartEnd = AlignFrame.getStartEnd(alignmentStartEnd,
+ alignmentStartEnd = av.getAlignment().getVisibleStartAndEndIndex(
hiddenCols);
}
String output = new FormatAdapter().formatSequences("Fasta", seqs,
* @param g1
* DOCUMENT ME!
*/
+ @Override
public void paintComponent(Graphics g)
{
import javax.swing.JPanel;
import javax.swing.JPopupMenu;
import javax.swing.Scrollable;
-import javax.swing.SwingUtilities;
import javax.swing.ToolTipManager;
/**
}
}
- if (SwingUtilities.isRightMouseButton(evt) && activeRow != -1)
+ if (evt.isPopupTrigger() && activeRow != -1)
{
if (av.getColumnSelection() == null)
{
});
SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
textarea.requestFocus();
textarea.setText(text);
}
+ @Override
public void save_actionPerformed(ActionEvent e)
{
JalviewFileChooser chooser = new JalviewFileChooser(
}
}
+ @Override
public void toggleHtml_actionPerformed(ActionEvent e)
{
String txt = textarea.getText();
* @param e
* DOCUMENT ME!
*/
+ @Override
public void copyItem_actionPerformed(ActionEvent e)
{
Clipboard c = Toolkit.getDefaultToolkit().getSystemClipboard();
* @param e
* DOCUMENT ME!
*/
+ @Override
public void cancel_actionPerformed(ActionEvent e)
{
try
}
}
+ @Override
public void textarea_mousePressed(MouseEvent e)
{
- if (SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
JPopupMenu popup = new JPopupMenu(
MessageManager.getString("action.edit"));
MessageManager.getString("action.copy"));
item.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent e)
{
copyItem_actionPerformed(e);
@Override
public void textarea_mousePressed(MouseEvent e)
{
- if (SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
JPopupMenu popup = new JPopupMenu(
MessageManager.getString("action.edit"));
ListSelectionModel rowSM = table.getSelectionModel();
rowSM.addListSelectionListener(new ListSelectionListener()
{
+ @Override
public void valueChanged(ListSelectionEvent e)
{
ListSelectionModel lsm = (ListSelectionModel) e.getSource();
table.addMouseListener(new MouseAdapter()
{
+ @Override
public void mouseClicked(MouseEvent evt)
{
- if (evt.getClickCount() == 2
- || SwingUtilities.isRightMouseButton(evt))
+ if (evt.getClickCount() == 2 || evt.isPopupTrigger())
{
editRemoveLocalSource(evt);
}
this(null);
}
+ @Override
public void paintComponent(java.awt.Graphics g)
{
if (sourceRegistry == null)
javax.swing.SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
TableSorter sorter = (TableSorter) table.getModel();
fullDetails.setText(text.toString());
javax.swing.SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
fullDetailsScrollpane.getVerticalScrollBar().setValue(0);
});
}
+ @Override
public void run()
{
loadingDasSources = true;
return selected;
}
+ @Override
public void refresh_actionPerformed(ActionEvent e)
{
saveProperties(jalview.bin.Cache.applicationProperties);
javax.swing.SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
filter1.setSelectedIndex(0);
});
}
+ @Override
public void amendLocal(boolean newSource)
{
String url = "http://localhost:8080/", nickname = "";
SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
scrollPane.getVerticalScrollBar().setValue(
refreshTableData(data);
SwingUtilities.invokeLater(new Runnable()
{
+ @Override
public void run()
{
scrollPane.getVerticalScrollBar().setValue(
}
}
+ @Override
public void valueChanged(ListSelectionEvent evt)
{
// Called when the MainTable selection changes
}
}
+ @Override
public void reset_actionPerformed(ActionEvent e)
{
registryURL.setText(sourceRegistry.getDasRegistryURL());
private Object[][] data;
+ @Override
public int getColumnCount()
{
return columnNames.length;
}
+ @Override
public int getRowCount()
{
return data.length;
}
+ @Override
public String getColumnName(int col)
{
return columnNames[col];
}
+ @Override
public Object getValueAt(int row, int col)
{
return data[row][col];
* each cell. If we didn't implement this method, then the last column would
* contain text ("true"/"false"), rather than a check box.
*/
+ @Override
public Class getColumnClass(int c)
{
return getValueAt(0, c).getClass();
/*
* Don't need to implement this method unless your table's editable.
*/
+ @Override
public boolean isCellEditable(int row, int col)
{
// Note that the data/cell address is constant,
/*
* Don't need to implement this method unless your table's data can change.
*/
+ @Override
public void setValueAt(Object value, int row, int col)
{
data[row][col] = value;
Thread thr = new Thread(new Runnable()
{
+ @Override
public void run()
{
// this actually initialises the das source list
import java.awt.Point;
import java.awt.Rectangle;
import java.awt.Toolkit;
+import java.awt.Window;
import java.awt.datatransfer.Clipboard;
import java.awt.datatransfer.ClipboardOwner;
import java.awt.datatransfer.DataFlavor;
import java.io.BufferedInputStream;
import java.io.File;
import java.io.FileOutputStream;
-import java.lang.reflect.Constructor;
import java.net.URL;
import java.util.ArrayList;
import java.util.Hashtable;
*/
instance = this;
doVamsasClientCheck();
- doGroovyCheck();
+
+ groovyShell = new JMenuItem();
+ groovyShell.setText(MessageManager.getString("label.groovy_console"));
+ groovyShell.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ groovyShell_actionPerformed();
+ }
+ });
+ toolsMenu.add(groovyShell);
+ groovyShell.setVisible(true);
+
doConfigureStructurePrefs();
setTitle("Jalview " + jalview.bin.Cache.getProperty("VERSION"));
setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
@Override
public void mousePressed(MouseEvent evt)
{
- if (SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
showPasteMenu(evt.getX(), evt.getY());
}
{
boolean success = true;
Transferable t = evt.getTransferable();
- java.util.List files = null;
- java.util.List protocols = null;
+ java.util.List<String> files = new ArrayList<String>();
+ java.util.List<String> protocols = new ArrayList<String>();
try
{
- DataFlavor uriListFlavor = new DataFlavor(
- "text/uri-list;class=java.lang.String");
- if (t.isDataFlavorSupported(DataFlavor.javaFileListFlavor))
- {
- // Works on Windows and MacOSX
- evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
- files = (java.util.List) t
- .getTransferData(DataFlavor.javaFileListFlavor);
- }
- else if (t.isDataFlavorSupported(uriListFlavor))
- {
- // This is used by Unix drag system
- evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
- String data = (String) t.getTransferData(uriListFlavor);
- files = new java.util.ArrayList(1);
- protocols = new java.util.ArrayList(1);
- for (java.util.StringTokenizer st = new java.util.StringTokenizer(
- data, "\r\n"); st.hasMoreTokens();)
- {
- String s = st.nextToken();
- if (s.startsWith("#"))
- {
- // the line is a comment (as per the RFC 2483)
- continue;
- }
- java.net.URI uri = new java.net.URI(s);
- if (uri.getScheme().toLowerCase().startsWith("http"))
- {
- protocols.add(FormatAdapter.URL);
- files.add(uri.toString());
- }
- else
- {
- // otherwise preserve old behaviour: catch all for file objects
- java.io.File file = new java.io.File(uri);
- protocols.add(FormatAdapter.FILE);
- files.add(file.toString());
- }
- }
- }
+ Desktop.transferFromDropTarget(files, protocols, evt, t);
} catch (Exception e)
{
+ e.printStackTrace();
success = false;
}
protected JMenuItem groovyShell;
- public void doGroovyCheck()
- {
- if (jalview.bin.Cache.groovyJarsPresent())
- {
- groovyShell = new JMenuItem();
- groovyShell.setText(MessageManager.getString("label.groovy_console"));
- groovyShell.addActionListener(new ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- groovyShell_actionPerformed();
- }
- });
- toolsMenu.add(groovyShell);
- groovyShell.setVisible(true);
- }
- }
-
/**
* Accessor method to quickly get all the AlignmentFrames loaded.
*
*/
public void groovyShell_actionPerformed()
{
- // use reflection to avoid creating compilation dependency.
- if (!jalview.bin.Cache.groovyJarsPresent())
- {
- throw new Error(
- MessageManager
- .getString("error.implementation_error_cannot_create_groovyshell"));
- }
try
{
- Class<?> gcClass = Desktop.class.getClassLoader().loadClass(
- "groovy.ui.Console");
- Constructor<?> gccons = gcClass.getConstructor();
- java.lang.reflect.Method setvar = gcClass.getMethod("setVariable",
- new Class[] { String.class, Object.class });
- java.lang.reflect.Method run = gcClass.getMethod("run");
- Object gc = gccons.newInstance();
- setvar.invoke(gc, new Object[] { "Jalview", this });
- run.invoke(gc);
+ openGroovyConsole();
} catch (Exception ex)
{
jalview.bin.Cache.log.error("Groovy Shell Creation failed.", ex);
}
/**
+ * Open the Groovy console
+ */
+ void openGroovyConsole()
+ {
+ groovyConsole = new groovy.ui.Console();
+
+ /*
+ * bind groovy variable 'Jalview' to the Desktop object
+ */
+ groovyConsole.setVariable("Jalview", this);
+
+ /*
+ * start the console
+ */
+ groovyConsole.run();
+
+ /*
+ * Allow only one console at a time, so that the AlignFrame menu option
+ * 'Calculate | Run Groovy script' is unambiguous.
+ * Disable 'new console', and enable 'Run script', when the console is
+ * opened, and the reverse when it is closed
+ */
+ Window window = (Window) groovyConsole.getFrame();
+ window.addWindowListener(new WindowAdapter()
+ {
+ @Override
+ public void windowClosed(WindowEvent e)
+ {
+ groovyShell.setEnabled(true);
+ enableExecuteGroovy(false);
+ }
+ });
+
+ /*
+ * if we got this far, enable 'Run Groovy' in AlignFrame menus
+ * and disable opening a second console
+ */
+ groovyShell.setEnabled(false);
+ enableExecuteGroovy(true);
+ }
+
+ /**
+ * Enable or disable 'Run Groovy script' in AlignFrame calculate menus
+ *
+ * @param enabled
+ */
+ public void enableExecuteGroovy(boolean enabled)
+ {
+ AlignFrame[] alignFrames = getAlignFrames();
+ if (alignFrames != null)
+ {
+ for (AlignFrame af : alignFrames)
+ {
+ af.setGroovyEnabled(enabled);
+ }
+ }
+ }
+
+ /**
* Progress bars managed by the IProgressIndicator method.
*/
private Hashtable<Long, JPanel> progressBars;
*/
private java.util.concurrent.Semaphore block = new Semaphore(0);
+ private static groovy.ui.Console groovyConsole;
+
/**
* add another dialog thread to the queue
*
Desktop.currentAlignFrame = currentAlignFrame;
}
+ public static groovy.ui.Console getGroovyConsole()
+ {
+ return groovyConsole;
+ }
+
+ public static void transferFromDropTarget(List<String> files,
+ List<String> protocols, DropTargetDropEvent evt, Transferable t)
+ throws Exception
+ {
+
+ DataFlavor uriListFlavor = new DataFlavor(
+ "text/uri-list;class=java.lang.String");
+ if (t.isDataFlavorSupported(DataFlavor.javaFileListFlavor))
+ {
+ // Works on Windows and MacOSX
+ Cache.log.debug("Drop handled as javaFileListFlavor");
+ evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ for (Object file : (List) t
+ .getTransferData(DataFlavor.javaFileListFlavor))
+ {
+ files.add(((File)file).toString());
+ protocols.add(FormatAdapter.FILE);
+ }
+ }
+ else
+ {
+ // Unix like behaviour
+ boolean added = false;
+ String data = null;
+ if (t.isDataFlavorSupported(uriListFlavor))
+ {
+ Cache.log.debug("Drop handled as uriListFlavor");
+ // This is used by Unix drag system
+ evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ data = (String) t.getTransferData(uriListFlavor);
+ }
+ if (data == null)
+ {
+ // fallback to text: workaround - on OSX where there's a JVM bug
+ Cache.log.debug("standard URIListFlavor failed. Trying text");
+ // try text fallback
+ data = (String) t.getTransferData(new DataFlavor(
+ "text/plain;class=java.lang.String"));
+ if (Cache.log.isDebugEnabled())
+ {
+ Cache.log.debug("fallback returned " + data);
+ }
+ }
+ while (protocols.size() < files.size())
+ {
+ Cache.log.debug("Adding missing FILE protocol for "
+ + files.get(protocols.size()));
+ protocols.add(FormatAdapter.FILE);
+ }
+ for (java.util.StringTokenizer st = new java.util.StringTokenizer(
+ data, "\r\n"); st.hasMoreTokens();)
+ {
+ added = true;
+ String s = st.nextToken();
+ if (s.startsWith("#"))
+ {
+ // the line is a comment (as per the RFC 2483)
+ continue;
+ }
+ java.net.URI uri = new java.net.URI(s);
+ if (uri.getScheme().toLowerCase().startsWith("http"))
+ {
+ protocols.add(FormatAdapter.URL);
+ files.add(uri.toString());
+ }
+ else
+ {
+ // otherwise preserve old behaviour: catch all for file objects
+ java.io.File file = new java.io.File(uri);
+ protocols.add(FormatAdapter.FILE);
+ files.add(file.toString());
+ }
+ }
+ if (Cache.log.isDebugEnabled())
+ {
+ if (data == null || !added)
+ {
+ Cache.log
+ .debug("Couldn't resolve drop data. Here are the supported flavors:");
+ for (DataFlavor fl : t.getTransferDataFlavors())
+ {
+ Cache.log.debug("Supported transfer dataflavor: "
+ + fl.toString());
+ evt.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ Object df = t.getTransferData(fl);
+ if (df != null)
+ {
+ Cache.log.debug("Retrieves: " + df);
+ }
+ else
+ {
+ Cache.log.debug("Retrieved nothing");
+ }
+ }
+ }
+ }
+ }
+ }
}
import jalview.io.JalviewFileChooser;
import jalview.schemes.AnnotationColourGradient;
import jalview.schemes.GraduatedColor;
+import jalview.util.Format;
import jalview.util.MessageManager;
+import jalview.util.QuickSort;
import jalview.viewmodel.AlignmentViewport;
import jalview.ws.dbsources.das.api.jalviewSourceI;
import java.util.Hashtable;
import java.util.Iterator;
import java.util.List;
+import java.util.Map;
import java.util.Set;
import java.util.Vector;
public void mousePressed(MouseEvent evt)
{
selectedRow = table.rowAtPoint(evt.getPoint());
- if (SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
popupSort(selectedRow, (String) table.getValueAt(selectedRow, 0),
table.getValueAt(selectedRow, 1), fr.getMinMax(),
}
protected void popupSort(final int selectedRow, final String type,
- final Object typeCol, final Hashtable minmax, int x, int y)
+ final Object typeCol, final Map<String, float[][]> minmax, int x,
+ int y)
{
JPopupMenu men = new JPopupMenu(MessageManager.formatMessage(
"label.settings_for_param", new String[] { type }));
men.add(dens);
if (minmax != null)
{
- final Object typeMinMax = minmax.get(type);
+ final float[][] typeMinMax = minmax.get(type);
/*
* final JCheckBoxMenuItem chb = new JCheckBoxMenuItem("Vary Height"); //
* this is broken at the moment and isn't that useful anyway!
*
* men.add(chb);
*/
- if (typeMinMax != null && ((float[][]) typeMinMax)[0] != null)
+ if (typeMinMax != null && typeMinMax[0] != null)
{
// if (table.getValueAt(row, column));
// graduated colourschemes for those where minmax exists for the
MessageManager.getString("label.select_columns_containing"));
selCols.addActionListener(new ActionListener()
{
-
@Override
public void actionPerformed(ActionEvent arg0)
{
MessageManager.getString("label.select_columns_not_containing"));
clearCols.addActionListener(new ActionListener()
{
-
@Override
public void actionPerformed(ActionEvent arg0)
{
false, type);
}
});
+ JMenuItem hideCols = new JMenuItem(
+ MessageManager.getString("label.hide_columns_containing"));
+ hideCols.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent arg0)
+ {
+ fr.ap.alignFrame.hideFeatureColumns(type, true);
+ }
+ });
+ JMenuItem hideOtherCols = new JMenuItem(
+ MessageManager.getString("label.hide_columns_not_containing"));
+ hideOtherCols.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent arg0)
+ {
+ fr.ap.alignFrame.hideFeatureColumns(type, false);
+ }
+ });
men.add(selCols);
men.add(clearCols);
+ men.add(hideCols);
+ men.add(hideOtherCols);
men.show(table, x, y);
}
void save()
{
JalviewFileChooser chooser = new JalviewFileChooser(
- jalview.bin.Cache.getProperty("LAST_DIRECTORY"),
+ Cache.getProperty("LAST_DIRECTORY"),
new String[] { "fc" },
new String[] { "Sequence Feature Colours" },
"Sequence Feature Colours");
PrintWriter out = new PrintWriter(new OutputStreamWriter(
new FileOutputStream(choice), "UTF-8"));
- Set fr_colours = fr.getAllFeatureColours();
- Iterator e = fr_colours.iterator();
+ Set<String> fr_colours = fr.getAllFeatureColours();
+ Iterator<String> e = fr_colours.iterator();
float[] sortOrder = new float[fr_colours.size()];
String[] sortTypes = new String[fr_colours.size()];
int i = 0;
while (e.hasNext())
{
- sortTypes[i] = e.next().toString();
+ sortTypes[i] = e.next();
sortOrder[i] = fr.getOrder(sortTypes[i]);
i++;
}
- jalview.util.QuickSort.sort(sortOrder, sortTypes);
+ QuickSort.sort(sortOrder, sortTypes);
sortOrder = null;
Object fcol;
GraduatedColor gcol;
- for (i = 0; i < sortTypes.length; i++)
+ for (String featureType : sortTypes)
{
jalview.schemabinding.version2.Colour col = new jalview.schemabinding.version2.Colour();
- col.setName(sortTypes[i]);
- col.setRGB(jalview.util.Format.getHexString(fr.getColour(col
- .getName())));
- fcol = fr.getFeatureStyle(sortTypes[i]);
+ col.setName(featureType);
+ fcol = fr.getFeatureStyle(featureType);
+ Color colour = fcol instanceof Color ? (Color) fcol
+ : ((GraduatedColor) fcol).getMaxColor();
+ col.setRGB(Format.getHexString(colour));
if (fcol instanceof GraduatedColor)
{
gcol = (GraduatedColor) fcol;
col.setMin(gcol.getMin());
col.setMax(gcol.getMax());
- col.setMinRGB(jalview.util.Format.getHexString(gcol
+ col.setMinRGB(Format.getHexString(gcol
.getMinColor()));
col.setAutoScale(gcol.isAutoScale());
col.setThreshold(gcol.getThresh());
*
* @return vector of selected das source nicknames
*/
- public Vector getSelectedSources()
+ public Vector<jalviewSourceI> getSelectedSources()
{
return dassourceBrowser.getSelectedSources();
}
* @param g
* DOCUMENT ME!
*/
+ @Override
public void paintComponent(Graphics g)
{
g.setColor(Color.white);
Font bold = new Font(av.getFont().getName(), Font.BOLD, av.getFont()
.getSize());
- if (av.isHiddenRepSequence(seq))
+ if (av.isReferenceSeq(seq) || av.isHiddenRepSequence(seq))
{
gg.setFont(bold);
}
*/
if (e.getClickCount() < 2 || SwingUtilities.isRightMouseButton(e))
{
+ // reinstate isRightMouseButton check to ignore mouse-related popup events
+ // note - this does nothing on default MacBookPro force-trackpad config!
return;
}
int seq = alignPanel.getSeqPanel().findSeq(e);
- if (SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
Sequence sq = (Sequence) av.getAlignment().getSequenceAt(seq);
// build a new links menu based on the current links + any non-positional
// features
- Vector nlinks = new Vector(Preferences.sequenceURLLinks);
- SequenceFeature sf[] = sq == null ? null : sq.getSequenceFeatures();
- for (int sl = 0; sf != null && sl < sf.length; sl++)
+ Vector<String> nlinks = new Vector<String>(
+ Preferences.sequenceURLLinks);
+ SequenceFeature sfs[] = sq == null ? null : sq.getSequenceFeatures();
+ if (sfs != null)
{
- if (sf[sl].begin == sf[sl].end && sf[sl].begin == 0)
+ for (SequenceFeature sf : sfs)
{
- if (sf[sl].links != null && sf[sl].links.size() > 0)
+ if (sf.begin == sf.end && sf.begin == 0)
{
- for (int l = 0, lSize = sf[sl].links.size(); l < lSize; l++)
+ if (sf.links != null && sf.links.size() > 0)
{
- nlinks.addElement(sf[sl].links.elementAt(l));
+ for (int l = 0, lSize = sf.links.size(); l < lSize; l++)
+ {
+ nlinks.addElement(sf.links.elementAt(l));
+ }
}
}
}
}
- jalview.gui.PopupMenu pop = new jalview.gui.PopupMenu(alignPanel, sq,
- nlinks, new Vector(Preferences.getGroupURLLinks()));
+ PopupMenu pop = new PopupMenu(alignPanel, sq, nlinks,
+ Preferences.getGroupURLLinks());
pop.show(this, e.getX(), e.getY());
return;
import jalview.structures.models.AAStructureBindingModel;
import jalview.util.MessageManager;
import jalview.util.Platform;
+import jalview.util.StringUtils;
import jalview.util.jarInputStreamProvider;
import jalview.viewmodel.AlignmentViewport;
import jalview.viewmodel.seqfeatures.FeatureRendererSettings;
import jalview.ws.params.AutoCalcSetting;
import jalview.ws.params.WsParamSetI;
+import java.awt.Color;
import java.awt.Rectangle;
import java.io.BufferedReader;
import java.io.DataInputStream;
import java.util.Map;
import java.util.Map.Entry;
import java.util.Set;
-import java.util.StringTokenizer;
import java.util.Vector;
import java.util.jar.JarEntry;
import java.util.jar.JarInputStream;
.getFeatureRenderer().getRenderOrder()
.toArray(new String[0]);
- Vector settingsAdded = new Vector();
+ Vector<String> settingsAdded = new Vector<String>();
Object gstyle = null;
GraduatedColor gcol = null;
if (renderOrder != null)
{
- for (int ro = 0; ro < renderOrder.length; ro++)
+ for (String featureType : renderOrder)
{
gstyle = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
- .getFeatureStyle(renderOrder[ro]);
+ .getFeatureStyle(featureType);
Setting setting = new Setting();
- setting.setType(renderOrder[ro]);
+ setting.setType(featureType);
if (gstyle instanceof GraduatedColor)
{
gcol = (GraduatedColor) gstyle;
}
else
{
- setting.setColour(ap.getSeqPanel().seqCanvas
- .getFeatureRenderer().getColour(renderOrder[ro])
- .getRGB());
+ setting.setColour(((Color) gstyle).getRGB());
}
setting.setDisplay(av.getFeaturesDisplayed().isVisible(
- renderOrder[ro]));
+ featureType));
float rorder = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
- .getOrder(renderOrder[ro]);
+ .getOrder(featureType);
if (rorder > -1)
{
setting.setOrder(rorder);
}
fs.addSetting(setting);
- settingsAdded.addElement(renderOrder[ro]);
+ settingsAdded.addElement(featureType);
}
}
- // Make sure we save none displayed feature settings
- Iterator en = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
- .getFeatureColours().keySet().iterator();
- while (en.hasNext())
- {
- String key = en.next().toString();
- if (settingsAdded.contains(key))
- {
- continue;
- }
-
- Setting setting = new Setting();
- setting.setType(key);
- setting.setColour(ap.getSeqPanel().seqCanvas.getFeatureRenderer()
- .getColour(key).getRGB());
-
- setting.setDisplay(false);
- float rorder = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
- .getOrder(key);
- if (rorder > -1)
- {
- setting.setOrder(rorder);
- }
- fs.addSetting(setting);
- settingsAdded.addElement(key);
- }
// is groups actually supposed to be a map here ?
- en = ap.getSeqPanel().seqCanvas.getFeatureRenderer()
+ Iterator<String> en = ap.getSeqPanel().seqCanvas
+ .getFeatureRenderer()
.getFeatureGroups().iterator();
- Vector groupsAdded = new Vector();
+ Vector<String> groupsAdded = new Vector<String>();
while (en.hasNext())
{
- String grp = en.next().toString();
+ String grp = en.next();
if (groupsAdded.contains(grp))
{
continue;
}
/**
+ * Answers true if 'version' is equal to or later than 'supported', where each
+ * is formatted as major/minor versions like "2.8.3" or "2.3.4b1" for bugfix
+ * changes. Development and test values for 'version' are leniently treated
+ * i.e. answer true.
*
* @param supported
* - minimum version we are comparing against
* @param version
- * - version of data being processsed.
- * @return true if version is development/null or evaluates to the same or
- * later X.Y.Z (where X,Y,Z are like [0-9]+b?[0-9]*)
+ * - version of data being processsed
+ * @return
*/
public static boolean isVersionStringLaterThan(String supported,
String version)
{
- if (version == null || version.equalsIgnoreCase("DEVELOPMENT BUILD")
+ if (supported == null || version == null
+ || version.equalsIgnoreCase("DEVELOPMENT BUILD")
|| version.equalsIgnoreCase("Test")
|| version.equalsIgnoreCase("AUTOMATED BUILD"))
{
}
else
{
- StringTokenizer currentV = new StringTokenizer(supported, "."), fileV = new StringTokenizer(
- version, ".");
- while (currentV.hasMoreTokens() && fileV.hasMoreTokens())
- {
- // convert b to decimal to catch bugfix releases within a series
- String curT = currentV.nextToken().toLowerCase().replace('b', '.');
- String fileT = fileV.nextToken().toLowerCase().replace('b', '.');
- try
- {
- float supportedVersionToken = Float.parseFloat(curT);
- float myVersiontoken = Float.parseFloat(fileT);
- if (supportedVersionToken > myVersiontoken)
- {
- // current version is newer than the version that wrote the file
- return false;
- }
- if (supportedVersionToken < myVersiontoken)
- {
- // current version is older than the version that wrote the file
- return true;
- }
- } catch (NumberFormatException nfe)
- {
- System.err
- .println("** WARNING: Version comparison failed for tokens ("
- + curT
- + ") and ("
- + fileT
- + ")\n** Current: '"
- + supported + "' and Version: '" + version + "'");
- }
- }
- if (currentV.hasMoreElements())
- {
- // fileV has no minor version but identical series to current
- return false;
- }
+ return StringUtils.compareVersions(version, supported, "b") >= 0;
}
- return true;
}
Vector<JalviewStructureDisplayI> newStructureViewers = null;
add(enabled, BorderLayout.NORTH);
for (Object str : opt.getPossibleValues())
{
- val.addItem((String) str);
+ val.addItem(str);
}
- val.setSelectedItem((String) opt.getValue());
+ val.setSelectedItem(opt.getValue());
if (opt.getPossibleValues().size() > 1)
{
setLayout(new GridLayout(1, 2));
setInitialValue();
}
+ @Override
public void actionPerformed(ActionEvent e)
{
if (e.getSource() != enabled)
return opt;
}
+ @Override
public void mouseClicked(MouseEvent e)
{
- if (javax.swing.SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
showUrlPopUp(this, finfo.toString(), e.getX(), e.getY());
}
}
+ @Override
public void mouseEntered(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mouseExited(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mousePressed(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mouseReleased(MouseEvent e)
{
// TODO Auto-generated method stub
showDesc.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent e)
{
descisvisible = !descisvisible;
validate();
}
+ @Override
public void actionPerformed(ActionEvent e)
{
if (adjusting)
lastVal = null;
}
+ @Override
public void mouseClicked(MouseEvent e)
{
- if (javax.swing.SwingUtilities.isRightMouseButton(e))
+ if (e.isPopupTrigger())
{
showUrlPopUp(this, finfo.toString(), e.getX(), e.getY());
}
}
+ @Override
public void mouseEntered(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mouseExited(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mousePressed(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void mouseReleased(MouseEvent e)
{
// TODO Auto-generated method stub
}
+ @Override
public void stateChanged(ChangeEvent e)
{
if (!adjusting)
{
valueField.setText(""
- + ((integ) ? ("" + (int) slider.getValue())
- : ("" + (float) (slider.getValue() / 1000f))));
+ + ((integ) ? ("" + slider.getValue())
+ : ("" + slider.getValue() / 1000f)));
checkIfModified();
}
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-
-package jalview.gui;
-
-import jalview.jbgui.GPDBSearchPanel;
-import jalview.jbgui.PDBDocFieldPreferences;
-import jalview.util.MessageManager;
-import jalview.ws.dbsources.PDBRestClient;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
-import jalview.ws.uimodel.PDBRestRequest;
-import jalview.ws.uimodel.PDBRestResponse;
-
-import java.util.ArrayList;
-import java.util.Collection;
-import java.util.Collections;
-import java.util.Comparator;
-import java.util.HashSet;
-import java.util.List;
-
-import javax.swing.table.DefaultTableModel;
-
-@SuppressWarnings("serial")
-public class PDBSearchPanel extends GPDBSearchPanel
-{
- private SequenceFetcher seqFetcher;
-
- private IProgressIndicator progressIdicator;
-
- private Collection<PDBDocField> wantedFields;
-
- public PDBSearchPanel(SequenceFetcher seqFetcher)
- {
- this.seqFetcher = seqFetcher;
- this.progressIdicator = (seqFetcher == null) ? null : seqFetcher
- .getProgressIndicator();
- }
-
- /**
- * Action performed when an input is detected on txt_search field.
- */
- @Override
- public void txt_search_ActionPerformed()
- {
- new Thread()
- {
- @Override
- public void run()
- {
- lbl_loading.setVisible(false);
- errorWarning.setLength(0);
- lbl_warning.setVisible(false);
- btn_ok.setEnabled(false);
- boolean allowEmptySequence = false;
- mainFrame.setTitle(MessageManager
- .getString("label.pdb_sequence_getcher"));
- tbl_summary.setModel(new DefaultTableModel());
- if (txt_search.getText().trim().length() > 0)
- {
- lbl_loading.setVisible(true);
- long startTime = System.currentTimeMillis();
-
- String searchTarget = ((PDBDocField) cmb_searchTarget
- .getSelectedItem()).getCode();
-
- wantedFields = PDBDocFieldPreferences.getSearchSummaryFields();
-
- String searchTerm = decodeSearchTerm(txt_search.getText(),
- searchTarget);
-
- PDBRestRequest request = new PDBRestRequest();
- request.setAllowEmptySeq(allowEmptySequence);
- request.setResponseSize(100);
- request.setFieldToSearchBy("(" + searchTarget + ":");
- request.setSearchTerm(searchTerm + ")");
- request.setWantedFields(wantedFields);
- // System.out.println(">>>>>>>>>>>>>> " + request.getQuery());
- PDBRestClient pdbRestCleint = new PDBRestClient();
- PDBRestResponse resultList;
- try
- {
- resultList = pdbRestCleint.executeRequest(request);
- } catch (Exception e)
- {
- // e.printStackTrace();
- errorWarning.append(e.getMessage());
- checkForErrors();
- return;
- }
-
- if (resultList.getSearchSummary() != null)
- {
- tbl_summary.setModel(PDBRestResponse.getTableModel(request,
- resultList.getSearchSummary()));
- }
-
- PDBRestResponse.configureTableColumn(tbl_summary, wantedFields);
-
- long endTime = System.currentTimeMillis();
- int resultSetCount = resultList.getNumberOfItemsFound();
- String result = (resultSetCount > 1) ? MessageManager
- .getString("label.results") : MessageManager
- .getString("label.result");
- mainFrame.setTitle(frameTitle + " - " + resultSetCount + " "
- + result + " (" + (endTime - startTime) + " milli secs)");
- lbl_loading.setVisible(false);
- }
- }
- }.start();
- }
-
- public static String decodeSearchTerm(String enteredText,
- String targetField)
- {
- String foundSearchTerms = enteredText;
- StringBuilder foundSearchTermsBuilder = new StringBuilder();
- if (enteredText.contains(";"))
- {
- String[] searchTerms = enteredText.split(";");
- for (String searchTerm : searchTerms)
- {
- if (searchTerm.contains(":"))
- {
- foundSearchTermsBuilder.append(targetField).append(":")
- .append(searchTerm.split(":")[0]).append(" OR ");
- }
- else
- {
- foundSearchTermsBuilder.append(targetField).append(":")
- .append(searchTerm).append(" OR ");
- }
- }
- int endIndex = foundSearchTermsBuilder.lastIndexOf(" OR ");
- foundSearchTerms = foundSearchTermsBuilder.toString();
- if (foundSearchTerms.contains(" OR "))
- {
- foundSearchTerms = foundSearchTerms.substring(
- targetField.length() + 1, endIndex);
- }
- }
- else if (enteredText.contains(":"))
- {
- foundSearchTerms = foundSearchTerms.split(":")[0];
- }
- return foundSearchTerms;
- }
-
- @Override
- public void btn_ok_ActionPerformed()
- {
- loadSelectedPDBSequencesToAlignment();
- }
-
- @Override
- public void btn_back_ActionPerformed()
- {
- mainFrame.dispose();
- new SequenceFetcher(progressIdicator);
- }
-
- @Override
- public void btn_cancel_ActionPerformed()
- {
- mainFrame.dispose();
- }
-
- @Override
- public void transferToSequenceFetcher(String ids)
- {
- // mainFrame.dispose();
- seqFetcher.textArea.setText(ids);
- Thread worker = new Thread(seqFetcher);
- worker.start();
- }
-
- /**
- * Add the discovered/selected sequences to a target alignment window
- */
- public void loadSelectedPDBSequencesToAlignment()
- {
- // mainFrame.dispose();
- disableActionButtons();
- StringBuilder selectedIds = new StringBuilder();
- HashSet<String> selectedIdsSet = new HashSet<String>();
- int pdbIdCol = PDBRestClient.getPDBIdColumIndex(wantedFields, false);
- int[] selectedRows = tbl_summary.getSelectedRows();
- for (int summaryRow : selectedRows)
- {
- String pdbIdStr = tbl_summary.getValueAt(summaryRow, pdbIdCol)
- .toString();
- String searchTerm = txt_search.getText();
- selectedIdsSet.add(getPDBIdwithSpecifiedChain(pdbIdStr, searchTerm));
- }
-
- for (String selectedId : selectedIdsSet)
- {
- selectedIds.append(selectedId).append(";");
- }
-
- String ids = selectedIds.toString();
- // System.out.println(">>>>>>>>>>>>>>>> selected Ids: " + ids);
- seqFetcher.textArea.setText(ids);
- Thread worker = new Thread(seqFetcher);
- worker.start();
- delayAndEnableActionButtons();
-
- }
-
- private void disableActionButtons()
- {
- btn_ok.setEnabled(false);
- btn_back.setEnabled(false);
- btn_cancel.setEnabled(false);
- }
-
- private void delayAndEnableActionButtons()
- {
- new Thread()
- {
- @Override
- public void run()
- {
- try
- {
- Thread.sleep(1500);
- } catch (InterruptedException e)
- {
- e.printStackTrace();
- }
- btn_ok.setEnabled(true);
- btn_back.setEnabled(true);
- btn_cancel.setEnabled(true);
- }
- }.start();
- }
-
- public static String getPDBIdwithSpecifiedChain(String pdbId,
- String searchTerm)
- {
- String pdbIdWithChainCode = "";
- if (searchTerm.contains(";"))
- {
- String[] foundTerms = searchTerm.split(";");
- for (String foundTerm : foundTerms)
- {
- if (foundTerm.contains(pdbId))
- {
- pdbIdWithChainCode = foundTerm;
- }
- }
- }
- else if (searchTerm.contains(pdbId))
- {
- pdbIdWithChainCode = searchTerm;
- }
- else
- {
- pdbIdWithChainCode = pdbId;
- }
- return pdbIdWithChainCode;
- }
-
- /**
- * Populates search target combo-box options
- */
- @Override
- public void populateCmbSearchTargetOptions()
- {
- List<PDBDocField> searchableTargets = new ArrayList<PDBDocField>();
- searchableTargets.add(PDBDocField.PDB_ID);
- searchableTargets.add(PDBDocField.PFAM_ACCESSION);
- searchableTargets.add(PDBDocField.MOLECULE_TYPE);
- searchableTargets.add(PDBDocField.MOLECULE_NAME);
- searchableTargets.add(PDBDocField.UNIPROT_ACCESSION);
- searchableTargets.add(PDBDocField.GENE_NAME);
- searchableTargets.add(PDBDocField.GENUS);
- searchableTargets.add(PDBDocField.ALL);
-
- Collections.sort(searchableTargets, new Comparator<PDBDocField>()
- {
- @Override
- public int compare(PDBDocField o1, PDBDocField o2)
- {
- return o1.getName().compareTo(o2.getName());
- }
- });
-
- for (PDBDocField searchTarget : searchableTargets)
- {
- cmb_searchTarget.addItem(searchTarget);
- }
- }
-
- public void checkForErrors()
- {
- lbl_warning.setVisible(false);
- if (errorWarning.length() > 0)
- {
- lbl_loading.setVisible(false);
- lbl_warning.setToolTipText(JvSwingUtils.wrapTooltip(true,
- errorWarning.toString()));
- lbl_warning.setVisible(true);
- }
- }
-}
import jalview.analysis.AlignmentAnnotationUtils;
import jalview.analysis.AlignmentUtils;
import jalview.analysis.Conservation;
+import jalview.bin.Cache;
import jalview.commands.ChangeCaseCommand;
import jalview.commands.EditCommand;
import jalview.commands.EditCommand.Action;
import jalview.schemes.TurnColourScheme;
import jalview.schemes.UserColourScheme;
import jalview.schemes.ZappoColourScheme;
+import jalview.util.DBRefUtils;
import jalview.util.GroupUrlLink;
import jalview.util.GroupUrlLink.UrlStringTooLongException;
import jalview.util.MessageManager;
import jalview.util.UrlLink;
+import jalview.ws.DBRefFetcher;
import java.awt.Color;
import java.awt.event.ActionEvent;
import java.awt.event.ActionListener;
+import java.util.ArrayList;
import java.util.Arrays;
import java.util.Collections;
import java.util.Hashtable;
{
private static final String ALL_ANNOTATIONS = "All";
- private static final String COMMA = ",";
-
JMenu groupMenu = new JMenu();
JMenuItem groupName = new JMenuItem();
* @param seq
* DOCUMENT ME!
*/
- public PopupMenu(final AlignmentPanel ap, Sequence seq, Vector links)
+ public PopupMenu(final AlignmentPanel ap, Sequence seq, List<String> links)
{
this(ap, seq, links, null);
}
* @param groupLinks
*/
public PopupMenu(final AlignmentPanel ap, final SequenceI seq,
- Vector links, Vector groupLinks)
+ List<String> links, List<String> groupLinks)
{
// /////////////////////////////////////////////////////////
// If this is activated from the sequence panel, the user may want to
if (links != null && links.size() > 0)
{
+ addFeatureLinks(seq, links);
+ }
+ }
- JMenu linkMenu = new JMenu(MessageManager.getString("action.link"));
- Vector linkset = new Vector();
- for (int i = 0; i < links.size(); i++)
+ /**
+ * Adds a 'Link' menu item with a sub-menu item for each hyperlink provided.
+ *
+ * @param seq
+ * @param links
+ */
+ void addFeatureLinks(final SequenceI seq, List<String> links)
+ {
+ JMenu linkMenu = new JMenu(MessageManager.getString("action.link"));
+ List<String> linkset = new ArrayList<String>();
+ for (String link : links)
+ {
+ UrlLink urlLink = null;
+ try
{
- String link = links.elementAt(i).toString();
- UrlLink urlLink = null;
- try
- {
- urlLink = new UrlLink(link);
- } catch (Exception foo)
- {
- jalview.bin.Cache.log.error("Exception for URLLink '" + link
- + "'", foo);
- continue;
- }
- ;
- if (!urlLink.isValid())
+ urlLink = new UrlLink(link);
+ } catch (Exception foo)
+ {
+ Cache.log.error("Exception for URLLink '" + link + "'", foo);
+ continue;
+ }
+ ;
+ if (!urlLink.isValid())
+ {
+ Cache.log.error(urlLink.getInvalidMessage());
+ continue;
+ }
+ final String label = urlLink.getLabel();
+ if (seq != null && urlLink.isDynamic())
+ {
+
+ // collect matching db-refs
+ DBRefEntry[] dbr = DBRefUtils.selectRefs(seq.getDBRefs(),
+ new String[] { urlLink.getTarget() });
+ // collect id string too
+ String id = seq.getName();
+ String descr = seq.getDescription();
+ if (descr != null && descr.length() < 1)
{
- jalview.bin.Cache.log.error(urlLink.getInvalidMessage());
- continue;
+ descr = null;
}
- final String label = urlLink.getLabel();
- if (seq != null && urlLink.isDynamic())
- {
- // collect matching db-refs
- DBRefEntry[] dbr = jalview.util.DBRefUtils.selectRefs(
- seq.getDBRefs(), new String[] { urlLink.getTarget() });
- // collect id string too
- String id = seq.getName();
- String descr = seq.getDescription();
- if (descr != null && descr.length() < 1)
- {
- descr = null;
- }
-
- if (dbr != null)
+ if (dbr != null)
+ {
+ for (int r = 0; r < dbr.length; r++)
{
- for (int r = 0; r < dbr.length; r++)
+ if (id != null && dbr[r].getAccessionId().equals(id))
{
- if (id != null && dbr[r].getAccessionId().equals(id))
- {
- // suppress duplicate link creation for the bare sequence ID
- // string with this link
- id = null;
- }
- // create Bare ID link for this RUL
- String[] urls = urlLink.makeUrls(dbr[r].getAccessionId(),
- true);
- if (urls != null)
- {
- for (int u = 0; u < urls.length; u += 2)
- {
- if (!linkset.contains(urls[u] + "|" + urls[u + 1]))
- {
- linkset.addElement(urls[u] + "|" + urls[u + 1]);
- addshowLink(linkMenu, label + "|" + urls[u],
- urls[u + 1]);
- }
- }
- }
+ // suppress duplicate link creation for the bare sequence ID
+ // string with this link
+ id = null;
}
- }
- if (id != null)
- {
- // create Bare ID link for this RUL
- String[] urls = urlLink.makeUrls(id, true);
+ // create Bare ID link for this URL
+ String[] urls = urlLink.makeUrls(dbr[r].getAccessionId(), true);
if (urls != null)
{
for (int u = 0; u < urls.length; u += 2)
{
if (!linkset.contains(urls[u] + "|" + urls[u + 1]))
{
- linkset.addElement(urls[u] + "|" + urls[u + 1]);
- addshowLink(linkMenu, label, urls[u + 1]);
+ linkset.add(urls[u] + "|" + urls[u + 1]);
+ addshowLink(linkMenu, label + "|" + urls[u], urls[u + 1]);
}
}
}
}
- // Create urls from description but only for URL links which are regex
- // links
- if (descr != null && urlLink.getRegexReplace() != null)
+ }
+ if (id != null)
+ {
+ // create Bare ID link for this URL
+ String[] urls = urlLink.makeUrls(id, true);
+ if (urls != null)
{
- // create link for this URL from description where regex matches
- String[] urls = urlLink.makeUrls(descr, true);
- if (urls != null)
+ for (int u = 0; u < urls.length; u += 2)
{
- for (int u = 0; u < urls.length; u += 2)
+ if (!linkset.contains(urls[u] + "|" + urls[u + 1]))
{
- if (!linkset.contains(urls[u] + "|" + urls[u + 1]))
- {
- linkset.addElement(urls[u] + "|" + urls[u + 1]);
- addshowLink(linkMenu, label, urls[u + 1]);
- }
+ linkset.add(urls[u] + "|" + urls[u + 1]);
+ addshowLink(linkMenu, label, urls[u + 1]);
}
}
}
}
- else
+ // Create urls from description but only for URL links which are regex
+ // links
+ if (descr != null && urlLink.getRegexReplace() != null)
{
- if (!linkset.contains(label + "|" + urlLink.getUrl_prefix()))
+ // create link for this URL from description where regex matches
+ String[] urls = urlLink.makeUrls(descr, true);
+ if (urls != null)
{
- linkset.addElement(label + "|" + urlLink.getUrl_prefix());
- // Add a non-dynamic link
- addshowLink(linkMenu, label, urlLink.getUrl_prefix());
+ for (int u = 0; u < urls.length; u += 2)
+ {
+ if (!linkset.contains(urls[u] + "|" + urls[u + 1]))
+ {
+ linkset.add(urls[u] + "|" + urls[u + 1]);
+ addshowLink(linkMenu, label, urls[u + 1]);
+ }
+ }
}
}
}
- if (sequence != null)
- {
- sequenceMenu.add(linkMenu);
- }
else
{
- add(linkMenu);
+ if (!linkset.contains(label + "|" + urlLink.getUrl_prefix()))
+ {
+ linkset.add(label + "|" + urlLink.getUrl_prefix());
+ // Add a non-dynamic link
+ addshowLink(linkMenu, label, urlLink.getUrl_prefix());
+ }
}
}
+ if (sequence != null)
+ {
+ sequenceMenu.add(linkMenu);
+ }
+ else
+ {
+ add(linkMenu);
+ }
}
/**
showOrHideMenu.add(item);
}
- private void buildGroupURLMenu(SequenceGroup sg, Vector groupLinks)
+ private void buildGroupURLMenu(SequenceGroup sg, List<String> groupLinks)
{
// TODO: usability: thread off the generation of group url content so root
// ID/regex match URLs
groupLinksMenu = new JMenu(
MessageManager.getString("action.group_link"));
+ // three types of url that might be created.
JMenu[] linkMenus = new JMenu[] { null,
new JMenu(MessageManager.getString("action.ids")),
new JMenu(MessageManager.getString("action.sequences")),
- new JMenu(MessageManager.getString("action.ids_sequences")) }; // three
- // types
- // of url
- // that
- // might
- // be
- // created.
+ new JMenu(MessageManager.getString("action.ids_sequences")) };
+
SequenceI[] seqs = ap.av.getSelectionAsNewSequence();
String[][] idandseqs = GroupUrlLink.formStrings(seqs);
- Hashtable commonDbrefs = new Hashtable();
+ Hashtable<String, Object[]> commonDbrefs = new Hashtable<String, Object[]>();
for (int sq = 0; sq < seqs.length; sq++)
{
for (int d = 0; d < dbr.length; d++)
{
String src = dbr[d].getSource(); // jalview.util.DBRefUtils.getCanonicalName(dbr[d].getSource()).toUpperCase();
- Object[] sarray = (Object[]) commonDbrefs.get(src);
+ Object[] sarray = commonDbrefs.get(src);
if (sarray == null)
{
sarray = new Object[2];
// now create group links for all distinct ID/sequence sets.
boolean addMenu = false; // indicates if there are any group links to give
// to user
- for (int i = 0; i < groupLinks.size(); i++)
+ for (String link : groupLinks)
{
- String link = groupLinks.elementAt(i).toString();
GroupUrlLink urlLink = null;
try
{
urlLink = new GroupUrlLink(link);
} catch (Exception foo)
{
- jalview.bin.Cache.log.error("Exception for GroupURLLink '" + link
+ Cache.log.error("Exception for GroupURLLink '" + link
+ "'", foo);
continue;
}
;
if (!urlLink.isValid())
{
- jalview.bin.Cache.log.error(urlLink.getInvalidMessage());
+ Cache.log.error(urlLink.getInvalidMessage());
continue;
}
final String label = urlLink.getLabel();
boolean usingNames = false;
// Now see which parts of the group apply for this URL
String ltarget = urlLink.getTarget(); // jalview.util.DBRefUtils.getCanonicalName(urlLink.getTarget());
- Object[] idset = (Object[]) commonDbrefs.get(ltarget.toUpperCase());
+ Object[] idset = commonDbrefs.get(ltarget.toUpperCase());
String[] seqstr, ids; // input to makeUrl
if (idset != null)
{
new Object[] { urlgenerator.getUrl_prefix(),
urlgenerator.getNumberInvolved(urlstub) }));
// TODO: put in info about what is being sent.
- item.addActionListener(new java.awt.event.ActionListener()
+ item.addActionListener(new ActionListener()
{
@Override
public void actionPerformed(ActionEvent e)
try
{
showLink(urlgenerator.constructFrom(urlstub));
- } catch (UrlStringTooLongException e)
+ } catch (UrlStringTooLongException e2)
{
}
}
@Override
public void run()
{
- boolean isNuclueotide = ap.alignFrame.getViewport().getAlignment()
+ boolean isNucleotide = ap.alignFrame.getViewport().getAlignment()
.isNucleotide();
- new jalview.ws.DBRefFetcher(sequences, ap.alignFrame, null,
- ap.alignFrame.featureSettings, isNuclueotide)
+ new DBRefFetcher(sequences, ap.alignFrame, null,
+ ap.alignFrame.featureSettings, isNucleotide)
.fetchDBRefs(false);
}
import jalview.jbgui.GSequenceLink;
import jalview.schemes.ColourSchemeProperty;
import jalview.util.MessageManager;
+import jalview.util.Platform;
import jalview.ws.sifts.SiftsSettings;
import java.awt.BorderLayout;
import java.awt.event.ActionListener;
import java.awt.event.MouseEvent;
import java.io.File;
-import java.util.Collection;
+import java.util.ArrayList;
import java.util.List;
import java.util.StringTokenizer;
import java.util.Vector;
* Holds name and link separated with | character. Sequence ID must be
* $SEQUENCE_ID$ or $SEQUENCE_ID=/.possible | chars ./=$
*/
- public static Vector sequenceURLLinks;
+ public static Vector<String> sequenceURLLinks;
/**
* Holds name and link separated with | character. Sequence IDS and Sequences
* (TODO: proper escape for using | to separate ids or sequences
*/
- public static Vector groupURLLinks;
+ public static List<String> groupURLLinks;
static
{
String string = Cache
.getDefault(
"SEQUENCE_LINKS",
"EMBL-EBI Search|http://www.ebi.ac.uk/ebisearch/search.ebi?db=allebi&query=$SEQUENCE_ID$");
- sequenceURLLinks = new Vector();
+ sequenceURLLinks = new Vector<String>();
try
{
* .properties file as '|' separated strings
*/
- groupURLLinks = new Vector();
+ groupURLLinks = new ArrayList<String>();
}
- Vector nameLinks, urlLinks;
+ Vector<String> nameLinks, urlLinks;
JInternalFrame frame;
private WsPreferences wsPrefs;
+ private OptionsParam promptEachTimeOpt = new OptionsParam(
+ MessageManager.getString("label.prompt_each_time"),
+ "Prompt each time");
+
+ private OptionsParam lineArtOpt = new OptionsParam(
+ MessageManager.getString("label.lineart"), "Lineart");
+
+ private OptionsParam textOpt = new OptionsParam(
+ MessageManager.getString("action.text"), "Text");
+
/**
* Creates a new Preferences object.
*/
wsPrefs = new WsPreferences();
wsTab.add(wsPrefs, BorderLayout.CENTER);
int width = 500, height = 450;
- if (new jalview.util.Platform().isAMac())
+ new jalview.util.Platform();
+ if (Platform.isAMac())
{
width = 570;
height = 480;
/*
* Set Connections tab defaults
*/
- nameLinks = new Vector();
- urlLinks = new Vector();
+ nameLinks = new Vector<String>();
+ urlLinks = new Vector<String>();
for (int i = 0; i < sequenceURLLinks.size(); i++)
{
String link = sequenceURLLinks.elementAt(i).toString();
/*
* Set Output tab defaults
*/
- epsRendering
- .addItem(MessageManager.getString("label.prompt_each_time"));
- epsRendering.addItem(MessageManager.getString("label.lineart"));
- epsRendering.addItem(MessageManager.getString("action.text"));
- epsRendering.setSelectedItem(Cache.getDefault("EPS_RENDERING",
- "Prompt each time"));
+ epsRendering.addItem(promptEachTimeOpt);
+ epsRendering.addItem(lineArtOpt);
+ epsRendering.addItem(textOpt);
+ String defaultEPS = Cache.getDefault("EPS_RENDERING",
+ "Prompt each time");
+ if (defaultEPS.equalsIgnoreCase("Text"))
+ {
+ epsRendering.setSelectedItem(textOpt);
+ }
+ else if (defaultEPS.equalsIgnoreCase("Lineart"))
+ {
+ epsRendering.setSelectedItem(lineArtOpt);
+ }
+ else
+ {
+ epsRendering.setSelectedItem(promptEachTimeOpt);
+ }
autoIdWidth.setSelected(Cache.getDefault("FIGURE_AUTOIDWIDTH", false));
userIdWidth.setEnabled(!autoIdWidth.isSelected());
userIdWidthlabel.setEnabled(!autoIdWidth.isSelected());
/*
* Save Output settings
*/
- if (epsRendering.getSelectedItem().equals("Prompt each time"))
- {
- Cache.applicationProperties.remove("EPS_RENDERING");
- }
- else
- {
- Cache.applicationProperties.setProperty("EPS_RENDERING", epsRendering
- .getSelectedItem().toString());
- }
+ Cache.applicationProperties.setProperty("EPS_RENDERING",
+ ((OptionsParam) epsRendering.getSelectedItem()).getCode());
/*
* Save Connections settings
if (nameLinks.size() > 0)
{
StringBuffer links = new StringBuffer();
- sequenceURLLinks = new Vector();
+ sequenceURLLinks = new Vector<String>();
for (int i = 0; i < nameLinks.size(); i++)
{
sequenceURLLinks.addElement(nameLinks.elementAt(i) + "|"
super.showunconserved_actionPerformed(e);
}
- public static Collection getGroupURLLinks()
+ public static List<String> getGroupURLLinks()
{
return groupURLLinks;
}
}
}
+ public class OptionsParam
+ {
+ private String name;
+
+ private String code;
+
+ public OptionsParam(String name, String code)
+ {
+ this.name = name;
+ this.code = code;
+ }
+
+ public String getName()
+ {
+ return name;
+ }
+
+ public void setName(String name)
+ {
+ this.name = name;
+ }
+
+ public String getCode()
+ {
+ return code;
+ }
+
+ public void setCode(String code)
+ {
+ this.code = code;
+ }
+
+ @Override
+ public String toString()
+ {
+ return name;
+ }
+
+ @Override
+ public boolean equals(Object that)
+ {
+ if (!(that instanceof OptionsParam))
+ {
+ return false;
+ }
+ return this.code.equalsIgnoreCase(((OptionsParam) that).code);
+ }
+
+ @Override
+ public int hashCode(){
+ return name.hashCode() + code.hashCode();
+ }
+ }
}
import java.awt.event.MouseEvent;
import java.awt.event.MouseListener;
import java.awt.event.MouseMotionListener;
+import java.util.List;
import javax.swing.JMenuItem;
import javax.swing.JPanel;
import javax.swing.JPopupMenu;
-import javax.swing.SwingUtilities;
import javax.swing.ToolTipManager;
/**
- * DOCUMENT ME!
- *
- * @author $author$
- * @version $Revision$
+ * The panel containing the sequence ruler (when not in wrapped mode), and
+ * supports a range of mouse operations to select, hide or reveal columns.
*/
public class ScalePanel extends JPanel implements MouseMotionListener,
MouseListener
{
protected int offy = 4;
- /** DOCUMENT ME!! */
public int width;
protected AlignViewport av;
boolean stretchingGroup = false;
- int min; // used by mouseDragged to see if user
+ /*
+ * min, max hold the extent of a mouse drag action
+ */
+ int min;
- int max; // used by mouseDragged to see if user
+ int max;
boolean mouseDragging = false;
- // wants to delete columns
+ /*
+ * holds a hidden column range when the mouse is over an adjacent column
+ */
+ int[] reveal;
+
+ /**
+ * Constructor
+ *
+ * @param av
+ * @param ap
+ */
public ScalePanel(AlignViewport av, AlignmentPanel ap)
{
this.av = av;
min = res;
max = res;
- if (SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
rightMouseButtonPressed(evt, res);
}
@Override
public void mouseMoved(MouseEvent evt)
{
+ this.setToolTipText(null);
+ reveal = null;
if (!av.hasHiddenColumns())
{
return;
res = av.getColumnSelection().adjustForHiddenColumns(res);
- reveal = null;
if (av.getColumnSelection().getHiddenColumns() != null)
{
for (int[] region : av.getColumnSelection().getHiddenColumns())
.getString("label.reveal_hidden_columns"));
break;
}
- else
- {
- this.setToolTipText(null);
- }
}
}
repaint();
}
- int[] reveal;
-
/**
* DOCUMENT ME!
*
ColumnSelection cs = av.getColumnSelection();
int avCharWidth = av.getCharWidth(), avCharHeight = av.getCharHeight();
- int s;
if (cs != null)
{
gg.setColor(new Color(220, 0, 0));
}
}
}
- // Draw the scale numbers
- gg.setColor(Color.black);
- int scalestartx = (startx / 10) * 10;
int widthx = 1 + endx - startx;
FontMetrics fm = gg.getFontMetrics(av.getFont());
- int y = avCharHeight - fm.getDescent();
-
- if ((scalestartx % 10) == 0)
- {
- scalestartx += 5;
- }
-
- String string;
- int maxX = 0;
-
- for (int i = scalestartx; i < endx; i += 5)
- {
- if ((i % 10) == 0)
- {
- string = String.valueOf(av.getColumnSelection()
- .adjustForHiddenColumns(i));
- if ((i - startx - 1) * avCharWidth > maxX)
- {
- gg.drawString(string, (i - startx - 1) * avCharWidth, y);
- maxX = (i - startx + 1) * avCharWidth + fm.stringWidth(string);
- }
-
- gg.drawLine(((i - startx - 1) * avCharWidth) + (avCharWidth / 2),
- y + 2,
- ((i - startx - 1) * avCharWidth) + (avCharWidth / 2), y
- + (fm.getDescent() * 2));
- }
- else
- {
- gg.drawLine(((i - startx - 1) * avCharWidth) + (avCharWidth / 2), y
- + fm.getDescent(), ((i - startx - 1) * avCharWidth)
- + (avCharWidth / 2), y + (fm.getDescent() * 2));
- }
- }
-
+ int y = avCharHeight, yOf = fm.getDescent();
+ y -= yOf;
if (av.hasHiddenColumns())
{
+ // draw any hidden column markers
gg.setColor(Color.blue);
int res;
if (av.getShowHiddenMarkers()
continue;
}
- gg.fillPolygon(new int[] { res * avCharWidth - avCharHeight / 4,
- res * avCharWidth + avCharHeight / 4, res * avCharWidth },
- new int[] { y - avCharHeight / 2, y - avCharHeight / 2,
- y + 8 }, 3);
+ gg.fillPolygon(new int[] {
+ -1 + res * avCharWidth - avCharHeight / 4,
+ -1 + res * avCharWidth + avCharHeight / 4,
+ -1 + res * avCharWidth }, new int[] { y, y, y + 2 * yOf }, 3);
}
}
+ }
+ // Draw the scale numbers
+ gg.setColor(Color.black);
+ int maxX = 0;
+ List<Object[]> marks = jalview.renderer.ScaleRenderer.calculateMarks(
+ av, startx, endx);
+
+ for (Object[] mark : marks)
+ {
+ boolean major = Boolean.valueOf((Boolean) mark[0]);
+ int mpos = ((Integer) mark[1]).intValue(); // (i - startx - 1)
+ String mstring = (String) mark[2];
+ if (mstring != null)
+ {
+ if (mpos * avCharWidth > maxX)
+ {
+ gg.drawString(mstring, mpos * avCharWidth, y);
+ maxX = (mpos + 2) * avCharWidth + fm.stringWidth(mstring);
+ }
+ }
+ if (major)
+ {
+ gg.drawLine((mpos * avCharWidth) + (avCharWidth / 2), y + 2,
+ (mpos * avCharWidth) + (avCharWidth / 2), y + (yOf * 2));
+ }
+ else
+ {
+ gg.drawLine((mpos * avCharWidth) + (avCharWidth / 2), y + yOf,
+ (mpos * avCharWidth) + (avCharWidth / 2), y + (yOf * 2));
+ }
+ }
+ if (av.hasHiddenColumns())
+ {
if (reveal != null && reveal[0] > startx && reveal[0] < endx)
{
gg.drawString(MessageManager.getString("label.reveal_columns"),
}
}
+
}
private void drawNorthScale(Graphics g, int startx, int endx, int ypos)
{
updateViewport();
- int scalestartx = startx - (startx % 10) + 10;
-
- g.setColor(Color.black);
- // NORTH SCALE
- for (int i = scalestartx; i < endx; i += 10)
+ for (Object[] mark : jalview.renderer.ScaleRenderer.calculateMarks(av,
+ startx, endx))
{
- int value = i;
- if (av.hasHiddenColumns())
+ int mpos = ((Integer) mark[1]).intValue(); // (i - startx - 1)
+ if (mpos < 0)
{
- value = av.getColumnSelection().adjustForHiddenColumns(value);
+ continue;
}
+ String mstring = (String) mark[2];
- g.drawString(String.valueOf(value), (i - startx - 1) * charWidth,
- ypos - (charHeight / 2));
-
- g.drawLine(((i - startx - 1) * charWidth) + (charWidth / 2),
- (ypos + 2) - (charHeight / 2), ((i - startx - 1) * charWidth)
- + (charWidth / 2), ypos - 2);
+ if (Boolean.valueOf((Boolean) mark[0]))
+ {
+ if (mstring != null)
+ {
+ g.drawString(mstring, mpos * charWidth, ypos - (charHeight / 2));
+ }
+ g.drawLine((mpos * charWidth) + (charWidth / 2), (ypos + 2)
+ - (charHeight / 2), (mpos * charWidth) + (charWidth / 2),
+ ypos - 2);
+ }
}
}
package jalview.gui;
import jalview.api.AlignViewportI;
+import jalview.bin.Cache;
import jalview.commands.EditCommand;
import jalview.commands.EditCommand.Action;
import jalview.commands.EditCommand.Edit;
import java.awt.event.MouseMotionListener;
import java.awt.event.MouseWheelEvent;
import java.awt.event.MouseWheelListener;
+import java.util.ArrayList;
import java.util.List;
-import java.util.Vector;
import javax.swing.JOptionPane;
import javax.swing.JPanel;
+import javax.swing.SwingUtilities;
import javax.swing.ToolTipManager;
/**
void insertNucAtCursor(boolean group, String nuc)
{
+ // TODO not called - delete?
groupEditing = group;
startseq = seqCanvas.cursorY;
lastres = seqCanvas.cursorX;
{
lastMousePress = evt.getPoint();
- if (javax.swing.SwingUtilities.isMiddleMouseButton(evt))
+ if (SwingUtilities.isMiddleMouseButton(evt))
{
mouseWheelPressed = true;
return;
{
for (int j = 0; j < startres - lastres; j++)
{
- if (!jalview.util.Comparison.isGap(groupSeqs[g]
- .getCharAt(fixedRight - j)))
+ if (!Comparison.isGap(groupSeqs[g].getCharAt(fixedRight - j)))
{
blank = false;
break;
continue;
}
- if (!jalview.util.Comparison.isGap(groupSeqs[g].getCharAt(j)))
+ if (!Comparison.isGap(groupSeqs[g].getCharAt(j)))
{
// Not a gap, block edit not valid
endEditing();
for (blankColumn = fixedColumn; blankColumn > j; blankColumn--)
{
- if (jalview.util.Comparison.isGap(seq[s].getCharAt(blankColumn)))
+ if (Comparison.isGap(seq[s].getCharAt(blankColumn)))
{
// Theres a space, so break and insert the gap
break;
}
- if (javax.swing.SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
List<SequenceFeature> allFeatures = ap.getFeatureRenderer()
.findFeaturesAtRes(sequence.getDatasetSequence(),
sequence.findPosition(res));
- Vector links = new Vector();
+ List<String> links = new ArrayList<String>();
for (SequenceFeature sf : allFeatures)
{
if (sf.links != null)
{
- for (int j = 0; j < sf.links.size(); j++)
+ for (String link : sf.links)
{
- links.addElement(sf.links.elementAt(j));
+ links.add(link);
}
}
}
- jalview.gui.PopupMenu pop = new jalview.gui.PopupMenu(ap, null, links);
+ PopupMenu pop = new PopupMenu(ap, null, links);
pop.show(this, evt.getX(), evt.getY());
return;
}
{
if (av.getAlignment() == null)
{
- jalview.bin.Cache.log.warn("alignviewport av SeqSetId="
+ Cache.log.warn("alignviewport av SeqSetId="
+ av.getSequenceSetId() + " ViewId=" + av.getViewId()
+ " 's alignment is NULL! returning immediately.");
return;
ColumnSelection cs = MappingUtils.mapColumnSelection(colsel, sourceAv,
av);
av.setColumnSelection(cs);
- av.isColSelChanged(true);
PaintRefresher.Refresh(this, av.getSequenceSetId());
package jalview.gui;
import jalview.api.FeatureSettingsModelI;
+import jalview.bin.Cache;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
+import jalview.fts.service.pdb.PDBFTSPanel;
+import jalview.fts.service.uniprot.UniprotFTSPanel;
+import jalview.io.gff.SequenceOntologyI;
import jalview.util.DBRefUtils;
import jalview.util.MessageManager;
import jalview.ws.dbsources.das.api.DasSourceRegistryI;
int debounceTrap = 0;
+ public JTextArea getTextArea()
+ {
+ return textArea;
+ }
+
/**
* Blocking method that initialises and returns the shared instance of the
* SequenceFetcher client
}
}
if (sfetch == null
- || dasRegistry != jalview.bin.Cache.getDasSourceRegistry()
- || lastDasSourceRegistry != (jalview.bin.Cache
- .getDasSourceRegistry().getDasRegistryURL() + jalview.bin.Cache
+ || dasRegistry != Cache.getDasSourceRegistry()
+ || lastDasSourceRegistry != (Cache.getDasSourceRegistry()
+ .getDasRegistryURL() + Cache
.getDasSourceRegistry().getLocalSourceString())
.hashCode())
{
.getString("status.init_sequence_database_fetchers"),
Thread.currentThread().hashCode());
}
- dasRegistry = jalview.bin.Cache.getDasSourceRegistry();
+ dasRegistry = Cache.getDasSourceRegistry();
dasRegistry.refreshSources();
jalview.ws.SequenceFetcher sf = new jalview.ws.SequenceFetcher();
{
debounceTrap++;
String currentSelection = database.getSelectedItem();
- if (!currentSelection.equalsIgnoreCase("pdb"))
- {
- otherSourceAction();
- }
+
if (currentSelection.equalsIgnoreCase("pdb")
&& (database.action == KeyEvent.VK_ENTER || ((debounceTrap % 2) == 0)))
{
pdbSourceAction();
}
+ else if (currentSelection.equalsIgnoreCase("uniprot")
+ && (database.action == KeyEvent.VK_ENTER || ((debounceTrap % 2) == 0)))
+ {
+ uniprotSourceAction();
+ }
+ else
+ {
+ otherSourceAction();
+ }
database.action = -1;
}
});
this.add(jPanel2, java.awt.BorderLayout.NORTH);
jScrollPane1.getViewport().add(textArea);
+ /*
+ * open the database tree
+ */
+ database.waitForInput();
}
private void pdbSourceAction()
{
databaseButt.setText(database.getSelectedItem());
- new PDBSearchPanel(this);
+ new PDBFTSPanel(this);
frame.dispose();
}
+ private void uniprotSourceAction()
+ {
+ databaseButt.setText(database.getSelectedItem());
+ new UniprotFTSPanel(this);
+ frame.dispose();
+ }
private void otherSourceAction()
{
try
// TODO: Refactor to GUI independent code and write tests.
// indicate if successive sources should be merged into one alignment.
boolean addToLast = false;
- ArrayList<String> aresultq = new ArrayList<String>(), presultTitle = new ArrayList<String>();
- ArrayList<AlignmentI> presult = new ArrayList<AlignmentI>(), aresult = new ArrayList<AlignmentI>();
+ List<String> aresultq = new ArrayList<String>();
+ List<String> presultTitle = new ArrayList<String>();
+ List<AlignmentI> presult = new ArrayList<AlignmentI>();
+ List<AlignmentI> aresult = new ArrayList<AlignmentI>();
Iterator<DbSourceProxy> proxies = database.getSelectedSources()
.iterator();
String[] qries;
- List<String> nextfetch = Arrays.asList(qries = textArea.getText()
+ List<String> nextFetch = Arrays.asList(qries = textArea.getText()
.split(";"));
Iterator<String> en = Arrays.asList(new String[0]).iterator();
int nqueries = qries.length;
FeatureSettingsModelI preferredFeatureColours = null;
- while (proxies.hasNext() && (en.hasNext() || nextfetch.size() > 0))
+ while (proxies.hasNext() && (en.hasNext() || nextFetch.size() > 0))
{
- if (!en.hasNext() && nextfetch.size() > 0)
+ if (!en.hasNext() && nextFetch.size() > 0)
{
- en = nextfetch.iterator();
- nqueries = nextfetch.size();
+ en = nextFetch.iterator();
+ nqueries = nextFetch.size();
// save the remaining queries in the original array
- qries = nextfetch.toArray(new String[nqueries]);
- nextfetch = new ArrayList<String>();
+ qries = nextFetch.toArray(new String[nqueries]);
+ nextFetch = new ArrayList<String>();
}
DbSourceProxy proxy = proxies.next();
- boolean isAliSource = false;
try
{
// update status
Integer.valueOf(nqueries).toString(),
proxy.getDbName() }), Thread.currentThread()
.hashCode());
- isAliSource = proxy.isAlignmentSource();
- if (proxy.getAccessionSeparator() == null)
+ if (proxy.getMaximumQueryCount() == 1)
{
+ /*
+ * proxy only handles one accession id at a time
+ */
while (en.hasNext())
{
- String item = en.next();
- try
+ String acc = en.next();
+ if (!fetchSingleAccession(proxy, acc, aresultq, aresult))
{
- if (aresult != null)
- {
- try
- {
- // give the server a chance to breathe
- Thread.sleep(5);
- } catch (Exception e)
- {
- //
- }
-
- }
-
- AlignmentI indres = null;
- try
- {
- indres = proxy.getSequenceRecords(item);
- } catch (OutOfMemoryError oome)
- {
- new OOMWarning("fetching " + item + " from "
- + proxy.getDbName(), oome, this);
- }
- if (indres != null)
- {
- aresultq.add(item);
- aresult.add(indres);
- }
- else
- {
- nextfetch.add(item);
- }
- } catch (Exception e)
- {
- jalview.bin.Cache.log.info("Error retrieving " + item
- + " from " + proxy.getDbName(), e);
- nextfetch.add(item);
+ nextFetch.add(acc);
}
}
}
else
{
- StringBuffer multiacc = new StringBuffer();
- ArrayList<String> tosend = new ArrayList<String>();
- while (en.hasNext())
- {
- String nel = en.next();
- tosend.add(nel);
- multiacc.append(nel);
- if (en.hasNext())
- {
- multiacc.append(proxy.getAccessionSeparator());
- }
- }
- try
- {
- AlignmentI rslt;
- SequenceI[] rs;
- List<String> nores = new ArrayList<String>();
- rslt = proxy.getSequenceRecords(multiacc.toString());
- if (rslt == null || rslt.getHeight() == 0)
- {
- // no results - pass on all queries to next source
- nextfetch.addAll(tosend);
- }
- else
- {
- aresultq.add(multiacc.toString());
- aresult.add(rslt);
-
- rs = rslt.getSequencesArray();
- // search for each query in the dbrefs associated with each
- // sequence
- // returned.
- // ones we do not find will be used to query next source (if any)
- for (String q : tosend)
- {
- DBRefEntry dbr = new DBRefEntry(), found[] = null;
- dbr.setSource(proxy.getDbSource());
- dbr.setVersion(null);
- String accId = proxy.getAccessionIdFromQuery(q);
- dbr.setAccessionId(accId);
- boolean rfound = false;
- for (int r = 0; r < rs.length; r++)
- {
- if (rs[r] != null)
- {
- found = DBRefUtils.searchRefs(rs[r].getDBRefs(), accId);
- if (found != null && found.length > 0)
- {
- rfound = true;
- rs[r] = null;
- }
- }
- }
- if (!rfound)
- {
- nextfetch.add(q);
- }
- }
- }
- } catch (OutOfMemoryError oome)
- {
- new OOMWarning("fetching " + multiacc + " from "
- + database.getSelectedItem(), oome, this);
- }
+ /*
+ * proxy can fetch multiple accessions at one time
+ */
+ fetchMultipleAccessions(proxy, en, aresultq, aresult, nextFetch);
}
-
} catch (Exception e)
{
showErrorMessage("Error retrieving " + textArea.getText()
e.printStackTrace();
} catch (OutOfMemoryError e)
{
- // resets dialog box - so we don't use OOMwarning here.
showErrorMessage("Out of Memory when retrieving "
+ textArea.getText()
+ " from "
+ " from " + database.getSelectedItem());
e.printStackTrace();
}
+
// Stack results ready for opening in alignment windows
if (aresult != null && aresult.size() > 0)
{
}
AlignmentI ar = null;
- if (isAliSource)
+ if (proxy.isAlignmentSource())
{
addToLast = false;
// new window for each result
{
ar.append(aresult.remove(0));
}
- ;
}
addToLast = true;
presult.add(ar);
}
// only remove visual delay after we finished parsing.
guiWindow.setProgressBar(null, Thread.currentThread().hashCode());
- if (nextfetch.size() > 0)
+ if (nextFetch.size() > 0)
{
StringBuffer sb = new StringBuffer();
sb.append("Didn't retrieve the following "
- + (nextfetch.size() == 1 ? "query" : nextfetch.size()
+ + (nextFetch.size() == 1 ? "query" : nextFetch.size()
+ " queries") + ": \n");
int l = sb.length(), lr = 0;
- for (String s : nextfetch)
+ for (String s : nextFetch)
{
if (l != sb.length())
{
}
/**
+ * Tries to fetch one or more accession ids from the database proxy
+ *
+ * @param proxy
+ * @param accessions
+ * the queries to fetch
+ * @param aresultq
+ * a successful queries list to add to
+ * @param aresult
+ * a list of retrieved alignments to add to
+ * @param nextFetch
+ * failed queries are added to this list
+ * @throws Exception
+ */
+ void fetchMultipleAccessions(DbSourceProxy proxy,
+ Iterator<String> accessions, List<String> aresultq,
+ List<AlignmentI> aresult, List<String> nextFetch)
+ throws Exception
+ {
+ StringBuilder multiacc = new StringBuilder();
+ List<String> tosend = new ArrayList<String>();
+ while (accessions.hasNext())
+ {
+ String nel = accessions.next();
+ tosend.add(nel);
+ multiacc.append(nel);
+ if (accessions.hasNext())
+ {
+ multiacc.append(proxy.getAccessionSeparator());
+ }
+ }
+
+ try
+ {
+ String query = multiacc.toString();
+ AlignmentI rslt = proxy.getSequenceRecords(query);
+ if (rslt == null || rslt.getHeight() == 0)
+ {
+ // no results - pass on all queries to next source
+ nextFetch.addAll(tosend);
+ }
+ else
+ {
+ aresultq.add(query);
+ aresult.add(rslt);
+ if (tosend.size() > 1)
+ {
+ checkResultForQueries(rslt, tosend, nextFetch, proxy);
+ }
+ }
+ } catch (OutOfMemoryError oome)
+ {
+ new OOMWarning("fetching " + multiacc + " from "
+ + database.getSelectedItem(), oome, this);
+ }
+ }
+
+ /**
+ * Query for a single accession id via the database proxy
+ *
+ * @param proxy
+ * @param accession
+ * @param aresultq
+ * a list of successful queries to add to
+ * @param aresult
+ * a list of retrieved alignments to add to
+ * @return true if the fetch was successful, else false
+ */
+ boolean fetchSingleAccession(DbSourceProxy proxy, String accession,
+ List<String> aresultq, List<AlignmentI> aresult)
+ {
+ boolean success = false;
+ try
+ {
+ if (aresult != null)
+ {
+ try
+ {
+ // give the server a chance to breathe
+ Thread.sleep(5);
+ } catch (Exception e)
+ {
+ //
+ }
+ }
+
+ AlignmentI indres = null;
+ try
+ {
+ indres = proxy.getSequenceRecords(accession);
+ } catch (OutOfMemoryError oome)
+ {
+ new OOMWarning("fetching " + accession + " from "
+ + proxy.getDbName(), oome, this);
+ }
+ if (indres != null)
+ {
+ aresultq.add(accession);
+ aresult.add(indres);
+ success = true;
+ }
+ } catch (Exception e)
+ {
+ Cache.log.info(
+ "Error retrieving " + accession
+ + " from " + proxy.getDbName(), e);
+ } finally
+ {
+ return success;
+ }
+ }
+
+ /**
+ * Checks which of the queries were successfully retrieved by searching the
+ * DBRefs of the retrieved sequences for a match. Any not found are added to
+ * the 'nextFetch' list.
+ *
+ * @param rslt
+ * @param queries
+ * @param nextFetch
+ * @param proxy
+ */
+ void checkResultForQueries(AlignmentI rslt, List<String> queries,
+ List<String> nextFetch, DbSourceProxy proxy)
+ {
+ SequenceI[] rs = rslt.getSequencesArray();
+
+ for (String q : queries)
+ {
+ DBRefEntry[] found = null;
+ DBRefEntry dbr = new DBRefEntry();
+ dbr.setSource(proxy.getDbSource());
+ dbr.setVersion(null);
+ String accId = proxy.getAccessionIdFromQuery(q);
+ dbr.setAccessionId(accId);
+ boolean rfound = false;
+ for (int r = 0; r < rs.length; r++)
+ {
+ if (rs[r] != null)
+ {
+ found = DBRefUtils.searchRefs(rs[r].getDBRefs(), accId);
+ if (found != null && found.length > 0)
+ {
+ rfound = true;
+ break;
+ }
+ }
+ }
+ if (!rfound)
+ {
+ nextFetch.add(q);
+ }
+ }
+ }
+
+ /**
*
* @return a standard title for any results retrieved using the currently
* selected source and settings
if (preferredFeatureColours != null)
{
- af.viewport.applyFeaturesStyle(preferredFeatureColours);
+ af.getViewport().applyFeaturesStyle(preferredFeatureColours);
}
+ if (Cache.getDefault("HIDE_INTRONS", true))
+ {
+ af.hideFeatureColumns(SequenceOntologyI.EXON, false);
+ }
+
Desktop.addInternalFrame(af, title, AlignFrame.DEFAULT_WIDTH,
AlignFrame.DEFAULT_HEIGHT);
try
{
- af.setMaximum(jalview.bin.Cache.getDefault("SHOW_FULLSCREEN",
+ af.setMaximum(Cache.getDefault("SHOW_FULLSCREEN",
false));
} catch (Exception ex)
{
import jalview.datamodel.DBRefSource;
import jalview.datamodel.PDBEntry;
import jalview.datamodel.SequenceI;
+import jalview.fts.api.FTSData;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSRestClientI;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
+import jalview.fts.service.pdb.PDBFTSRestClient;
import jalview.jbgui.GStructureChooser;
-import jalview.jbgui.PDBDocFieldPreferences;
import jalview.structure.StructureSelectionManager;
import jalview.util.MessageManager;
-import jalview.ws.dbsources.PDBRestClient;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
+import jalview.ws.DBRefFetcher;
import jalview.ws.sifts.SiftsSettings;
-import jalview.ws.uimodel.PDBRestRequest;
-import jalview.ws.uimodel.PDBRestResponse;
-import jalview.ws.uimodel.PDBRestResponse.PDBResponseSummary;
import java.awt.event.ItemEvent;
import java.util.ArrayList;
private IProgressIndicator progressIndicator;
- private Collection<PDBResponseSummary> discoveredStructuresSet;
+ private Collection<FTSData> discoveredStructuresSet;
- private PDBRestRequest lastPdbRequest;
+ private FTSRestRequest lastPdbRequest;
- private PDBRestClient pdbRestCleint;
+ private FTSRestClientI pdbRestCleint;
private String selectedPdbFileName;
public void fetchStructuresMetaData()
{
long startTime = System.currentTimeMillis();
- Collection<PDBDocField> wantedFields = PDBDocFieldPreferences
- .getStructureSummaryFields();
+ pdbRestCleint = PDBFTSRestClient.getInstance();
+ Collection<FTSDataColumnI> wantedFields = pdbRestCleint
+ .getAllDefaulDisplayedDataColumns();
- discoveredStructuresSet = new LinkedHashSet<PDBResponseSummary>();
+ discoveredStructuresSet = new LinkedHashSet<FTSData>();
HashSet<String> errors = new HashSet<String>();
for (SequenceI seq : selectedSequences)
{
- PDBRestRequest pdbRequest = new PDBRestRequest();
+ FTSRestRequest pdbRequest = new FTSRestRequest();
pdbRequest.setAllowEmptySeq(false);
pdbRequest.setResponseSize(500);
pdbRequest.setFieldToSearchBy("(");
pdbRequest.setWantedFields(wantedFields);
pdbRequest.setSearchTerm(buildQuery(seq) + ")");
pdbRequest.setAssociatedSequence(seq);
- pdbRestCleint = new PDBRestClient();
- PDBRestResponse resultList;
+ FTSRestResponse resultList;
try
{
resultList = pdbRestCleint.executeRequest(pdbRequest);
if (discoveredStructuresSet != null
&& !discoveredStructuresSet.isEmpty())
{
- tbl_summary.setModel(PDBRestResponse.getTableModel(lastPdbRequest,
+ tbl_summary.setModel(FTSRestResponse.getTableModel(lastPdbRequest,
discoveredStructuresSet));
structuresDiscovered = true;
noOfStructuresFound = discoveredStructuresSet.size();
{
if (isValidSeqName(entry.getId()))
{
- queryBuilder.append(PDBRestClient.PDBDocField.PDB_ID.getCode())
+ queryBuilder.append("pdb_id")
.append(":")
.append(entry.getId().toLowerCase())
.append(" OR ");
if (dbRef.getSource().equalsIgnoreCase(DBRefSource.UNIPROT))
{
queryBuilder
- .append(PDBRestClient.PDBDocField.UNIPROT_ACCESSION
- .getCode()).append(":")
+.append("uniprot_accession").append(":")
.append(getDBRefId(dbRef))
.append(" OR ");
queryBuilder
- .append(PDBRestClient.PDBDocField.UNIPROT_ID.getCode())
+.append("uniprot_id")
.append(":")
.append(getDBRefId(dbRef)).append(" OR ");
isUniProtRefsFound = true;
else if (dbRef.getSource().equalsIgnoreCase(DBRefSource.PDB))
{
- queryBuilder.append(PDBRestClient.PDBDocField.PDB_ID.getCode())
+ queryBuilder.append("pdb_id")
.append(":").append(getDBRefId(dbRef).toLowerCase())
.append(" OR ");
isPDBRefsFound = true;
public void run()
{
long startTime = System.currentTimeMillis();
+ pdbRestCleint = PDBFTSRestClient.getInstance();
lbl_loading.setVisible(true);
- Collection<PDBDocField> wantedFields = PDBDocFieldPreferences
- .getStructureSummaryFields();
- Collection<PDBResponseSummary> filteredResponse = new HashSet<PDBResponseSummary>();
+ Collection<FTSDataColumnI> wantedFields = pdbRestCleint
+ .getAllDefaulDisplayedDataColumns();
+ Collection<FTSData> filteredResponse = new HashSet<FTSData>();
HashSet<String> errors = new HashSet<String>();
for (SequenceI seq : selectedSequences)
{
- PDBRestRequest pdbRequest = new PDBRestRequest();
+ FTSRestRequest pdbRequest = new FTSRestRequest();
if (fieldToFilterBy.equalsIgnoreCase("uniprot_coverage"))
{
System.out.println(">>>>>> Filtering with uniprot coverate");
pdbRequest.setWantedFields(wantedFields);
pdbRequest.setAssociatedSequence(seq);
}
- pdbRestCleint = new PDBRestClient();
- PDBRestResponse resultList;
+ FTSRestResponse resultList;
try
{
resultList = pdbRestCleint.executeRequest(pdbRequest);
if (!filteredResponse.isEmpty())
{
final int filterResponseCount = filteredResponse.size();
- Collection<PDBResponseSummary> reorderedStructuresSet = new LinkedHashSet<PDBResponseSummary>();
+ Collection<FTSData> reorderedStructuresSet = new LinkedHashSet<FTSData>();
reorderedStructuresSet.addAll(filteredResponse);
reorderedStructuresSet.addAll(discoveredStructuresSet);
- tbl_summary.setModel(PDBRestResponse.getTableModel(
+ tbl_summary.setModel(FTSRestResponse.getTableModel(
lastPdbRequest, reorderedStructuresSet));
- PDBRestResponse.configureTableColumn(tbl_summary, wantedFields);
+ FTSRestResponse.configureTableColumn(tbl_summary, wantedFields);
tbl_summary.getColumn("Ref Sequence").setPreferredWidth(120);
tbl_summary.getColumn("Ref Sequence").setMinWidth(100);
tbl_summary.getColumn("Ref Sequence").setMaxWidth(200);
if (isStructuresDiscovered())
{
cmb_filterOption.addItem(new FilterOption("Best Quality",
- PDBDocField.OVERALL_QUALITY.getCode(), VIEWS_FILTER));
+ "overall_quality", VIEWS_FILTER));
cmb_filterOption.addItem(new FilterOption("Most UniProt Coverage",
- PDBDocField.UNIPROT_COVERAGE.getCode(), VIEWS_FILTER));
+ "uniprot_coverage", VIEWS_FILTER));
cmb_filterOption.addItem(new FilterOption("Best Resolution",
- PDBDocField.RESOLUTION.getCode(), VIEWS_FILTER));
+ "resolution", VIEWS_FILTER));
cmb_filterOption.addItem(new FilterOption("Most Protein Chain",
- PDBDocField.PROTEIN_CHAIN_COUNT.getCode(), VIEWS_FILTER));
+ "number_of_protein_chains", VIEWS_FILTER));
cmb_filterOption.addItem(new FilterOption("Most Bound Molecules",
- PDBDocField.BOUND_MOLECULE_COUNT.getCode(), VIEWS_FILTER));
+ "number_of_bound_molecules", VIEWS_FILTER));
cmb_filterOption.addItem(new FilterOption("Most Polymer Residues",
- PDBDocField.POLYMER_RESIDUE_COUNT.getCode(), VIEWS_FILTER));
+ "number_of_polymer_residues", VIEWS_FILTER));
}
cmb_filterOption.addItem(new FilterOption("Enter PDB Id", "-",
VIEWS_ENTER_ID));
String currentView = selectedFilterOpt.getView();
if (currentView == VIEWS_FILTER)
{
- int pdbIdColIndex = tbl_summary.getColumn(
- PDBRestClient.PDBDocField.PDB_ID.getName()).getModelIndex();
+ int pdbIdColIndex = tbl_summary.getColumn("PDB Id")
+ .getModelIndex();
int refSeqColIndex = tbl_summary.getColumn("Ref Sequence")
.getModelIndex();
int[] selectedRows = tbl_summary.getSelectedRows();
int[] selectedRows = tbl_local_pdb.getSelectedRows();
PDBEntry[] pdbEntriesToView = new PDBEntry[selectedRows.length];
int count = 0;
- int pdbIdColIndex = tbl_local_pdb.getColumn(
- PDBRestClient.PDBDocField.PDB_ID.getName()).getModelIndex();
+ int pdbIdColIndex = tbl_local_pdb.getColumn("PDB Id")
+ .getModelIndex();
int refSeqColIndex = tbl_local_pdb.getColumn("Ref Sequence")
.getModelIndex();
ArrayList<SequenceI> selectedSeqsToView = new ArrayList<SequenceI>();
if (pdbEntry == null)
{
pdbEntry = new PDBEntry();
+ if (pdbIdStr.split(":").length > 1)
+ {
+ pdbEntry.setChainCode(pdbIdStr.split(":")[1]);
+ }
pdbEntry.setId(pdbIdStr);
pdbEntry.setType(PDBEntry.Type.PDB);
selectedSequence.getDatasetSequence().addPDBId(pdbEntry);
{
ssm.setProgressBar(null);
ssm.setProgressBar("Fetching Database refs..");
- new jalview.ws.DBRefFetcher(sequences, null, null, null, false)
- .fetchDBRefs(true);
+ new DBRefFetcher(sequences).fetchDBRefs(true);
break;
}
}
}
- if (pdbEntriesToView.length > 1)
- {
- ArrayList<SequenceI[]> seqsMap = new ArrayList<SequenceI[]>();
- for (SequenceI seq : sequences)
- {
- seqsMap.add(new SequenceI[] { seq });
- }
- SequenceI[][] collatedSeqs = seqsMap.toArray(new SequenceI[0][0]);
+ if (pdbEntriesToView.length > 1)
+ {
+ ArrayList<SequenceI[]> seqsMap = new ArrayList<SequenceI[]>();
+ for (SequenceI seq : sequences)
+ {
+ seqsMap.add(new SequenceI[] { seq });
+ }
+ SequenceI[][] collatedSeqs = seqsMap.toArray(new SequenceI[0][0]);
ssm.setProgressBar(null);
ssm.setProgressBar("Fetching PDB Structures for selected entries..");
- sViewer.viewStructures(pdbEntriesToView, collatedSeqs, alignPanel);
- }
- else
- {
+ sViewer.viewStructures(pdbEntriesToView, collatedSeqs, alignPanel);
+ }
+ else
+ {
ssm.setProgressBar(null);
ssm.setProgressBar("Fetching PDB Structure for "
+ pdbEntriesToView[0].getId());
- sViewer.viewStructures(pdbEntriesToView[0], sequences, alignPanel);
- }
+ sViewer.viewStructures(pdbEntriesToView[0], sequences, alignPanel);
+ }
}
/**
this.structuresDiscovered = structuresDiscovered;
}
- public Collection<PDBResponseSummary> getDiscoveredStructuresSet()
+ public Collection<FTSData> getDiscoveredStructuresSet()
{
return discoveredStructuresSet;
}
isValidPBDEntry = false;
if (txt_search.getText().length() > 0)
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.PDB_ID);
- PDBRestRequest pdbRequest = new PDBRestRequest();
+ String searchTerm = txt_search.getText().toLowerCase();
+ searchTerm = searchTerm.split(":")[0];
+ System.out.println(">>>>> search term : " + searchTerm);
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ FTSRestRequest pdbRequest = new FTSRestRequest();
pdbRequest.setAllowEmptySeq(false);
pdbRequest.setResponseSize(1);
pdbRequest.setFieldToSearchBy("(pdb_id:");
pdbRequest.setWantedFields(wantedFields);
pdbRequest
- .setSearchTerm(txt_search.getText().toLowerCase() + ")");
+.setSearchTerm(searchTerm + ")");
pdbRequest.setAssociatedSequence(selectedSequence);
- pdbRestCleint = new PDBRestClient();
- PDBRestResponse resultList;
+ pdbRestCleint = PDBFTSRestClient.getInstance();
+ wantedFields.add(pdbRestCleint.getPrimaryKeyColumn());
+ FTSRestResponse resultList;
try
{
resultList = pdbRestCleint.executeRequest(pdbRequest);
import javax.swing.JColorChooser;
import javax.swing.JPanel;
import javax.swing.JScrollPane;
-import javax.swing.SwingUtilities;
import javax.swing.ToolTipManager;
/**
{
if (highlightNode != null)
{
- if (SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
Color col = JColorChooser.showDialog(this,
MessageManager.getString("label.select_subtree_colour"),
av.addPropertyChangeListener(new java.beans.PropertyChangeListener()
{
+ @Override
public void propertyChange(PropertyChangeEvent evt)
{
if (evt.getPropertyName().equals("alignment"))
}
+ @Override
public void viewMenu_menuSelected()
{
buildAssociatedViewMenu();
buttonGroup.add(item);
item.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent evt)
{
treeCanvas.applyToAllViews = false;
itemf.setSelected(treeCanvas.applyToAllViews);
itemf.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent evt)
{
treeCanvas.applyToAllViews = itemf.isSelected();
}
}
+ @Override
public void run()
{
* @param e
* DOCUMENT ME!
*/
+ @Override
public void textbox_actionPerformed(ActionEvent e)
{
CutAndPasteTransfer cap = new CutAndPasteTransfer();
* @param e
* DOCUMENT ME!
*/
+ @Override
public void saveAsNewick_actionPerformed(ActionEvent e)
{
JalviewFileChooser chooser = new JalviewFileChooser(
* @param e
* DOCUMENT ME!
*/
+ @Override
public void printMenu_actionPerformed(ActionEvent e)
{
// Putting in a thread avoids Swing painting problems
treeCanvas.startPrinting();
}
+ @Override
public void originalSeqData_actionPerformed(ActionEvent e)
{
if (!tree.hasOriginalSequenceData())
* @param e
* DOCUMENT ME!
*/
+ @Override
public void fitToWindow_actionPerformed(ActionEvent e)
{
treeCanvas.fitToWindow = fitToWindow.isSelected();
* @param e
* DOCUMENT ME!
*/
+ @Override
public void font_actionPerformed(ActionEvent e)
{
if (treeCanvas == null)
* @param e
* DOCUMENT ME!
*/
+ @Override
public void distanceMenu_actionPerformed(ActionEvent e)
{
treeCanvas.setShowDistances(distanceMenu.isSelected());
* @param e
* DOCUMENT ME!
*/
+ @Override
public void bootstrapMenu_actionPerformed(ActionEvent e)
{
treeCanvas.setShowBootstrap(bootstrapMenu.isSelected());
* @param e
* DOCUMENT ME!
*/
+ @Override
public void placeholdersMenu_actionPerformed(ActionEvent e)
{
treeCanvas.setMarkPlaceholders(placeholdersMenu.isSelected());
* @param e
* DOCUMENT ME!
*/
+ @Override
public void epsTree_actionPerformed(ActionEvent e)
{
boolean accurateText = true;
* @param e
* DOCUMENT ME!
*/
+ @Override
public void pngTree_actionPerformed(ActionEvent e)
{
int width = treeCanvas.getWidth();
tree.applyToNodes(new NodeTransformI()
{
+ @Override
public void transform(BinaryNode node)
{
if (node instanceof SequenceNode
}
else if (format.equals(IdentifyFile.FeaturesFile))
{
- alignFile = new FeaturesFile(inFile, type);
+ alignFile = new FeaturesFile(true, inFile, type);
}
return buildAlignmentFrom(alignFile);
} catch (Exception e)
features = sequences[i].getSequenceFeatures();
if (features != null)
{
- for (int j = 0; j < features.length; j++)
+ for (SequenceFeature sequenceFeature : features)
{
- isnonpos = features[j].begin == 0 && features[j].end == 0;
+ isnonpos = sequenceFeature.begin == 0 && sequenceFeature.end == 0;
if ((!nonpos && isnonpos)
|| (!isnonpos && visOnly && !visible
- .containsKey(features[j].type)))
+ .containsKey(sequenceFeature.type)))
{
// skip if feature is nonpos and we ignore them or if we only
// output visible and it isn't non-pos and it's not visible
}
if (group != null
- && (features[j].featureGroup == null || !features[j].featureGroup
+ && (sequenceFeature.featureGroup == null || !sequenceFeature.featureGroup
.equals(group)))
{
continue;
}
- if (group == null && features[j].featureGroup != null)
+ if (group == null && sequenceFeature.featureGroup != null)
{
continue;
}
// we have features to output
featuresGen = true;
- if (features[j].description == null
- || features[j].description.equals(""))
+ if (sequenceFeature.description == null
+ || sequenceFeature.description.equals(""))
{
- out.append(features[j].type).append(TAB);
+ out.append(sequenceFeature.type).append(TAB);
}
else
{
- if (features[j].links != null
- && features[j].getDescription().indexOf("<html>") == -1)
+ if (sequenceFeature.links != null
+ && sequenceFeature.getDescription().indexOf("<html>") == -1)
{
out.append("<html>");
}
- out.append(features[j].description + " ");
- if (features[j].links != null)
+ out.append(sequenceFeature.description);
+ if (sequenceFeature.links != null)
{
- for (int l = 0; l < features[j].links.size(); l++)
+ for (int l = 0; l < sequenceFeature.links.size(); l++)
{
- String label = features[j].links.elementAt(l).toString();
+ String label = sequenceFeature.links.elementAt(l);
String href = label.substring(label.indexOf("|") + 1);
label = label.substring(0, label.indexOf("|"));
- if (features[j].description.indexOf(href) == -1)
+ if (sequenceFeature.description.indexOf(href) == -1)
{
- out.append("<a href=\"" + href + "\">" + label + "</a>");
+ out.append(" <a href=\"" + href + "\">" + label
+ + "</a>");
}
}
- if (features[j].getDescription().indexOf("</html>") == -1)
+ if (sequenceFeature.getDescription().indexOf("</html>") == -1)
{
out.append("</html>");
}
}
out.append(sequences[i].getName());
out.append("\t-1\t");
- out.append(features[j].begin);
+ out.append(sequenceFeature.begin);
out.append(TAB);
- out.append(features[j].end);
+ out.append(sequenceFeature.end);
out.append(TAB);
- out.append(features[j].type);
- if (!Float.isNaN(features[j].score))
+ out.append(sequenceFeature.type);
+ if (!Float.isNaN(sequenceFeature.score))
{
out.append(TAB);
- out.append(features[j].score);
+ out.append(sequenceFeature.score);
}
out.append(newline);
}
boolean includeNonPositionalFeatures)
{
StringBuilder out = new StringBuilder(256);
- out.append(String.format("%s %d\n", GFF_VERSION, gffVersion));
+ int version = gffVersion == 0 ? 2 : gffVersion;
+ out.append(String.format("%s %d\n", GFF_VERSION, version));
String source;
boolean isnonpos;
for (SequenceI seq : sequences)
}
}
- if (renderStyle.equalsIgnoreCase("lineart"))
+ if (renderStyle.equalsIgnoreCase("Lineart"))
{
g1.setRenderingHint(SVGHints.KEY_DRAW_STRING_TYPE,
SVGHints.VALUE_DRAW_STRING_TYPE_VECTOR);
} catch (IOException ex)
{
}
- ;
if (dta != null && dta.indexOf("*") > -1)
{
starterm = true;
// read as a FASTA (probably)
break;
}
- if ((data.indexOf("<") > -1)) // possible Markup Language data i.e HTML,
+ int lessThan = data.indexOf("<");
+ if ((lessThan > -1)) // possible Markup Language data i.e HTML,
// RNAML, XML
{
- // FIXME this is nuts - it consumes the rest of the file if no match
- boolean identified = false;
- do
- {
- if (data.matches("<(?i)html(\"[^\"]*\"|'[^']*'|[^'\">])*>"))
- {
- reply = HtmlFile.FILE_DESC;
- identified = true;
- break;
- }
-
- if (data.matches("<(?i)rnaml (\"[^\"]*\"|'[^']*'|[^'\">])*>"))
- {
- reply = "RNAML";
- identified = true;
- break;
- }
- } while ((data = source.nextLine()) != null);
-
- if (identified)
+ String upper = data.toUpperCase();
+ if (upper.substring(lessThan).startsWith("<HTML"))
{
+ reply = HtmlFile.FILE_DESC;
break;
}
- if (data == null)
+ if (upper.substring(lessThan).startsWith("<RNAML"))
{
+ reply = "RNAML";
break;
}
}
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
+import jalview.io.gff.GffConstants;
+import jalview.util.DBRefUtils;
import jalview.util.UrlLink;
import java.util.ArrayList;
-import java.util.Hashtable;
import java.util.List;
+import java.util.Map;
/**
* generate HTML reports for a sequence
}
/**
- * appends the features at rpos to the given stringbuffer ready for display in
- * a tooltip
+ * Append text for the list of features to the tooltip
*
* @param tooltipText2
- * @param linkImageURL
* @param rpos
* @param features
- * TODO refactor to Jalview 'utilities' somehow.
+ * @param minmax
*/
public void appendFeatures(final StringBuffer tooltipText2, int rpos,
- List<SequenceFeature> features)
+ List<SequenceFeature> features, Map<String, float[][]> minmax)
{
- appendFeatures(tooltipText2, rpos, features, null);
+ if (features != null)
+ {
+ for (SequenceFeature feature : features)
+ {
+ appendFeature(tooltipText2, rpos, minmax, feature);
+ }
+ }
}
- public void appendFeatures(final StringBuffer tooltipText2, int rpos,
- List<SequenceFeature> features, Hashtable minmax)
+ /**
+ * Appends text for one sequence feature to the string buffer
+ *
+ * @param sb
+ * @param rpos
+ * @param minmax
+ * {{min, max}, {min, max}} positional and non-positional feature
+ * scores for this type
+ * @param feature
+ */
+ void appendFeature(final StringBuffer sb, int rpos,
+ Map<String, float[][]> minmax, SequenceFeature feature)
{
- String tmpString;
- if (features != null)
+ if ("disulfide bond".equals(feature.getType()))
{
- for (SequenceFeature feature : features)
+ if (feature.getBegin() == rpos || feature.getEnd() == rpos)
{
- if (feature.getType().equals("disulfide bond"))
+ if (sb.length() > 6)
{
- if (feature.getBegin() == rpos || feature.getEnd() == rpos)
- {
- if (tooltipText2.length() > 6)
- {
- tooltipText2.append("<br>");
- }
- tooltipText2.append("disulfide bond " + feature.getBegin()
- + ":" + feature.getEnd());
- }
+ sb.append("<br>");
}
- else
+ sb.append("disulfide bond ").append(feature.getBegin()).append(":")
+ .append(feature.getEnd());
+ }
+ }
+ else
+ {
+ if (sb.length() > 6)
+ {
+ sb.append("<br>");
+ }
+ // TODO: remove this hack to display link only features
+ boolean linkOnly = feature.getValue("linkonly") != null;
+ if (!linkOnly)
+ {
+ sb.append(feature.getType()).append(" ");
+ if (rpos != 0)
{
- if (tooltipText2.length() > 6)
+ // we are marking a positional feature
+ sb.append(feature.begin);
+ }
+ if (feature.begin != feature.end)
+ {
+ sb.append(" " + feature.end);
+ }
+
+ if (feature.getDescription() != null
+ && !feature.description.equals(feature.getType()))
+ {
+ String tmpString = feature.getDescription();
+ String tmp2up = tmpString.toUpperCase();
+ final int startTag = tmp2up.indexOf("<HTML>");
+ if (startTag > -1)
{
- tooltipText2.append("<br>");
+ tmpString = tmpString.substring(startTag + 6);
+ tmp2up = tmp2up.substring(startTag + 6);
}
- // TODO: remove this hack to display link only features
- boolean linkOnly = feature.getValue("linkonly") != null;
- if (!linkOnly)
+ // TODO strips off </body> but not <body> - is that intended?
+ int endTag = tmp2up.indexOf("</BODY>");
+ if (endTag > -1)
{
- tooltipText2.append(feature.getType() + " ");
- if (rpos != 0)
- {
- // we are marking a positional feature
- tooltipText2.append(feature.begin);
- }
- if (feature.begin != feature.end)
- {
- tooltipText2.append(" " + feature.end);
- }
-
- if (feature.getDescription() != null
- && !feature.description.equals(feature.getType()))
- {
- tmpString = feature.getDescription();
- String tmp2up = tmpString.toUpperCase();
- int startTag = tmp2up.indexOf("<HTML>");
- if (startTag > -1)
- {
- tmpString = tmpString.substring(startTag + 6);
- tmp2up = tmp2up.substring(startTag + 6);
- }
- int endTag = tmp2up.indexOf("</BODY>");
- if (endTag > -1)
- {
- tmpString = tmpString.substring(0, endTag);
- tmp2up = tmp2up.substring(0, endTag);
- }
- endTag = tmp2up.indexOf("</HTML>");
- if (endTag > -1)
- {
- tmpString = tmpString.substring(0, endTag);
- }
-
- if (startTag > -1)
- {
- tooltipText2.append("; " + tmpString);
- }
- else
- {
- if (tmpString.indexOf("<") > -1
- || tmpString.indexOf(">") > -1)
- {
- // The description does not specify html is to
- // be used, so we must remove < > symbols
- tmpString = tmpString.replaceAll("<", "<");
- tmpString = tmpString.replaceAll(">", ">");
-
- tooltipText2.append("; ");
- tooltipText2.append(tmpString);
+ tmpString = tmpString.substring(0, endTag);
+ tmp2up = tmp2up.substring(0, endTag);
+ }
+ endTag = tmp2up.indexOf("</HTML>");
+ if (endTag > -1)
+ {
+ tmpString = tmpString.substring(0, endTag);
+ }
- }
- else
- {
- tooltipText2.append("; " + tmpString);
- }
- }
- }
- // check score should be shown
- if (!Float.isNaN(feature.getScore()))
+ if (startTag > -1)
+ {
+ sb.append("; ").append(tmpString);
+ }
+ else
+ {
+ if (tmpString.indexOf("<") > -1
+ || tmpString.indexOf(">") > -1)
{
- float[][] rng = (minmax == null) ? null : ((float[][]) minmax
- .get(feature.getType()));
- if (rng != null && rng[0] != null && rng[0][0] != rng[0][1])
- {
- tooltipText2.append(" Score=" + feature.getScore());
- }
+ // The description does not specify html is to
+ // be used, so we must remove < > symbols
+ tmpString = tmpString.replaceAll("<", "<");
+ tmpString = tmpString.replaceAll(">", ">");
+ sb.append("; ").append(tmpString);
}
- if (feature.getValue("status") != null)
+ else
{
- String status = feature.getValue("status").toString();
- if (status.length() > 0)
- {
- tooltipText2.append("; (" + feature.getValue("status")
- + ")");
- }
+ sb.append("; ").append(tmpString);
}
}
}
- if (feature.links != null)
+
+ /*
+ * score should be shown if there is one, and min != max
+ * for this feature type (e.g. not all 0)
+ */
+ if (!Float.isNaN(feature.getScore()))
{
- if (linkImageURL != null)
+ float[][] rng = (minmax == null) ? null : minmax.get(feature
+ .getType());
+ if (rng != null && rng[0] != null && rng[0][0] != rng[0][1])
{
- tooltipText2.append(" <img src=\"" + linkImageURL + "\">");
+ sb.append(" Score=").append(
+ String.valueOf(feature.getScore()));
}
- else
+ }
+ String status = (String) feature.getValue("status");
+ if (status != null && status.length() > 0)
+ {
+ sb.append("; (").append(status).append(")");
+ }
+ String clinSig = (String) feature
+ .getValue(GffConstants.CLINICAL_SIGNIFICANCE);
+ if (clinSig != null)
+ {
+ sb.append("; ").append(clinSig);
+ }
+ }
+ }
+ appendLinks(sb, feature);
+ }
+
+ /**
+ * Format and appends any hyperlinks for the sequence feature to the string
+ * buffer
+ *
+ * @param sb
+ * @param feature
+ */
+ void appendLinks(final StringBuffer sb, SequenceFeature feature)
+ {
+ if (feature.links != null)
+ {
+ if (linkImageURL != null)
+ {
+ sb.append(" <img src=\"" + linkImageURL + "\">");
+ }
+ else
+ {
+ for (String urlstring : feature.links)
+ {
+ try
{
- for (String urlstring : feature.links)
+ for (String[] urllink : createLinksFrom(null, urlstring))
{
- try
- {
- for (String[] urllink : createLinksFrom(null, urlstring))
- {
- tooltipText2.append("<br/> <a href=\""
- + urllink[3]
- + "\" target=\""
- + urllink[0]
- + "\">"
- + (urllink[0].toLowerCase().equals(
- urllink[1].toLowerCase()) ? urllink[0]
- : (urllink[0] + ":" + urllink[1]))
- + "</a></br>");
- }
- } catch (Exception x)
- {
- System.err.println("problem when creating links from "
- + urlstring);
- x.printStackTrace();
- }
+ sb.append("<br/> <a href=\""
+ + urllink[3]
+ + "\" target=\""
+ + urllink[0]
+ + "\">"
+ + (urllink[0].toLowerCase().equals(
+ urllink[1].toLowerCase()) ? urllink[0]
+ : (urllink[0] + ":" + urllink[1]))
+ + "</a></br>");
}
+ } catch (Exception x)
+ {
+ System.err.println("problem when creating links from "
+ + urlstring);
+ x.printStackTrace();
}
-
}
}
+
}
}
* @return String[][] { String[] { link target, link label, dynamic component
* inserted (if any), url }}
*/
- public String[][] createLinksFrom(SequenceI seq, String link)
+ String[][] createLinksFrom(SequenceI seq, String link)
{
- ArrayList<String[]> urlSets = new ArrayList<String[]>();
- ArrayList<String> uniques = new ArrayList<String>();
+ List<String[]> urlSets = new ArrayList<String[]>();
+ List<String> uniques = new ArrayList<String>();
UrlLink urlLink = new UrlLink(link);
if (!urlLink.isValid())
{
System.err.println(urlLink.getInvalidMessage());
return null;
}
- final String target = urlLink.getTarget(); // link.substring(0,
- // link.indexOf("|"));
- final String label = urlLink.getLabel();
if (seq != null && urlLink.isDynamic())
{
-
- // collect matching db-refs
- DBRefEntry[] dbr = jalview.util.DBRefUtils.selectRefs(seq.getDBRefs(),
- new String[] { target });
- // collect id string too
- String id = seq.getName();
- String descr = seq.getDescription();
- if (descr != null && descr.length() < 1)
+ urlSets.addAll(createDynamicLinks(seq, urlLink, uniques));
+ }
+ else
+ {
+ String target = urlLink.getTarget();
+ String label = urlLink.getLabel();
+ String unq = label + "|" + urlLink.getUrl_prefix();
+ if (!uniques.contains(unq))
{
- descr = null;
+ uniques.add(unq);
+ urlSets.add(new String[] { target, label, null,
+ urlLink.getUrl_prefix() });
}
- if (dbr != null)
+ }
+
+ return urlSets.toArray(new String[][] {});
+ }
+
+ /**
+ * Formats and returns a list of dynamic href links
+ *
+ * @param seq
+ * @param urlLink
+ * @param uniques
+ */
+ List<String[]> createDynamicLinks(SequenceI seq, UrlLink urlLink,
+ List<String> uniques)
+ {
+ List<String[]> result = new ArrayList<String[]>();
+ final String target = urlLink.getTarget();
+ final String label = urlLink.getLabel();
+
+ // collect matching db-refs
+ DBRefEntry[] dbr = DBRefUtils.selectRefs(seq.getDBRefs(),
+ new String[] { target });
+ // collect id string too
+ String id = seq.getName();
+ String descr = seq.getDescription();
+ if (descr != null && descr.length() < 1)
+ {
+ descr = null;
+ }
+ if (dbr != null)
+ {
+ for (int r = 0; r < dbr.length; r++)
{
- for (int r = 0; r < dbr.length; r++)
+ if (id != null && dbr[r].getAccessionId().equals(id))
{
- if (id != null && dbr[r].getAccessionId().equals(id))
- {
- // suppress duplicate link creation for the bare sequence ID
- // string with this link
- id = null;
- }
- // create Bare ID link for this RUL
- String[] urls = urlLink.makeUrls(dbr[r].getAccessionId(), true);
- if (urls != null)
- {
- for (int u = 0; u < urls.length; u += 2)
- {
- String unq = urls[u] + "|" + urls[u + 1];
- if (!uniques.contains(unq))
- {
- urlSets.add(new String[] { target, label, urls[u],
- urls[u + 1] });
- uniques.add(unq);
- }
- }
- }
+ // suppress duplicate link creation for the bare sequence ID
+ // string with this link
+ id = null;
}
- }
- if (id != null)
- {
- // create Bare ID link for this RUL
- String[] urls = urlLink.makeUrls(id, true);
+ // create Bare ID link for this URL
+ String[] urls = urlLink.makeUrls(dbr[r].getAccessionId(), true);
if (urls != null)
{
for (int u = 0; u < urls.length; u += 2)
String unq = urls[u] + "|" + urls[u + 1];
if (!uniques.contains(unq))
{
- urlSets.add(new String[] { target, label, urls[u],
+ result.add(new String[] { target, label, urls[u],
urls[u + 1] });
uniques.add(unq);
}
}
}
}
- if (descr != null && urlLink.getRegexReplace() != null)
+ }
+ if (id != null)
+ {
+ // create Bare ID link for this URL
+ String[] urls = urlLink.makeUrls(id, true);
+ if (urls != null)
{
- // create link for this URL from description only if regex matches
- String[] urls = urlLink.makeUrls(descr, true);
- if (urls != null)
+ for (int u = 0; u < urls.length; u += 2)
{
- for (int u = 0; u < urls.length; u += 2)
+ String unq = urls[u] + "|" + urls[u + 1];
+ if (!uniques.contains(unq))
{
- String unq = urls[u] + "|" + urls[u + 1];
- if (!uniques.contains(unq))
- {
- urlSets.add(new String[] { target, label, urls[u],
- urls[u + 1] });
- uniques.add(unq);
- }
+ result.add(new String[] { target, label, urls[u],
+ urls[u + 1] });
+ uniques.add(unq);
}
}
}
-
}
- else
+ if (descr != null && urlLink.getRegexReplace() != null)
{
- String unq = label + "|" + urlLink.getUrl_prefix();
- if (!uniques.contains(unq))
+ // create link for this URL from description only if regex matches
+ String[] urls = urlLink.makeUrls(descr, true);
+ if (urls != null)
{
- uniques.add(unq);
- // Add a non-dynamic link
- urlSets.add(new String[] { target, label, null,
- urlLink.getUrl_prefix() });
+ for (int u = 0; u < urls.length; u += 2)
+ {
+ String unq = urls[u] + "|" + urls[u + 1];
+ if (!uniques.contains(unq))
+ {
+ result.add(new String[] { target, label, urls[u],
+ urls[u + 1] });
+ uniques.add(unq);
+ }
+ }
}
}
-
- return urlSets.toArray(new String[][] {});
+ return result;
}
public void createSequenceAnnotationReport(final StringBuffer tip,
SequenceI sequence, boolean showDbRefs, boolean showNpFeats,
- Hashtable minmax)
+ Map<String, float[][]> minmax)
{
createSequenceAnnotationReport(tip, sequence, showDbRefs, showNpFeats,
true, minmax);
public void createSequenceAnnotationReport(final StringBuffer tip,
SequenceI sequence, boolean showDbRefs, boolean showNpFeats,
- boolean tableWrap, Hashtable minmax)
+ boolean tableWrap, Map<String, float[][]> minmax)
{
String tmp;
tip.append("<i>");
private String id;
private String dbRefType;
+
/**
* set to true to add derived sequence annotations (temp factor read from
* file, or computed secondary structure) to the alignment
sourceDBRef.setSource(DBRefSource.PDB);
sourceDBRef.setStartRes(pdbSequence.getStart());
sourceDBRef.setEndRes(pdbSequence.getEnd());
-
- SequenceI chainseq = pdbSequence.deriveSequence();
- chainseq.setSourceDBRef(sourceDBRef);
- chainseq.addPDBId(entry);
- chainseq.addDBRef(sourceDBRef);
-
+ pdbSequence.setSourceDBRef(sourceDBRef);
+ pdbSequence.addPDBId(entry);
+ pdbSequence.addDBRef(sourceDBRef);
+ SequenceI chainseq = pdbSequence;
seqs.addElement(chainseq);
-
AlignmentAnnotation[] chainannot = chainseq.getAnnotation();
if (chainannot != null && visibleChainAnnotation)
@SuppressWarnings("unchecked")
protected void replaceAndUpdateChains(List<SequenceI> prot,
- AlignmentI al,
- String pep, boolean b)
+ AlignmentI al, String pep, boolean b)
{
List<List<? extends Object>> replaced = AlignSeq
.replaceMatchingSeqsWith(seqs, annotations, prot, al, pep,
}
@SuppressWarnings({ "unchecked", "rawtypes" })
- private void processWithJmolParser(List<SequenceI> prot)
- throws Exception
+ private void processWithJmolParser(List<SequenceI> prot) throws Exception
{
try
{
Class cl = Class.forName("jalview.ext.jmol.JmolParser");
if (cl != null)
{
- final Constructor constructor = cl
-.getConstructor(new Class[] {
+ final Constructor constructor = cl.getConstructor(new Class[] {
boolean.class, boolean.class, boolean.class, FileParse.class });
final Object[] args = new Object[] { visibleChainAnnotation,
predictSecondaryStructure, externalSecondaryStructure,
- new FileParse(getDataName(),
- type) };
+ new FileParse(getDataName(), type) };
StructureViewSettings.setShowSeqFeatures(false);
StructureViewSettings.setVisibleChainAnnotation(false);
--- /dev/null
+package jalview.io.gff;
+
+/**
+ * A class to hold constants shared by creators and consumers of GFF or feature
+ * data
+ */
+public class GffConstants
+{
+ // SequenceOntology terms are to be found in SequenceOntologyI
+
+ /*
+ * clinical_significance may be an attribute of
+ * sequence_variant data from Ensembl
+ */
+ public static final String CLINICAL_SIGNIFICANCE = "clinical_significance";
+
+ /*
+ * not instantiable
+ */
+ private GffConstants()
+ {
+ }
+}
import javax.swing.JRadioButtonMenuItem;
import javax.swing.JTabbedPane;
import javax.swing.KeyStroke;
-import javax.swing.SwingUtilities;
import javax.swing.event.ChangeEvent;
import javax.swing.event.MenuEvent;
import javax.swing.event.MenuListener;
protected JMenu showProducts = new JMenu();
+ protected JMenuItem runGroovy = new JMenuItem();
+
protected JMenuItem rnahelicesColour = new JMenuItem();
protected JCheckBoxMenuItem autoCalculate = new JCheckBoxMenuItem();
@Override
public void mousePressed(MouseEvent evt)
{
- if (evt.isControlDown()
- || SwingUtilities.isRightMouseButton(evt))
+ if (evt.isPopupTrigger())
{
radioItem.removeActionListener(radioItem.getActionListeners()[0]);
// for show products actions see AlignFrame.canShowProducts
showProducts.setText(MessageManager.getString("label.get_cross_refs"));
+ runGroovy.setText(MessageManager.getString("label.run_groovy"));
+ runGroovy.setToolTipText(MessageManager.getString("label.run_groovy_tip"));
+ runGroovy.addActionListener(new ActionListener()
+ {
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ runGroovy_actionPerformed();
+ }
+ });
+
JMenuItem openFeatureSettings = new JMenuItem(
MessageManager.getString("action.feature_settings"));
openFeatureSettings.addActionListener(new ActionListener()
alignFrameMenuBar.add(colourMenu);
alignFrameMenuBar.add(calculateMenu);
alignFrameMenuBar.add(webService);
+
fileMenu.add(fetchSequence);
fileMenu.add(addSequenceMenu);
fileMenu.add(reload);
fileMenu.add(associatedData);
fileMenu.addSeparator();
fileMenu.add(closeMenuItem);
+
+ pasteMenu.add(pasteNew);
+ pasteMenu.add(pasteThis);
editMenu.add(undoMenuItem);
editMenu.add(redoMenuItem);
editMenu.add(cut);
// editMenu.addSeparator();
editMenu.add(padGapsMenuitem);
+ showMenu.add(showAllColumns);
+ showMenu.add(showAllSeqs);
+ showMenu.add(showAllhidden);
+ hideMenu.add(hideSelColumns);
+ hideMenu.add(hideSelSequences);
+ hideMenu.add(hideAllSelection);
+ hideMenu.add(hideAllButSelection);
viewMenu.add(newView);
viewMenu.add(expandViews);
viewMenu.add(gatherViews);
colourMenu.add(modifyPID);
colourMenu.add(annotationColour);
colourMenu.add(rnahelicesColour);
+
+ sort.add(sortIDMenuItem);
+ sort.add(sortLengthMenuItem);
+ sort.add(sortGroupMenuItem);
+ sort.add(sortPairwiseMenuItem);
+ sort.add(sortByTreeMenu);
calculateMenu.add(sort);
calculateMenu.add(calculateTree);
calculateMenu.addSeparator();
calculateMenu.add(autoCalculate);
calculateMenu.add(sortByTree);
calculateMenu.addSeparator();
+ calculateMenu.add(expandAlignment);
calculateMenu.add(extractScores);
+ calculateMenu.addSeparator();
+ calculateMenu.add(runGroovy);
+
webServiceNoServices = new JMenuItem(
MessageManager.getString("label.no_services"));
webService.add(webServiceNoServices);
- pasteMenu.add(pasteNew);
- pasteMenu.add(pasteThis);
- sort.add(sortIDMenuItem);
- sort.add(sortLengthMenuItem);
- sort.add(sortGroupMenuItem);
- sort.add(sortPairwiseMenuItem);
- sort.add(sortByTreeMenu);
exportImageMenu.add(htmlMenuItem);
exportImageMenu.add(epsFile);
exportImageMenu.add(createPNG);
this.getContentPane().add(statusPanel, java.awt.BorderLayout.SOUTH);
statusPanel.add(statusBar, null);
this.getContentPane().add(tabbedPane, java.awt.BorderLayout.CENTER);
- showMenu.add(showAllColumns);
- showMenu.add(showAllSeqs);
- showMenu.add(showAllhidden);
- hideMenu.add(hideSelColumns);
- hideMenu.add(hideSelSequences);
- hideMenu.add(hideAllSelection);
- hideMenu.add(hideAllButSelection);
formatMenu.add(font);
formatMenu.addSeparator();
selectMenu.add(grpsFromSelection);
selectMenu.add(deleteGroups);
selectMenu.add(annotationColumn);
- calculateMenu.add(expandAlignment);
// TODO - determine if the listenToViewSelections button is needed : see bug
// JAL-574
// selectMenu.addSeparator();
}
/**
+ * Try to run script in a Groovy console, having first ensured that this
+ * alignframe is set as currentAlignFrame in Desktop
+ */
+ protected void runGroovy_actionPerformed()
+ {
+
+ }
+ /**
* Adds the given action listener and key accelerator to the given menu item.
* Also saves in a lookup table to support lookup of action by key stroke.
*
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2)
- * Copyright (C) 2014 The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-
-package jalview.jbgui;
-
-import jalview.gui.Desktop;
-import jalview.gui.JvSwingUtils;
-import jalview.jbgui.PDBDocFieldPreferences.PreferenceSource;
-import jalview.util.MessageManager;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
-
-import java.awt.BorderLayout;
-import java.awt.CardLayout;
-import java.awt.Dimension;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.awt.event.KeyAdapter;
-import java.awt.event.KeyEvent;
-import java.awt.event.MouseAdapter;
-import java.awt.event.MouseEvent;
-import java.util.Arrays;
-
-import javax.swing.ImageIcon;
-import javax.swing.JButton;
-import javax.swing.JComboBox;
-import javax.swing.JFrame;
-import javax.swing.JInternalFrame;
-import javax.swing.JLabel;
-import javax.swing.JPanel;
-import javax.swing.JScrollPane;
-import javax.swing.JTabbedPane;
-import javax.swing.JTable;
-import javax.swing.JTextField;
-import javax.swing.event.ChangeEvent;
-import javax.swing.event.ChangeListener;
-import javax.swing.event.DocumentEvent;
-import javax.swing.event.DocumentListener;
-
-/**
- * GUI layout for PDB Fetch Panel
- *
- * @author tcnofoegbu
- *
- */
-@SuppressWarnings("serial")
-public abstract class GPDBSearchPanel extends JPanel
-{
- protected String frameTitle = MessageManager
- .getString("label.pdb_sequence_getcher");
-
- protected JInternalFrame mainFrame = new JInternalFrame(frameTitle);
-
- protected JComboBox<PDBDocField> cmb_searchTarget = new JComboBox<PDBDocField>();
-
- protected JButton btn_ok = new JButton();
-
- protected JButton btn_back = new JButton();
-
- protected JButton btn_cancel = new JButton();
-
- protected JTextField txt_search = new JTextField(20);
-
- protected JTable tbl_summary = new JTable()
- {
- @Override
- public String getToolTipText(MouseEvent evt)
- {
- String toolTipText = null;
- java.awt.Point pnt = evt.getPoint();
- int rowIndex = rowAtPoint(pnt);
- int colIndex = columnAtPoint(pnt);
-
- try
- {
- if (getValueAt(rowIndex, colIndex) == null)
- {
- return null;
- }
- toolTipText = getValueAt(rowIndex, colIndex).toString();
-
- } catch (Exception e)
- {
- e.printStackTrace();
- }
- toolTipText = (toolTipText == null ? null
- : (toolTipText.length() > 500 ? JvSwingUtils.wrapTooltip(
- true, toolTipText.subSequence(0, 500) + "...")
- : JvSwingUtils.wrapTooltip(true, toolTipText)));
-
- return toolTipText;
- }
- };
-
- protected StringBuilder errorWarning = new StringBuilder();
-
- protected JScrollPane scrl_searchResult = new JScrollPane(tbl_summary);
-
- protected ImageIcon warningImage = new ImageIcon(getClass().getResource(
- "/images/warning.gif"));
-
- protected ImageIcon loadingImage = new ImageIcon(getClass().getResource(
- "/images/loading.gif"));
-
- protected JLabel lbl_warning = new JLabel(warningImage);
-
- protected JLabel lbl_loading = new JLabel(loadingImage);
-
- private JTabbedPane tabbedPane = new JTabbedPane();
-
- private PDBDocFieldPreferences pdbDocFieldPrefs = new PDBDocFieldPreferences(
- PreferenceSource.SEARCH_SUMMARY);
-
- private JPanel pnl_actions = new JPanel();
-
- private JPanel pnl_results = new JPanel(new CardLayout());
-
- private JPanel pnl_inputs = new JPanel();
-
- private BorderLayout mainLayout = new BorderLayout();
-
- protected PDBDocField[] previousWantedFields;
-
- public GPDBSearchPanel()
- {
- try
- {
- jbInit();
- mainFrame.invalidate();
- mainFrame.pack();
- } catch (Exception e)
- {
- e.printStackTrace();
- }
- }
-
- /**
- * Initializes the GUI default properties
- *
- * @throws Exception
- */
- private void jbInit() throws Exception
- {
- lbl_warning.setVisible(false);
- lbl_warning.setFont(new java.awt.Font("Verdana", 0, 12));
- lbl_loading.setVisible(false);
- lbl_loading.setFont(new java.awt.Font("Verdana", 0, 12));
-
- tbl_summary.setAutoResizeMode(JTable.AUTO_RESIZE_ALL_COLUMNS);
- tbl_summary.setAutoCreateRowSorter(true);
- tbl_summary.getTableHeader().setReorderingAllowed(false);
- tbl_summary.addMouseListener(new MouseAdapter()
- {
- @Override
- public void mouseClicked(MouseEvent e)
- {
- validateSelection();
- }
-
- @Override
- public void mouseReleased(MouseEvent e)
- {
- validateSelection();
- }
- });
- tbl_summary.addKeyListener(new KeyAdapter()
- {
- @Override
- public void keyPressed(KeyEvent evt)
- {
- validateSelection();
- switch (evt.getKeyCode())
- {
- case KeyEvent.VK_ESCAPE: // escape key
- btn_back_ActionPerformed();
- break;
- case KeyEvent.VK_ENTER: // enter key
- if (btn_ok.isEnabled())
- {
- btn_ok_ActionPerformed();
- }
- evt.consume();
- break;
- case KeyEvent.VK_TAB: // tab key
- if (evt.isShiftDown())
- {
- tabbedPane.requestFocus();
- }
- else
- {
- btn_back.requestFocus();
- }
- evt.consume();
- break;
- default:
- return;
- }
- }
- });
-
- btn_back.setFont(new java.awt.Font("Verdana", 0, 12));
- btn_back.setText(MessageManager.getString("action.back"));
- btn_back.addActionListener(new java.awt.event.ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- btn_back_ActionPerformed();
- }
- });
- btn_back.addKeyListener(new KeyAdapter()
- {
- @Override
- public void keyPressed(KeyEvent evt)
- {
- if (evt.getKeyCode() == KeyEvent.VK_ENTER)
- {
- btn_back_ActionPerformed();
- }
- }
- });
-
- btn_ok.setEnabled(false);
- btn_ok.setFont(new java.awt.Font("Verdana", 0, 12));
- btn_ok.setText(MessageManager.getString("action.ok"));
- btn_ok.addActionListener(new java.awt.event.ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- btn_ok_ActionPerformed();
- }
- });
- btn_ok.addKeyListener(new KeyAdapter()
- {
- @Override
- public void keyPressed(KeyEvent evt)
- {
- if (evt.getKeyCode() == KeyEvent.VK_ENTER)
- {
- btn_ok_ActionPerformed();
- }
- }
- });
-
- btn_cancel.setFont(new java.awt.Font("Verdana", 0, 12));
- btn_cancel.setText(MessageManager.getString("action.cancel"));
- btn_cancel.addActionListener(new java.awt.event.ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- btn_cancel_ActionPerformed();
- }
- });
- btn_cancel.addKeyListener(new KeyAdapter()
- {
- @Override
- public void keyPressed(KeyEvent evt)
- {
- if (evt.getKeyCode() == KeyEvent.VK_ENTER)
- {
- btn_cancel_ActionPerformed();
- }
- }
- });
-
- scrl_searchResult.setPreferredSize(new Dimension(500, 300));
- scrl_searchResult
- .setHorizontalScrollBarPolicy(JScrollPane.HORIZONTAL_SCROLLBAR_NEVER);
-
- cmb_searchTarget.setFont(new java.awt.Font("Verdana", 0, 12));
- cmb_searchTarget.addActionListener(new ActionListener()
- {
- @Override
- public void actionPerformed(ActionEvent e)
- {
- String tooltipText;
- if ("all".equalsIgnoreCase(getCmbSearchTarget().getSelectedItem()
- .toString()))
- {
- tooltipText = MessageManager.getString("label.search_all");
- }
- else if ("pdb id".equalsIgnoreCase(getCmbSearchTarget()
- .getSelectedItem().toString()))
- {
- tooltipText = MessageManager
- .getString("label.separate_multiple_accession_ids");
- }
- else
- {
- tooltipText = MessageManager.formatMessage(
- "label.separate_multiple_query_values",
- new Object[] { getCmbSearchTarget().getSelectedItem()
- .toString() });
- }
- txt_search.setToolTipText(JvSwingUtils.wrapTooltip(true,
- tooltipText));
- txt_search_ActionPerformed();
- }
- });
-
- populateCmbSearchTargetOptions();
-
- txt_search.setFont(new java.awt.Font("Verdana", 0, 12));
-
- txt_search.addKeyListener(new KeyAdapter()
- {
- @Override
- public void keyPressed(KeyEvent e)
- {
- if (e.getKeyCode() == KeyEvent.VK_ENTER)
- {
- if (txt_search.getText() == null
- || txt_search.getText().isEmpty())
- {
- return;
- }
- if ("pdb id".equalsIgnoreCase(getCmbSearchTarget()
- .getSelectedItem().toString()))
- {
- transferToSequenceFetcher(txt_search.getText());
- }
- }
- }
- });
-
- txt_search.getDocument().addDocumentListener(new DocumentListener()
- {
- @Override
- public void insertUpdate(DocumentEvent e)
- {
- txt_search_ActionPerformed();
- }
-
- @Override
- public void removeUpdate(DocumentEvent e)
- {
- txt_search_ActionPerformed();
- }
-
- @Override
- public void changedUpdate(DocumentEvent e)
- {
- txt_search_ActionPerformed();
- }
- });
-
- final String searchTabTitle = MessageManager
- .getString("label.search_result");
- final String configureCols = MessageManager
- .getString("label.configure_displayed_columns");
- ChangeListener changeListener = new ChangeListener()
- {
- @Override
- public void stateChanged(ChangeEvent changeEvent)
- {
- JTabbedPane sourceTabbedPane = (JTabbedPane) changeEvent
- .getSource();
- int index = sourceTabbedPane.getSelectedIndex();
-
- btn_back.setVisible(true);
- btn_cancel.setVisible(true);
- btn_ok.setVisible(true);
- if (sourceTabbedPane.getTitleAt(index).equals(configureCols))
- {
- btn_back.setVisible(false);
- btn_cancel.setVisible(false);
- btn_ok.setVisible(false);
- btn_back.setEnabled(false);
- btn_cancel.setEnabled(false);
- btn_ok.setEnabled(false);
- previousWantedFields = PDBDocFieldPreferences
- .getSearchSummaryFields().toArray(new PDBDocField[0]);
- }
- if (sourceTabbedPane.getTitleAt(index).equals(searchTabTitle))
- {
- btn_back.setEnabled(true);
- btn_cancel.setEnabled(true);
- if (wantedFieldsUpdated())
- {
- txt_search_ActionPerformed();
- }
- else
- {
- validateSelection();
- }
- }
- }
- };
- tabbedPane.addChangeListener(changeListener);
- tabbedPane.setPreferredSize(new Dimension(500, 300));
- tabbedPane.add(searchTabTitle, scrl_searchResult);
- tabbedPane.add(configureCols, pdbDocFieldPrefs);
-
- pnl_actions.add(btn_back);
- pnl_actions.add(btn_ok);
- pnl_actions.add(btn_cancel);
-
- pnl_results.add(tabbedPane);
- pnl_inputs.add(cmb_searchTarget);
- pnl_inputs.add(txt_search);
- pnl_inputs.add(lbl_loading);
- pnl_inputs.add(lbl_warning);
-
- this.setLayout(mainLayout);
- this.add(pnl_inputs, java.awt.BorderLayout.NORTH);
- this.add(pnl_results, java.awt.BorderLayout.CENTER);
- this.add(pnl_actions, java.awt.BorderLayout.SOUTH);
- mainFrame.setVisible(true);
- mainFrame.setContentPane(this);
- mainFrame.setDefaultCloseOperation(JFrame.DISPOSE_ON_CLOSE);
- Desktop.addInternalFrame(mainFrame, frameTitle, 800, 400);
- }
-
- public boolean wantedFieldsUpdated()
- {
- if (previousWantedFields == null)
- {
- return true;
- }
-
- return Arrays.equals(PDBDocFieldPreferences.getSearchSummaryFields()
- .toArray(new PDBDocField[0]), previousWantedFields) ? false
- : true;
-
- }
-
- public void validateSelection()
- {
- if (tbl_summary.getSelectedRows().length > 0)
- {
- btn_ok.setEnabled(true);
- }
- else
- {
- btn_ok.setEnabled(false);
- }
- }
-
- public JComboBox<PDBDocField> getCmbSearchTarget()
- {
- return cmb_searchTarget;
- }
-
- public JTextField getTxtSearch()
- {
- return txt_search;
- }
-
- public JInternalFrame getMainFrame()
- {
- return mainFrame;
- }
-
- public abstract void transferToSequenceFetcher(String ids);
-
- public abstract void txt_search_ActionPerformed();
-
- public abstract void btn_ok_ActionPerformed();
-
- public abstract void btn_back_ActionPerformed();
-
- public abstract void btn_cancel_ActionPerformed();
-
- public abstract void populateCmbSearchTargetOptions();
-
-}
*/
package jalview.jbgui;
+import jalview.fts.core.FTSDataColumnPreferences;
+import jalview.fts.core.FTSDataColumnPreferences.PreferenceSource;
+import jalview.fts.service.pdb.PDBFTSRestClient;
import jalview.gui.JvSwingUtils;
import jalview.gui.StructureViewer.ViewerType;
-import jalview.jbgui.PDBDocFieldPreferences.PreferenceSource;
import jalview.util.MessageManager;
import java.awt.BorderLayout;
/*
* Output tab components
*/
- protected JComboBox<String> epsRendering = new JComboBox<String>();
+ protected JComboBox<Object> epsRendering = new JComboBox<Object>();
protected JLabel userIdWidthlabel = new JLabel();
ypos += lineSpacing;
ypos += lineSpacing;
- PDBDocFieldPreferences docFieldPref = new PDBDocFieldPreferences(
- PreferenceSource.PREFERENCES);
+ FTSDataColumnPreferences docFieldPref = new FTSDataColumnPreferences(
+ PreferenceSource.PREFERENCES, PDBFTSRestClient.getInstance());
docFieldPref.setBounds(new Rectangle(10, ypos, 450, 120));
structureTab.add(docFieldPref);
package jalview.jbgui;
import jalview.datamodel.SequenceI;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.core.FTSDataColumnPreferences;
+import jalview.fts.core.FTSDataColumnPreferences.PreferenceSource;
+import jalview.fts.service.pdb.PDBFTSRestClient;
import jalview.gui.AlignmentPanel;
import jalview.gui.Desktop;
import jalview.gui.JvSwingUtils;
-import jalview.jbgui.PDBDocFieldPreferences.PreferenceSource;
import jalview.util.MessageManager;
-import jalview.ws.dbsources.PDBRestClient;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
import java.awt.BorderLayout;
import java.awt.CardLayout;
import javax.swing.event.ChangeListener;
import javax.swing.event.DocumentEvent;
import javax.swing.event.DocumentListener;
+import javax.swing.table.TableColumn;
@SuppressWarnings("serial")
/**
protected static final String VIEWS_LOCAL_PDB = "VIEWS_LOCAL_PDB";
+ protected JTable tbl_local_pdb = new JTable();
+
+ protected JScrollPane scrl_localPDB = new JScrollPane(tbl_local_pdb);
+
+ private JTabbedPane pnl_filter = new JTabbedPane();
+
+ private FTSDataColumnPreferences pdbDocFieldPrefs = new FTSDataColumnPreferences(
+ PreferenceSource.STRUCTURE_CHOOSER,
+ PDBFTSRestClient.getInstance());
+
+ protected FTSDataColumnI[] previousWantedFields;
+
protected JTable tbl_summary = new JTable()
{
+ private boolean inLayout;
+
+ @Override
+ public boolean getScrollableTracksViewportWidth()
+ {
+ return hasExcessWidth();
+
+ }
+
+ @Override
+ public void doLayout()
+ {
+ if (hasExcessWidth())
+ {
+ autoResizeMode = AUTO_RESIZE_SUBSEQUENT_COLUMNS;
+ }
+ inLayout = true;
+ super.doLayout();
+ inLayout = false;
+ autoResizeMode = AUTO_RESIZE_OFF;
+ }
+
+ protected boolean hasExcessWidth()
+ {
+ return getPreferredSize().width < getParent().getWidth();
+ }
+
+ @Override
+ public void columnMarginChanged(ChangeEvent e)
+ {
+ if (isEditing())
+ {
+ removeEditor();
+ }
+ TableColumn resizingColumn = getTableHeader().getResizingColumn();
+ // Need to do this here, before the parent's
+ // layout manager calls getPreferredSize().
+ if (resizingColumn != null && autoResizeMode == AUTO_RESIZE_OFF
+ && !inLayout)
+ {
+ resizingColumn.setPreferredWidth(resizingColumn.getWidth());
+ }
+ resizeAndRepaint();
+ }
+
@Override
public String getToolTipText(MouseEvent evt)
{
protected JScrollPane scrl_foundStructures = new JScrollPane(tbl_summary);
- protected JTable tbl_local_pdb = new JTable();
-
- protected JScrollPane scrl_localPDB = new JScrollPane(tbl_local_pdb);
-
- private JTabbedPane pnl_filter = new JTabbedPane();
-
- private PDBDocFieldPreferences pdbDocFieldPrefs = new PDBDocFieldPreferences(
- PreferenceSource.STRUCTURE_CHOOSER);
-
- protected PDBDocField[] previousWantedFields;
-
public GStructureChooser()
{
try
btn_cancel.setEnabled(false);
btn_view.setVisible(false);
btn_cancel.setVisible(false);
- previousWantedFields = PDBDocFieldPreferences
- .getStructureSummaryFields().toArray(
- new PDBRestClient.PDBDocField[0]);
+ previousWantedFields = PDBFTSRestClient.getInstance()
+ .getAllDefaulDisplayedDataColumns()
+ .toArray(new FTSDataColumnI[0]);
}
if (sourceTabbedPane.getTitleAt(index)
.equals(foundStructureSummary))
return true;
}
- return Arrays.equals(PDBDocFieldPreferences.getStructureSummaryFields()
- .toArray(new PDBRestClient.PDBDocField[0]),
+ return Arrays.equals(
+ PDBFTSRestClient.getInstance()
+ .getAllDefaulDisplayedDataColumns()
+ .toArray(new FTSDataColumnI[0]),
previousWantedFields) ? false : true;
}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.renderer;
+
+import jalview.api.AlignViewportI;
+import jalview.datamodel.SequenceI;
+
+import java.util.ArrayList;
+import java.util.List;
+
+/**
+ * Calculate and display alignment rulers
+ *
+ * @author jprocter
+ *
+ */
+public class ScaleRenderer
+{
+ /**
+ * calculate positions markers on the alignment ruler
+ *
+ * @param av
+ * @param startx
+ * left-most column in visible view
+ * @param endx
+ * - right-most column in visible view
+ * @return List { Object { .. } } Boolean: true/false for major/minor mark,
+ * Integer: marker position in alignment column coords, String: null
+ * or a String to be rendered at the position.
+ */
+ public static List<Object[]> calculateMarks(AlignViewportI av,
+ int startx, int endx)
+ {
+ new ArrayList<Object[]>();
+
+ int scalestartx = (startx / 10) * 10;
+
+ SequenceI refSeq = av.getAlignment().getSeqrep();
+ int refSp = 0, refStartI = 0, refEndI = -1;
+ if (refSeq != null)
+ {
+ // find bounds and set origin appopriately
+ // locate first visible position for this sequence
+ int[] refbounds = av.getColumnSelection()
+ .locateVisibleBoundsOfSequence(refSeq);
+
+ refSp = refbounds[0];
+ refStartI = refbounds[4];
+ refEndI = refbounds[5];
+ scalestartx = refSp + ((scalestartx - refSp) / 10) * 10;
+ }
+
+ if (refSeq == null && scalestartx % 10 == 0)
+ {
+ scalestartx += 5;
+ }
+ List<Object[]> marks = new ArrayList<Object[]>();
+ String string;
+ int refN, iadj;
+ // todo: add a 'reference origin column' to set column number relative to
+ for (int i = scalestartx; i < endx; i += 5)
+ {
+ Object[] amark = new Object[3];
+ if (((i - refSp) % 10) == 0)
+ {
+ if (refSeq == null)
+ {
+ iadj = av.getColumnSelection().adjustForHiddenColumns(i - 1) + 1;
+ string = String.valueOf(iadj);
+ }
+ else
+ {
+ iadj = av.getColumnSelection().adjustForHiddenColumns(i - 1);
+ refN = refSeq.findPosition(iadj);
+ // TODO show bounds if position is a gap
+ // - ie L--R -> "1L|2R" for
+ // marker
+ if (iadj < refStartI)
+ {
+ string = String.valueOf(iadj - refStartI);
+ }
+ else if (iadj > refEndI)
+ {
+ string = "+" + String.valueOf(iadj - refEndI);
+ }
+ else
+ {
+ string = String.valueOf(refN) + refSeq.getCharAt(iadj);
+ }
+ }
+ amark[0] = Boolean.TRUE;
+ amark[1] = Integer.valueOf(i - startx - 1);
+ amark[2] = string;
+
+ }
+ else
+ {
+ amark[0] = Boolean.FALSE;
+ amark[1] = Integer.valueOf(i - startx - 1);
+ amark[2] = null;
+ }
+ marks.add(amark);
+ }
+ return marks;
+ }
+
+}
}
- if (transparency != 1.0f && g != null && transparencyAvailable)
+ if (transparency != 1.0f && g != null)
{
Graphics2D g2 = (Graphics2D) g;
g2.setComposite(AlphaComposite.getInstance(AlphaComposite.SRC_OVER,
}
}
- boolean transparencyAvailable = true;
-
- protected void setTransparencyAvailable(boolean isTransparencyAvailable)
- {
- transparencyAvailable = isTransparencyAvailable;
- }
-
- @Override
- public boolean isTransparencyAvailable()
- {
- return transparencyAvailable;
- }
-
/**
* Called when alignment in associated view has new/modified features to
* discover and display.
return col == null ? null : col.brighter().brighter().brighter();
}
+ /**
+ * Returns a color between minColour and maxColour; the RGB values are in
+ * proportion to where 'value' lies between minValue and maxValue
+ *
+ * @param value
+ * @param minValue
+ * @param minColour
+ * @param maxValue
+ * @param maxColour
+ * @return
+ */
+ public static Color getGraduatedColour(float value, float minValue,
+ Color minColour, float maxValue, Color maxColour)
+ {
+ if (minValue == maxValue)
+ {
+ return minColour;
+ }
+ if (value < minValue)
+ {
+ value = minValue;
+ }
+ if (value > maxValue)
+ {
+ value = maxValue;
+ }
+
+ /*
+ * prop = proportion of the way value is from minValue to maxValue
+ */
+ float prop = (value - minValue) / (maxValue - minValue);
+ float r = minColour.getRed() + prop
+ * (maxColour.getRed() - minColour.getRed());
+ float g = minColour.getGreen() + prop
+ * (maxColour.getGreen() - minColour.getGreen());
+ float b = minColour.getBlue() + prop
+ * (maxColour.getBlue() - minColour.getBlue());
+ return new Color(r / 255, g / 255, b / 255);
+ }
}
* @param letters
* @return
*/
- public static final boolean areNucleotide(char[][] letters)
+ static final boolean areNucleotide(char[][] letters)
{
int ntCount = 0;
int aaCount = 0;
// to save a lengthy calculation
for (char c : seq)
{
- if ('a' <= c && c <= 'z')
- {
- c -= TO_UPPER_CASE;
- }
-
- if (c == 'A' || c == 'G' || c == 'C' || c == 'T' || c == 'U')
+ if (isNucleotide(c))
{
ntCount++;
}
- else if (!Comparison.isGap(c))
+ else if (!isGap(c))
{
aaCount++;
}
}
/**
+ * Answers true if the character is one of aAcCgGtTuU
+ *
+ * @param c
+ * @return
+ */
+ public static boolean isNucleotide(char c)
+ {
+ if ('a' <= c && c <= 'z')
+ {
+ c -= TO_UPPER_CASE;
+ }
+
+ switch (c)
+ {
+ case 'A':
+ case 'C':
+ case 'G':
+ case 'T':
+ case 'U':
+ return true;
+ }
+ return false;
+ }
+
+ /**
+ * Answers true if every character in the string is one of aAcCgGtTuU, or
+ * (optionally) a gap character (dot, dash, space), else false
+ *
+ * @param s
+ * @param allowGaps
+ * @return
+ */
+ public static boolean isNucleotideSequence(String s, boolean allowGaps)
+ {
+ if (s == null)
+ {
+ return false;
+ }
+ for (int i = 0; i < s.length(); i++)
+ {
+ char c = s.charAt(i);
+ if (!isNucleotide(c))
+ {
+ if (!allowGaps || !isGap(c))
+ {
+ return false;
+ }
+ }
+ }
+ return true;
+ }
+
+ /**
* Convenience overload of isNucleotide
*
* @param seqs
--- /dev/null
+package jalview.util;
+
+import java.util.ArrayList;
+import java.util.Collections;
+import java.util.List;
+
+public class DnaUtils
+{
+
+ /**
+ * Parses an ENA/GenBank format location specifier and returns a list of
+ * [start, end] ranges. Returns null if not able to parse.
+ *
+ * @param location
+ * @return
+ * @see http://www.insdc.org/files/feature_table.html#3.4
+ */
+ public static List<int[]> parseLocation(String location)
+ {
+ if (location.startsWith("join("))
+ {
+ return parseJoin(location);
+ }
+ else if (location.startsWith("complement("))
+ {
+ return parseComplement(location);
+ }
+ String errorMessage = "Unable to process location specifier: "
+ + location;
+ if (location.startsWith("order("))
+ {
+ System.err.println(errorMessage);
+ return null;
+ }
+
+ /*
+ * try to parse m..n (or simply m)
+ * also handles <m..n or m..>n (discarding < or >)
+ */
+ String[] range = location.split("\\.\\.");
+ if (range.length == 1 || range.length == 2)
+ {
+ try
+ {
+ int start = parseRangeEnd(range[0]);
+ int end = range.length == 1 ? start : parseRangeEnd(range[1]);
+ return Collections.singletonList(new int[] { start, end });
+ } catch (NumberFormatException e)
+ {
+ /*
+ * could be a location like <1..888 or 1..>888
+ */
+ System.err.println(errorMessage);
+ return null;
+ }
+ }
+ else
+ {
+ /*
+ * could be a location like 102.110 or 123^124
+ */
+ System.err.println(errorMessage);
+ return null;
+ }
+ }
+
+ /**
+ * Returns the integer value of a locus, discarding any < or > prefix
+ *
+ * @throws NumberFormatException
+ * if value is not numeric
+ */
+ static int parseRangeEnd(String loc)
+ {
+
+ if (loc.startsWith("<") || loc.startsWith(">"))
+ {
+ loc = loc.substring(1);
+ }
+ return Integer.valueOf(loc);
+ }
+
+ /**
+ * Parses a complement(locationSpec) into a list of start-end ranges
+ *
+ * @param location
+ * @return
+ */
+ static List<int[]> parseComplement(String location)
+ {
+ /*
+ * take what is inside complement()
+ */
+ if (!location.endsWith(")"))
+ {
+ return null;
+ }
+ String toComplement = location.substring("complement(".length(),
+ location.length() - 1);
+ List<int[]> ranges = parseLocation(toComplement);
+ if (ranges == null)
+ {
+ /*
+ * something bad in there
+ */
+ return null;
+ }
+
+ /*
+ * reverse the order and direction of ranges
+ */
+ Collections.reverse(ranges);
+ for (int[] range : ranges)
+ {
+ int temp = range[0];
+ range[0] = range[1];
+ range[1] = temp;
+ }
+ return ranges;
+ }
+
+ /**
+ * Parses a join(loc1,loc2,...,locn) into a list of start-end ranges
+ *
+ * @param location
+ * @return
+ */
+ static List<int[]> parseJoin(String location)
+ {
+ List<int[]> ranges = new ArrayList<int[]>();
+
+ /*
+ * take what is inside join()
+ */
+ if (!location.endsWith(")"))
+ {
+ return null;
+ }
+ String joinedLocs = location.substring("join(".length(),
+ location.length() - 1);
+ String[] locations = joinedLocs.split(",");
+ for (String loc : locations)
+ {
+ List<int[]> range = parseLocation(loc);
+ if (range == null)
+ {
+ /*
+ * something bad in there
+ */
+ return null;
+ }
+ else
+ {
+ ranges.addAll(range);
+ }
+ }
+ return ranges;
+ }
+
+}
}
}
- if (renderStyle.equalsIgnoreCase("lineart"))
+ if (renderStyle.equalsIgnoreCase("Lineart"))
{
ig2.setRenderingHint(SVGHints.KEY_DRAW_STRING_TYPE,
SVGHints.VALUE_DRAW_STRING_TYPE_VECTOR);
}
return result;
}
+
+ /**
+ * Compares two versions formatted as e.g. "3.4.5" and returns -1, 0 or 1 as
+ * the first version precedes, is equal to, or follows the second
+ *
+ * @param v1
+ * @param v2
+ * @return
+ */
+ public static int compareVersions(String v1, String v2)
+ {
+ return compareVersions(v1, v2, null);
+ }
+
+ /**
+ * Compares two versions formatted as e.g. "3.4.5b1" and returns -1, 0 or 1 as
+ * the first version precedes, is equal to, or follows the second
+ *
+ * @param v1
+ * @param v2
+ * @param pointSeparator
+ * a string used to delimit point increments in sub-tokens of the
+ * version
+ * @return
+ */
+ public static int compareVersions(String v1, String v2,
+ String pointSeparator)
+ {
+ if (v1 == null || v2 == null)
+ {
+ return 0;
+ }
+ String[] toks1 = v1.split("\\.");
+ String[] toks2 = v2.split("\\.");
+ int i = 0;
+ for (; i < toks1.length; i++)
+ {
+ if (i >= toks2.length)
+ {
+ /*
+ * extra tokens in v1
+ */
+ return 1;
+ }
+ String tok1 = toks1[i];
+ String tok2 = toks2[i];
+ if (pointSeparator != null)
+ {
+ /*
+ * convert e.g. 5b2 into decimal 5.2 for comparison purposes
+ */
+ tok1 = tok1.replace(pointSeparator, ".");
+ tok2 = tok2.replace(pointSeparator, ".");
+ }
+ try
+ {
+ float f1 = Float.valueOf(tok1);
+ float f2 = Float.valueOf(tok2);
+ int comp = Float.compare(f1, f2);
+ if (comp != 0)
+ {
+ return comp;
+ }
+ } catch (NumberFormatException e)
+ {
+ System.err.println("Invalid version format found: "
+ + e.getMessage());
+ return 0;
+ }
+ }
+
+ if (i < toks2.length)
+ {
+ /*
+ * extra tokens in v2
+ */
+ return -1;
+ }
+
+ /*
+ * same length, all tokens match
+ */
+ return 0;
+ }
+
+ /**
+ * Converts the string to all lower-case except the first character which is
+ * upper-cased
+ *
+ * @param s
+ * @return
+ */
+ public static String toSentenceCase(String s)
+ {
+ if (s == null)
+ {
+ return s;
+ }
+ if (s.length() <= 1)
+ {
+ return s.toUpperCase();
+ }
+ return s.substring(0, 1).toUpperCase() + s.substring(1).toLowerCase();
+ }
}
{
updateHiddenColumns();
}
+ isColSelChanged(true);
}
/**
*/
public boolean isColSelChanged(boolean b)
{
- int hc = (colSel == null || colSel.isEmpty()) ? -1 : colSel
- .hashCode();
+ int hc = (colSel == null || colSel.isEmpty()) ? -1 : colSel.hashCode();
if (hc != -1 && hc != colselhash)
{
if (b)
colSel.hideSelectedColumns();
setSelectionGroup(null);
-
+ isColSelChanged(true);
}
public void hideColumns(int start, int end)
{
colSel.hideColumns(start, end);
}
+ isColSelChanged(true);
}
public void showColumn(int col)
{
colSel.revealHiddenColumns(col);
-
+ isColSelChanged(true);
}
public void showAllHiddenColumns()
{
colSel.revealAllHiddenColumns();
+ isColSelChanged(true);
}
// common hide/show seq stuff
}
+ /**
+ *
+ * @return null or the current reference sequence
+ */
+ public SequenceI getReferenceSeq()
+ {
+ return alignment.getSeqrep();
+ }
+
+ /**
+ * @param seq
+ * @return true iff seq is the reference for the alignment
+ */
+ public boolean isReferenceSeq(SequenceI seq)
+ {
+ return alignment.getSeqrep() == seq;
+ }
+
+ /**
+ *
+ * @param seq
+ * @return true if there are sequences represented by this sequence that are
+ * currently hidden
+ */
public boolean isHiddenRepSequence(SequenceI seq)
{
- return alignment.getSeqrep() == seq
- || (hiddenRepSequences != null && hiddenRepSequences
+ return (hiddenRepSequences != null && hiddenRepSequences
.containsKey(seq));
}
+ /**
+ *
+ * @param seq
+ * @return null or a sequence group containing the sequences that seq
+ * represents
+ */
public SequenceGroup getRepresentedSequences(SequenceI seq)
{
return (SequenceGroup) (hiddenRepSequences == null ? null
protected AlignmentViewport av;
+ /*
+ * map holds per feature type, {{min, max}, {min, max}} feature score
+ * values for positional and non-positional features respectively
+ */
+ private Map<String, float[][]> minmax = new Hashtable<String, float[][]>();
+
@Override
public AlignViewportI getViewport()
{
renderOrder = neworder;
}
- protected Hashtable minmax = new Hashtable();
-
- public Hashtable getMinMax()
+ public Map<String, float[][]> getMinMax()
{
return minmax;
}
*/
protected final byte[] normaliseScore(SequenceFeature sequenceFeature)
{
- float[] mm = ((float[][]) minmax.get(sequenceFeature.type))[0];
+ float[] mm = minmax.get(sequenceFeature.type)[0];
final byte[] r = new byte[] { 0, (byte) 255 };
if (mm != null)
{
}
if (minmax == null)
{
- minmax = new Hashtable();
+ minmax = new Hashtable<String, float[][]>();
}
AlignmentI alignment = av.getAlignment();
for (int i = 0; i < alignment.getHeight(); i++)
if (!Float.isNaN(features[index].score))
{
int nonpos = features[index].getBegin() >= 1 ? 0 : 1;
- float[][] mm = (float[][]) minmax.get(features[index].getType());
+ float[][] mm = minmax.get(features[index].getType());
if (mm == null)
{
mm = new float[][] { null, null };
}
/**
- * return a nominal colour for this feature
- *
- * @param featureType
- * @return standard color, or maximum colour for graduated colourscheme
- */
- public Color getColour(String featureType)
- {
- Object fc = getFeatureStyle(featureType);
-
- if (fc instanceof Color)
- {
- return (Color) fc;
- }
- else
- {
- if (fc instanceof GraduatedColor)
- {
- return ((GraduatedColor) fc).getMaxColor();
- }
- }
- throw new Error("Implementation Error: Unrecognised render object "
- + fc.getClass() + " for features of type " + featureType);
- }
-
- /**
* calculate the render colour for a specific feature using current feature
* settings.
*
changeSupport.removePropertyChangeListener(listener);
}
- public Set getAllFeatureColours()
+ public Set<String> getAllFeatureColours()
{
return featureColours.keySet();
}
return renderOrder != null;
}
+ /**
+ * Returns feature types in ordering of rendering, where last means on top
+ */
public List<String> getRenderOrder()
{
if (renderOrder == null)
while (en.hasNext())
{
String col = en.next();
- fcols.put(col, getColour(col));
+ fcols.put(col, featureColours.get(col));
}
return fcols;
}
protected AlignmentViewPanel ap;
- protected List<AlignmentAnnotation> ourAnnots = null;
+ protected List<AlignmentAnnotation> ourAnnots;
public AlignCalcWorker(AlignViewportI alignViewport,
AlignmentViewPanel alignPanel)
}
+ @Override
public boolean involves(AlignmentAnnotation i)
{
return ourAnnots != null && ourAnnots.contains(i);
}
/**
- * permanently remove from the alignment all annotation rows managed by this
+ * Permanently removes from the alignment all annotation rows managed by this
* worker
*/
@Override
- public void removeOurAnnotation()
+ public void removeAnnotation()
{
if (ourAnnots != null && alignViewport != null)
{
alignment.deleteAnnotation(aa, true);
}
}
+ ourAnnots.clear();
}
}
// TODO: allow GUI to query workers associated with annotation to add items to
--- /dev/null
+package jalview.workers;
+
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.Annotation;
+import jalview.gui.AlignFrame;
+import jalview.gui.Desktop;
+
+import java.awt.Color;
+
+/**
+ * Factory class with methods which allow clients (including external scripts
+ * such as Groovy) to 'register and forget' an alignment annotation calculator. <br>
+ * Currently supports two flavours of calculator:
+ * <ul>
+ * <li>a 'feature counter' which can count any desired property derivable from
+ * residue value and any sequence features at each position of the alignment</li>
+ * <li>a 'general purpose' calculator which computes one more complete
+ * AlignmentAnnotation objects</li>
+ * </ul>
+ */
+public class AlignmentAnnotationFactory
+{
+ /**
+ * Constructs and registers a new alignment annotation worker
+ *
+ * @param counter
+ * provider of feature counts per alignment position
+ */
+ public static void newCalculator(FeatureCounterI counter)
+ {
+ if (Desktop.getCurrentAlignFrame() != null)
+ {
+ newCalculator(Desktop.getCurrentAlignFrame(), counter);
+ }
+ else
+ {
+ System.err
+ .println("Can't register calculator as no alignment window has focus");
+ }
+ }
+
+ /**
+ * Constructs and registers a new alignment annotation worker
+ *
+ * @param af
+ * the AlignFrame for which the annotation is to be calculated
+ * @param counter
+ * provider of feature counts per alignment position
+ */
+ public static void newCalculator(AlignFrame af, FeatureCounterI counter)
+ {
+ new ColumnCounterWorker(af, counter);
+ }
+
+ /**
+ * Constructs and registers a new alignment annotation worker
+ *
+ * @param calculator
+ * provider of AlignmentAnnotation for the alignment
+ */
+ public static void newCalculator(AnnotationProviderI calculator)
+ {
+ if (Desktop.getCurrentAlignFrame() != null)
+ {
+ newCalculator(Desktop.getCurrentAlignFrame(), calculator);
+ }
+ else
+ {
+ System.err
+ .println("Can't register calculator as no alignment window has focus");
+ }
+ }
+
+ /**
+ * Constructs and registers a new alignment annotation worker
+ *
+ * @param af
+ * the AlignFrame for which the annotation is to be calculated
+ * @param calculator
+ * provider of AlignmentAnnotation for the alignment
+ */
+ public static void newCalculator(AlignFrame af,
+ AnnotationProviderI calculator)
+ {
+ new AnnotationWorker(af, calculator);
+ }
+
+ /**
+ * Factory method to construct an Annotation object
+ *
+ * @param displayChar
+ * @param desc
+ * @param secondaryStructure
+ * @param val
+ * @param color
+ * @return
+ */
+ public static Annotation newAnnotation(String displayChar, String desc,
+ char secondaryStructure, float val, Color color)
+ {
+ return new Annotation(displayChar, desc, secondaryStructure, val, color);
+ }
+
+ /**
+ * Factory method to construct an AlignmentAnnotation object
+ *
+ * @param name
+ * @param desc
+ * @param anns
+ * @return
+ */
+ public static AlignmentAnnotation newAlignmentAnnotation(String name,
+ String desc, Annotation[] anns)
+ {
+ return new AlignmentAnnotation(name, desc, anns);
+ }
+}
--- /dev/null
+package jalview.workers;
+
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.AlignmentI;
+import jalview.gui.FeatureRenderer;
+
+import java.util.List;
+
+/**
+ * Interface to be satisfied by any class which computes one or more alignment
+ * annotations
+ */
+public interface AnnotationProviderI
+{
+ List<AlignmentAnnotation> calculateAnnotation(AlignmentI al,
+ FeatureRenderer fr);
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.workers;
+
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.AlignmentI;
+import jalview.gui.AlignFrame;
+import jalview.gui.AlignmentPanel;
+import jalview.gui.FeatureRenderer;
+
+import java.util.ArrayList;
+import java.util.List;
+
+/**
+ * A class to create and update one or more alignment annotations, given a
+ * 'calculator'.
+ *
+ */
+class AnnotationWorker extends AlignCalcWorker
+{
+ /*
+ * the provider of the annotation calculations
+ */
+ AnnotationProviderI counter;
+
+ /**
+ * Constructor
+ *
+ * @param af
+ * @param counter
+ */
+ public AnnotationWorker(AlignFrame af, AnnotationProviderI counter)
+ {
+ super(af.getViewport(), af.alignPanel);
+ ourAnnots = new ArrayList<AlignmentAnnotation>();
+ this.counter = counter;
+ calcMan.registerWorker(this);
+ }
+
+ @Override
+ public void run()
+ {
+ try
+ {
+ calcMan.notifyStart(this);
+
+ while (!calcMan.notifyWorking(this))
+ {
+ try
+ {
+ Thread.sleep(200);
+ } catch (InterruptedException ex)
+ {
+ ex.printStackTrace();
+ }
+ }
+ if (alignViewport.isClosed())
+ {
+ abortAndDestroy();
+ return;
+ }
+
+ removeAnnotations();
+ AlignmentI alignment = alignViewport.getAlignment();
+ if (alignment != null)
+ {
+ try
+ {
+ List<AlignmentAnnotation> anns = counter.calculateAnnotation(
+ alignment, new FeatureRenderer((AlignmentPanel) ap));
+ for (AlignmentAnnotation ann : anns)
+ {
+ ann.showAllColLabels = true;
+ ann.graph = AlignmentAnnotation.BAR_GRAPH;
+ ourAnnots.add(ann);
+ alignment.addAnnotation(ann);
+ }
+ } catch (IndexOutOfBoundsException x)
+ {
+ // probable race condition. just finish and return without any fuss.
+ return;
+ }
+ }
+ } catch (OutOfMemoryError error)
+ {
+ ap.raiseOOMWarning("calculating annotations", error);
+ calcMan.workerCannotRun(this);
+ } finally
+ {
+ calcMan.workerComplete(this);
+ }
+
+ if (ap != null)
+ {
+ ap.adjustAnnotationHeight();
+ ap.paintAlignment(true);
+ }
+
+ }
+
+ /**
+ * Remove all our annotations before re-calculating them
+ */
+ void removeAnnotations()
+ {
+ for (AlignmentAnnotation ann : ourAnnots)
+ {
+ alignViewport.getAlignment().deleteAnnotation(ann);
+ }
+ ourAnnots.clear();
+ }
+
+ @Override
+ public void updateAnnotation()
+ {
+ // do nothing
+ }
+}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.workers;
+
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Annotation;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.gui.AlignFrame;
+import jalview.gui.AlignmentPanel;
+import jalview.gui.FeatureRenderer;
+import jalview.util.ColorUtils;
+import jalview.util.Comparison;
+
+import java.awt.Color;
+import java.util.ArrayList;
+import java.util.List;
+
+/**
+ * A class to compute an alignment annotation with column counts of any
+ * properties of interest of positions in an alignment. <br>
+ * This is designed to be extensible, by supplying to the constructor an object
+ * that computes a count for each residue position, based on the residue value
+ * and any sequence features at that position.
+ *
+ */
+class ColumnCounterWorker extends AlignCalcWorker
+{
+ FeatureCounterI counter;
+
+ /**
+ * Constructor registers the annotation for the given alignment frame
+ *
+ * @param af
+ * @param counter
+ */
+ public ColumnCounterWorker(AlignFrame af, FeatureCounterI counter)
+ {
+ super(af.getViewport(), af.alignPanel);
+ ourAnnots = new ArrayList<AlignmentAnnotation>();
+ this.counter = counter;
+ calcMan.registerWorker(this);
+ }
+
+ /**
+ * method called under control of AlignCalcManager to recompute the annotation
+ * when the alignment changes
+ */
+ @Override
+ public void run()
+ {
+ try
+ {
+ calcMan.notifyStart(this);
+
+ while (!calcMan.notifyWorking(this))
+ {
+ try
+ {
+ Thread.sleep(200);
+ } catch (InterruptedException ex)
+ {
+ ex.printStackTrace();
+ }
+ }
+ if (alignViewport.isClosed())
+ {
+ abortAndDestroy();
+ return;
+ }
+
+ removeAnnotation();
+ if (alignViewport.getAlignment() != null)
+ {
+ try
+ {
+ computeAnnotations();
+ } catch (IndexOutOfBoundsException x)
+ {
+ // probable race condition. just finish and return without any fuss.
+ return;
+ }
+ }
+ } catch (OutOfMemoryError error)
+ {
+ ap.raiseOOMWarning("calculating feature counts", error);
+ calcMan.workerCannotRun(this);
+ } finally
+ {
+ calcMan.workerComplete(this);
+ }
+
+ if (ap != null)
+ {
+ ap.adjustAnnotationHeight();
+ ap.paintAlignment(true);
+ }
+
+ }
+
+ /**
+ * Scan each column of the alignment to calculate a count by feature type. Set
+ * the count as the value of the alignment annotation for that feature type.
+ */
+ void computeAnnotations()
+ {
+ FeatureRenderer fr = new FeatureRenderer((AlignmentPanel) ap);
+ // TODO use the commented out code once JAL-2075 is fixed
+ // to get adequate performance on genomic length sequence
+ AlignmentI alignment = alignViewport.getAlignment();
+ // AlignmentView alignmentView = alignViewport.getAlignmentView(false);
+ // AlignmentI alignment = alignmentView.getVisibleAlignment(' ');
+
+ // int width = alignmentView.getWidth();
+ int width = alignment.getWidth();
+ int height = alignment.getHeight();
+ int[] counts = new int[width];
+ int max = 0;
+
+ for (int col = 0; col < width; col++)
+ {
+ int count = 0;
+ for (int row = 0; row < height; row++)
+ {
+ count += countFeaturesAt(alignment, col, row, fr);
+ }
+ counts[col] = count;
+ max = Math.max(count, max);
+ }
+
+ Annotation[] anns = new Annotation[width];
+ /*
+ * add non-zero counts as annotations
+ */
+ for (int i = 0; i < counts.length; i++)
+ {
+ int count = counts[i];
+ if (count > 0)
+ {
+ Color color = ColorUtils.getGraduatedColour(count, 0, Color.cyan,
+ max, Color.blue);
+ anns[i] = new Annotation(String.valueOf(count),
+ String.valueOf(count), '0', count, color);
+ }
+ }
+
+ /*
+ * construct the annotation, save it and add it to the displayed alignment
+ */
+ AlignmentAnnotation ann = new AlignmentAnnotation(counter.getName(),
+ counter.getDescription(), anns);
+ ann.showAllColLabels = true;
+ ann.graph = AlignmentAnnotation.BAR_GRAPH;
+ ourAnnots.add(ann);
+ alignViewport.getAlignment().addAnnotation(ann);
+ }
+
+ /**
+ * Returns a count of any feature types present at the specified position of
+ * the alignment
+ *
+ * @param alignment
+ * @param col
+ * @param row
+ * @param fr
+ */
+ int countFeaturesAt(AlignmentI alignment, int col, int row,
+ FeatureRenderer fr)
+ {
+ SequenceI seq = alignment.getSequenceAt(row);
+ if (seq == null)
+ {
+ return 0;
+ }
+ if (col >= seq.getLength())
+ {
+ return 0;// sequence doesn't extend this far
+ }
+ char res = seq.getCharAt(col);
+ if (Comparison.isGap(res))
+ {
+ return 0;
+ }
+ int pos = seq.findPosition(col);
+
+ /*
+ * compute a count for any displayed features at residue
+ */
+ // NB have to adjust pos if using AlignmentView.getVisibleAlignment
+ // see JAL-2075
+ List<SequenceFeature> features = fr.findFeaturesAtRes(seq, pos);
+ int count = this.counter.count(String.valueOf(res), features);
+ return count;
+ }
+
+ /**
+ * Method called when the user changes display options that may affect how the
+ * annotation is rendered, but do not change its values. Currently no such
+ * options affect user-defined annotation, so this method does nothing.
+ */
+ @Override
+ public void updateAnnotation()
+ {
+ // do nothing
+ }
+}
package jalview.workers;
import jalview.analysis.AAFrequency;
-import jalview.api.AlignCalcWorkerI;
import jalview.api.AlignViewportI;
import jalview.api.AlignmentViewPanel;
import jalview.datamodel.AlignmentAnnotation;
import java.util.Hashtable;
-public class ConsensusThread extends AlignCalcWorker implements
- AlignCalcWorkerI
+public class ConsensusThread extends AlignCalcWorker
{
public ConsensusThread(AlignViewportI alignViewport,
AlignmentViewPanel alignPanel)
package jalview.workers;
import jalview.analysis.Conservation;
-import jalview.api.AlignCalcWorkerI;
import jalview.api.AlignViewportI;
import jalview.api.AlignmentViewPanel;
import jalview.datamodel.AlignmentAnnotation;
import java.util.ArrayList;
import java.util.List;
-public class ConservationThread extends AlignCalcWorker implements
- AlignCalcWorkerI
+public class ConservationThread extends AlignCalcWorker
{
private int ConsPercGaps = 25; // JBPNote : This should be a configurable
--- /dev/null
+package jalview.workers;
+
+import jalview.datamodel.SequenceFeature;
+
+import java.util.List;
+
+/**
+ * An interface for a type that returns counts of any value of interest at a
+ * sequence position that can be determined from the sequence character and any
+ * features present at that position
+ *
+ */
+public interface FeatureCounterI
+{
+ /**
+ * Returns a count of some property of interest, for example
+ * <ul>
+ * <li>the number of variant features at the position</li>
+ * <li>the number of Cath features of status 'True Positive'</li>
+ * <li>1 if the residue is hydrophobic, else 0</li>
+ * <li>etc</li>
+ * </ul>
+ *
+ * @param residue
+ * the residue (or gap) at the position
+ * @param a
+ * list of any sequence features which include the position
+ */
+ int count(String residue, List<SequenceFeature> features);
+
+ /**
+ * Returns a name for the annotation that this is counting, for use as the
+ * displayed label
+ *
+ * @return
+ */
+ String getName();
+
+ /**
+ * Returns a description for the annotation, for display as a tooltip
+ *
+ * @return
+ */
+ String getDescription();
+
+ /**
+ * Returns the colour (as [red, green, blue] values in the range 0-255) to use
+ * for the minimum value on histogram bars. If this is different to
+ * getMaxColour(), then bars will have a graduated colour.
+ *
+ * @return
+ */
+ int[] getMinColour();
+
+ /**
+ * Returns the colour (as [red, green, blue] values in the range 0-255) to use
+ * for the maximum value on histogram bars. If this is the same as
+ * getMinColour(), then bars will have a single colour (not graduated).
+ *
+ * @return
+ */
+ int[] getMaxColour();
+}
package jalview.workers;
import jalview.analysis.StructureFrequency;
-import jalview.api.AlignCalcWorkerI;
import jalview.api.AlignViewportI;
import jalview.api.AlignmentViewPanel;
import jalview.datamodel.AlignmentAnnotation;
import java.util.Hashtable;
-public class StrucConsensusThread extends AlignCalcWorker implements
- AlignCalcWorkerI
+public class StrucConsensusThread extends AlignCalcWorker
{
public StrucConsensusThread(AlignViewportI alignViewport,
AlignmentViewPanel alignPanel)
String[] defdb = null, otherdb = sfetcher
.getDbInstances(jalview.ws.dbsources.das.datamodel.DasSequenceSource.class);
List<DbSourceProxy> selsources = new ArrayList<DbSourceProxy>();
- Vector dasselsrc = (featureSettings != null) ? featureSettings
+ Vector<jalviewSourceI> dasselsrc = (featureSettings != null) ? featureSettings
.getSelectedSources() : new jalview.gui.DasSourceBrowser()
.getSelectedSources();
Enumeration<jalviewSourceI> en = dasselsrc.elements();
}
/**
+ * Constructor with only sequences provided
+ *
+ * @param sequences
+ */
+ public DBRefFetcher(SequenceI[] sequences)
+ {
+ this(sequences, null, null, null, false);
+ }
+
+ /**
* Add a listener to be notified when sequence fetching is complete
*
* @param l
import jalview.bin.Cache;
import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.DBRefSource;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.gui.AlignFrame;
import jalview.gui.Desktop;
import jalview.gui.FeatureSettings;
+import jalview.util.DBRefUtils;
import jalview.util.MessageManager;
import jalview.util.UrlLink;
import jalview.ws.dbsources.das.api.DasSourceRegistryI;
{
for (int j = 0; j < dbref.length; j++)
{
- if (dbref[j].getSource().equals(
- jalview.datamodel.DBRefSource.UNIPROT))
+ if (dbref[j].getSource().equals(DBRefSource.UNIPROT))
{
refCount++;
break;
public void run()
{
running = true;
- boolean isNuclueotide = af.getViewport().getAlignment()
+ boolean isNucleotide = af.getViewport().getAlignment()
.isNucleotide();
- new jalview.ws.DBRefFetcher(sequences, af, null, af.featureSettings,
- isNuclueotide).fetchDBRefs(true);
+ new DBRefFetcher(sequences, af, null, af.featureSettings,
+ isNucleotide).fetchDBRefs(true);
startFetching();
setGuiFetchComplete();
{
jalviewSourceI[] sources = sourceRegistry.getSources().toArray(
new jalviewSourceI[0]);
- String active = jalview.bin.Cache.getDefault("DAS_ACTIVE_SOURCE",
+ String active = Cache.getDefault("DAS_ACTIVE_SOURCE",
"uniprot");
StringTokenizer st = new StringTokenizer(active, "\t");
selectedSources = new Vector();
{
return null;
}
- DBRefEntry[] uprefs = jalview.util.DBRefUtils.selectRefs(
+ DBRefEntry[] uprefs = DBRefUtils.selectRefs(
seq.getDBRefs(), new String[] {
// jalview.datamodel.DBRefSource.PDB,
- jalview.datamodel.DBRefSource.UNIPROT,
+ DBRefSource.UNIPROT,
// jalview.datamodel.DBRefSource.EMBL - not tested on any EMBL coord
// sys sources
});
for (COORDINATES csys : dasSource.getVersion().getCOORDINATES())
{
- if (jalview.util.DBRefUtils.isDasCoordinateSystem(
+ if (DBRefUtils.isDasCoordinateSystem(
csys.getAuthority(), uprefs[j]))
{
debug("Launched fetcher for coordinate system "
addDBRefSourceImpl(Pdb.class);
addDBRefSourceImpl(PfamFull.class);
addDBRefSourceImpl(PfamSeed.class);
- // ensures Seed alignment is 'default' for PFAM
- addDBRefSourceImpl(RfamFull.class);
addDBRefSourceImpl(RfamSeed.class);
if (addDas)
{
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.ws.dbsources;
-
-import jalview.util.MessageManager;
-import jalview.ws.uimodel.PDBRestRequest;
-import jalview.ws.uimodel.PDBRestResponse;
-import jalview.ws.uimodel.PDBRestResponse.PDBResponseSummary;
-
-import java.util.ArrayList;
-import java.util.Collection;
-import java.util.Iterator;
-import java.util.List;
-
-import javax.ws.rs.core.MediaType;
-
-import org.json.simple.JSONArray;
-import org.json.simple.JSONObject;
-import org.json.simple.parser.JSONParser;
-import org.json.simple.parser.ParseException;
-
-import com.sun.jersey.api.client.Client;
-import com.sun.jersey.api.client.ClientResponse;
-import com.sun.jersey.api.client.WebResource;
-import com.sun.jersey.api.client.config.ClientConfig;
-import com.sun.jersey.api.client.config.DefaultClientConfig;
-
-/**
- * A rest client for querying the Search endpoing of the PDB REST API
- *
- * @author tcnofoegbu
- *
- */
-public class PDBRestClient
-{
- public static final String PDB_SEARCH_ENDPOINT = "http://www.ebi.ac.uk/pdbe/search/pdb/select?";
-
- private static int DEFAULT_RESPONSE_SIZE = 200;
-
- /**
- * Takes a PDBRestRequest object and returns a response upon execution
- *
- * @param pdbRestRequest
- * the PDBRestRequest instance to be processed
- * @return the pdbResponse object for the given request
- * @throws Exception
- */
- public PDBRestResponse executeRequest(PDBRestRequest pdbRestRequest)
- throws Exception
- {
- try
- {
- ClientConfig clientConfig = new DefaultClientConfig();
- Client client = Client.create(clientConfig);
-
- String wantedFields = getPDBDocFieldsAsCommaDelimitedString(pdbRestRequest
- .getWantedFields());
- int responseSize = (pdbRestRequest.getResponseSize() == 0) ? DEFAULT_RESPONSE_SIZE
- : pdbRestRequest.getResponseSize();
- String sortParam = null;
- if (pdbRestRequest.getFieldToSortBy() == null
- || pdbRestRequest.getFieldToSortBy().trim().isEmpty())
- {
- sortParam = "";
- }
- else
- {
- if (pdbRestRequest.getFieldToSortBy()
- .equalsIgnoreCase("Resolution"))
- {
- sortParam = pdbRestRequest.getFieldToSortBy()
- + (pdbRestRequest.isAscending() ? " asc" : " desc");
- }
- else
- {
- sortParam = pdbRestRequest.getFieldToSortBy()
- + (pdbRestRequest.isAscending() ? " desc" : " asc");
- }
- }
-
- String facetPivot = (pdbRestRequest.getFacetPivot() == null || pdbRestRequest
- .getFacetPivot().isEmpty()) ? "" : pdbRestRequest
- .getFacetPivot();
- String facetPivotMinCount = String.valueOf(pdbRestRequest
- .getFacetPivotMinCount());
-
- // Build request parameters for the REST Request
- WebResource webResource = null;
- if (pdbRestRequest.isFacet())
- {
- webResource = client.resource(PDB_SEARCH_ENDPOINT)
- .queryParam("wt", "json").queryParam("fl", wantedFields)
- .queryParam("rows", String.valueOf(responseSize))
- .queryParam("q", pdbRestRequest.getQuery())
- .queryParam("sort", sortParam).queryParam("facet", "true")
- .queryParam("facet.pivot", facetPivot)
- .queryParam("facet.pivot.mincount", facetPivotMinCount);
- }
- else
- {
- webResource = client.resource(PDB_SEARCH_ENDPOINT)
- .queryParam("wt", "json").queryParam("fl", wantedFields)
- .queryParam("rows", String.valueOf(responseSize))
- .queryParam("q", pdbRestRequest.getQuery())
- .queryParam("sort", sortParam);
- }
- // Execute the REST request
- ClientResponse clientResponse = webResource.accept(
- MediaType.APPLICATION_JSON).get(ClientResponse.class);
-
- // Get the JSON string from the response object
- String responseString = clientResponse.getEntity(String.class);
- // System.out.println("query >>>>>>> " + pdbRestRequest.toString());
-
- // Check the response status and report exception if one occurs
- if (clientResponse.getStatus() != 200)
- {
- String errorMessage = "";
- if (clientResponse.getStatus() == 400)
- {
- errorMessage = parseJsonExceptionString(responseString);
- throw new Exception(errorMessage);
- }
- else
- {
- errorMessage = getMessageByHTTPStatusCode(clientResponse
- .getStatus());
- throw new Exception(errorMessage);
- }
- }
-
- // Make redundant objects eligible for garbage collection to conserve
- // memory
- clientResponse = null;
- client = null;
-
- // Process the response and return the result to the caller.
- return parsePDBJsonResponse(responseString, pdbRestRequest);
- } catch (Exception e)
- {
- String exceptionMsg = e.getMessage();
- if (exceptionMsg.contains("SocketException"))
- {
- // No internet connection
- throw new Exception(
- MessageManager
- .getString("exception.unable_to_detect_internet_connection"));
- }
- else if (exceptionMsg.contains("UnknownHostException"))
- {
- // The server 'www.ebi.ac.uk' is unreachable
- throw new Exception(
- MessageManager
- .getString("exception.pdb_server_unreachable"));
- }
- else
- {
- throw e;
- }
- }
- }
-
- public String getMessageByHTTPStatusCode(int code)
- {
- String message = "";
- switch (code)
- {
- case 410:
- message = MessageManager
- .getString("exception.pdb_rest_service_no_longer_available");
- break;
- case 403:
- case 404:
- message = MessageManager.getString("exception.resource_not_be_found");
- break;
- case 408:
- case 409:
- case 500:
- case 501:
- case 502:
- case 503:
- case 504:
- case 505:
- message = MessageManager.getString("exception.pdb_server_error");
- break;
-
- default:
- break;
- }
- return message;
- }
-
- /**
- * Process error response from PDB server if/when one occurs.
- *
- * @param jsonResponse
- * the JSON string containing error message from the server
- * @return the processed error message from the JSON string
- */
- public static String parseJsonExceptionString(String jsonErrorResponse)
- {
- StringBuilder errorMessage = new StringBuilder(
- "\n============= PDB Rest Client RunTime error =============\n");
-
- try
- {
- JSONParser jsonParser = new JSONParser();
- JSONObject jsonObj = (JSONObject) jsonParser.parse(jsonErrorResponse);
- JSONObject errorResponse = (JSONObject) jsonObj.get("error");
-
- JSONObject responseHeader = (JSONObject) jsonObj
- .get("responseHeader");
- JSONObject paramsObj = (JSONObject) responseHeader.get("params");
- String status = responseHeader.get("status").toString();
- String message = errorResponse.get("msg").toString();
- String query = paramsObj.get("q").toString();
- String fl = paramsObj.get("fl").toString();
-
- errorMessage.append("Status: ").append(status).append("\n");
- errorMessage.append("Message: ").append(message).append("\n");
- errorMessage.append("query: ").append(query).append("\n");
- errorMessage.append("fl: ").append(fl).append("\n");
-
- } catch (ParseException e)
- {
- e.printStackTrace();
- }
- return errorMessage.toString();
- }
-
- /**
- * Parses the JSON response string from PDB REST API. The response is dynamic
- * hence, only fields specifically requested for in the 'wantedFields'
- * parameter is fetched/processed
- *
- * @param pdbJsonResponseString
- * the JSON string to be parsed
- * @param pdbRestRequest
- * the request object which contains parameters used to process the
- * JSON string
- * @return
- */
- @SuppressWarnings("unchecked")
- public static PDBRestResponse parsePDBJsonResponse(
- String pdbJsonResponseString, PDBRestRequest pdbRestRequest)
- {
- PDBRestResponse searchResult = new PDBRestResponse();
- List<PDBResponseSummary> result = null;
- try
- {
- JSONParser jsonParser = new JSONParser();
- JSONObject jsonObj = (JSONObject) jsonParser
- .parse(pdbJsonResponseString);
-
- JSONObject pdbResponse = (JSONObject) jsonObj.get("response");
- String queryTime = ((JSONObject) jsonObj.get("responseHeader")).get(
- "QTime").toString();
- int numFound = Integer
- .valueOf(pdbResponse.get("numFound").toString());
- if (numFound > 0)
- {
- result = new ArrayList<PDBResponseSummary>();
- JSONArray docs = (JSONArray) pdbResponse.get("docs");
- for (Iterator<JSONObject> docIter = docs.iterator(); docIter
- .hasNext();)
- {
- JSONObject doc = docIter.next();
- result.add(searchResult.new PDBResponseSummary(doc,
- pdbRestRequest));
- }
- searchResult.setNumberOfItemsFound(numFound);
- searchResult.setResponseTime(queryTime);
- searchResult.setSearchSummary(result);
- }
- } catch (ParseException e)
- {
- e.printStackTrace();
- }
- return searchResult;
- }
-
- /**
- * Takes a collection of PDBDocField and converts its 'code' Field values into
- * a comma delimited string.
- *
- * @param pdbDocfields
- * the collection of PDBDocField to process
- * @return the comma delimited string from the pdbDocFields collection
- */
- public static String getPDBDocFieldsAsCommaDelimitedString(
- Collection<PDBDocField> pdbDocfields)
- {
- String result = "";
- if (pdbDocfields != null && !pdbDocfields.isEmpty())
- {
- StringBuilder returnedFields = new StringBuilder();
- for (PDBDocField field : pdbDocfields)
- {
- returnedFields.append(",").append(field.getCode());
- }
- returnedFields.deleteCharAt(0);
- result = returnedFields.toString();
- }
- return result;
- }
-
- /**
- * Determines the column index for 'PDB Id' Fields in the dynamic summary
- * table. The PDB Id serves as a unique identifier for a given row in the
- * summary table
- *
- * @param wantedFields
- * the available table columns in no particular order
- * @return the pdb id field column index
- */
- public static int getPDBIdColumIndex(
- Collection<PDBDocField> wantedFields, boolean hasRefSeq)
- {
-
- // If a reference sequence is attached then start counting from 1 else
- // start from zero
- int pdbFieldIndexCounter = hasRefSeq ? 1 : 0;
-
- for (PDBDocField field : wantedFields)
- {
- if (field.equals(PDBDocField.PDB_ID))
- {
- break; // Once PDB Id index is determined exit iteration
- }
- ++pdbFieldIndexCounter;
- }
- return pdbFieldIndexCounter;
- }
-
- public static PDBDocField getPDBDocFieldByCode(String fieldCode)
- throws Exception
- {
- for (PDBDocField curPDBDocField : PDBDocField.values())
- {
- if (curPDBDocField.getCode().equalsIgnoreCase(fieldCode))
- {
- return curPDBDocField;
- }
- }
- throw new Exception("PDB doc Field not found!");
- }
-
- /**
- * This enum represents the fields available in the PDB JSON response
- *
- */
- public enum PDBDocField
- {
- PDB_ID("PDB Id", "pdb_id", Group.CROSS_REFS), TITLE(
- "Title",
- "title", Group.MISCELLENOUS),
- MOLECULE_NAME("Molecule",
- "molecule_name",
- Group.NAMES_AND_TAXONOMY), MOLECULE_TYPE(
- "Molecule Type", "molecule_type", Group.NAMES_AND_TAXONOMY), MOLECULE_SEQUENCE(
- "Sequence", "molecule_sequence", Group.MISCELLENOUS), PFAM_ACCESSION(
- "PFAM Accession", "pfam_accession",
- Group.CROSS_REFS), PFAM_NAME(
- "PFAM Name", "pfam_name", Group.NAMES_AND_TAXONOMY), INTERPRO_NAME(
- "InterPro Name", "interpro_name", Group.NAMES_AND_TAXONOMY), INTERPRO_ACCESSION(
- "InterPro Accession", "interpro_accession",
- Group.CROSS_REFS), UNIPROT_ID("UniProt Id",
- "uniprot_id", Group.CROSS_REFS), UNIPROT_ACCESSION(
- "UniProt Accession", "uniprot_accession",
- Group.CROSS_REFS),
-
- UNIPROT_COVERAGE(
- "UniProt Coverage", "uniprot_coverage", Group.MISCELLENOUS), UNIPROT_FEATURES(
- "Uniprot Features", "uniprot_features", Group.MISCELLENOUS), R_FACTOR(
-"R Factor",
- "r_factor", Group.QUALITY_MEASURES), RESOLUTION("Resolution",
- "resolution", Group.QUALITY_MEASURES), DATA_QUALITY(
- "Data Quality", "data_quality", Group.QUALITY_MEASURES), OVERALL_QUALITY(
- "Overall Quality", "overall_quality", Group.QUALITY_MEASURES), POLYMER_COUNT(
- "Number of Polymers", "number_of_polymers", Group.MISCELLENOUS), PROTEIN_CHAIN_COUNT(
- "Number of Protein Chains", "number_of_protein_chains",
- Group.MISCELLENOUS), BOUND_MOLECULE_COUNT(
- "Number of Bound Molecule", "number_of_bound_molecules",
- Group.MISCELLENOUS), POLYMER_RESIDUE_COUNT(
- "Number of Polymer Residue", "number_of_polymer_residues",
- Group.MISCELLENOUS), GENUS("GENUS", "genus",
- Group.NAMES_AND_TAXONOMY), GENE_NAME("Gene Name", "gene_name",
- Group.NAMES_AND_TAXONOMY), EXPERIMENTAL_METHOD(
- "Experimental Method", "experimental_method",
- Group.PROCEDURE_AND_SOFTWARE), GO_ID("GO Id", "go_id",
- Group.CROSS_REFS), ASSEMBLY_ID("Assembly Id",
- "assembly_id", Group.CROSS_REFS), ASSEMBLY_FORM(
- "Assembly Form", "assembly_form", Group.MISCELLENOUS), ASSEMBLY_TYPE(
- "Assembly Type", "assembly_type", Group.MISCELLENOUS), SPACE_GROUP(
- "Space Group", "spacegroup", Group.MISCELLENOUS), CATH_CODE(
- "Cath Code", "cath_code", Group.CROSS_REFS), TAX_ID(
- "Tax Id", "tax_id", Group.CROSS_REFS), TAX_QUERY(
- "Tax Query", "tax_query", Group.CROSS_REFS), INTERACTING_ENTITY_ID(
- "Interacting Entity Id", "interacting_entity_id",
- Group.CROSS_REFS), INTERACTING_MOLECULES(
- "Interacting Molecules", "interacting_molecules",
- Group.MISCELLENOUS), PUBMED_ID("Pubmed Id", "pubmed_id",
- Group.CROSS_REFS), STATUS("Status", "status",
- Group.MISCELLENOUS), MODEL_QUALITY("Model Quality",
- "model_quality", Group.QUALITY_MEASURES), PIVOT_RESOLUTION(
- "Pivot Resolution", "pivot_resolution", Group.QUALITY_MEASURES), DATA_REDUCTION_SOFTWARE(
- "Data reduction software", "data_reduction_software",
- Group.PROCEDURE_AND_SOFTWARE), MAX_OBSERVED_RES(
- "Max observed residues",
- "max_observed_residues", Group.MISCELLENOUS), ORG_SCI_NAME(
- "Organism scientific name", "organism_scientific_name",
- Group.NAMES_AND_TAXONOMY), SUPER_KINGDOM("Super kingdom",
- "superkingdom", Group.NAMES_AND_TAXONOMY), RANK("Rank", "rank",
- Group.NAMES_AND_TAXONOMY), CRYSTALLISATION_PH(
- "Crystallisation Ph",
- "crystallisation_ph", Group.MISCELLENOUS), BIOLOGICAL_FUNCTION(
- "Biological Function", "biological_function",
- Group.MISCELLENOUS), BIOLOGICAL_PROCESS("Biological Process",
- "biological_process", Group.MISCELLENOUS), BIOLOGICAL_CELL_COMPONENT(
- "Biological Cell Component", "biological_cell_component",
- Group.MISCELLENOUS), COMPOUND_NAME("Compound Name",
- "compound_name", Group.NAMES_AND_TAXONOMY), COMPOUND_ID(
- "Compound Id", "compound_id", Group.CROSS_REFS), COMPOUND_WEIGHT(
- "Compound Weight", "compound_weight", Group.MISCELLENOUS), COMPOUND_SYSTEMATIC_NAME(
- "Compound Systematic Name", "compound_systematic_name",
- Group.NAMES_AND_TAXONOMY), INTERACTING_LIG(
- "Interacting Ligands",
- "interacting_ligands", Group.MISCELLENOUS), JOURNAL("Journal",
- "journal", Group.MISCELLENOUS), ALL_AUTHORS("All Authors",
- "all_authors", Group.MISCELLENOUS), EXPERIMENTAL_DATA_AVAILABLE(
- "Experiment Data Available", "experiment_data_available",
- Group.MISCELLENOUS), DIFFRACTION_PROTOCOL(
- "Diffraction Protocol", "diffraction_protocol",
- Group.PROCEDURE_AND_SOFTWARE), REFINEMENT_SOFTWARE(
- "Refinement Software", "refinement_software",
- Group.PROCEDURE_AND_SOFTWARE), STRUCTURE_DETERMINATION_METHOD(
- "Structure Determination Method",
- "structure_determination_method", Group.PROCEDURE_AND_SOFTWARE), SYNCHROTON_SITE(
- "Synchrotron Site", "synchrotron_site", Group.MISCELLENOUS), SAMPLE_PREP_METHOD(
- "Sample Preparation Method", "sample_preparation_method",
- Group.PROCEDURE_AND_SOFTWARE), ENTRY_AUTHORS("Entry Authors",
- "entry_authors", Group.MISCELLENOUS), CITATION_TITLE(
- "Citation Title", "citation_title", Group.MISCELLENOUS), STRUCTURE_SOLUTION_SOFTWARE(
- "Structure Solution Software", "structure_solution_software",
- Group.PROCEDURE_AND_SOFTWARE), ENTRY_ENTITY("Entry Entity",
- "entry_entity", Group.MISCELLENOUS), R_FREE("R Free", "r_free",
- Group.QUALITY_MEASURES), NO_OF_POLYMER_ENTITIES(
- "Number of Polymer Entities", "number_of_polymer_entities",
- Group.MISCELLENOUS), NO_OF_BOUND_ENTITIES(
- "Number of Bound Entities", "number_of_bound_entities",
- Group.MISCELLENOUS), CRYSTALLISATION_RESERVOIR(
- "Crystallisation Reservoir", "crystallisation_reservoir",
- Group.MISCELLENOUS), DATA_SCALING_SW("Data Scalling Software",
- "data_scaling_software", Group.PROCEDURE_AND_SOFTWARE), DETECTOR(
- "Detector", "detector", Group.MISCELLENOUS), DETECTOR_TYPE(
- "Detector Type", "detector_type", Group.MISCELLENOUS), MODIFIED_RESIDUE_FLAG(
- "Modified Residue Flag", "modified_residue_flag",
- Group.MISCELLENOUS), NUMBER_OF_COPIES("Number of Copies",
- "number_of_copies", Group.MISCELLENOUS), STRUCT_ASYM_ID(
- "Struc Asym Id", "struct_asym_id",
- Group.CROSS_REFS), HOMOLOGUS_PDB_ENTITY_ID(
- "Homologus PDB Entity Id", "homologus_pdb_entity_id",
- Group.CROSS_REFS), MOLECULE_SYNONYM(
- "Molecule Synonym",
- "molecule_synonym", Group.MISCELLENOUS), DEPOSITION_SITE(
- "Deposition Site", "deposition_site", Group.MISCELLENOUS), SYNCHROTRON_BEAMLINE(
- "Synchrotron Beamline", "synchrotron_beamline",
- Group.MISCELLENOUS), ENTITY_ID("Entity Id", "entity_id",
- Group.CROSS_REFS), BEAM_SOURCE_NAME(
- "Beam Source Name",
- "beam_source_name",
- Group.NAMES_AND_TAXONOMY), PROCESSING_SITE(
- "Processing Site", "processing_site", Group.MISCELLENOUS), ENTITY_WEIGHT(
- "Entity Weight", "entity_weight", Group.MISCELLENOUS), VERSION(
- "Version", "_version_", Group.MISCELLENOUS), ALL("ALL", "text",
- Group.MISCELLENOUS);
-
- public enum Group
- {
- DATE_OF("Date Of", 5), NAMES_AND_TAXONOMY("Names & Taxonomy", 3),
- MISCELLENOUS("Miscellenous", 6), QUALITY_MEASURES("Quality Measures",
- 1), CROSS_REFS("Cross References", 2),
- PROCEDURE_AND_SOFTWARE("Procedures & Softwares", 4);
-
- Group(String name, int sortOrder)
- {
- this.name = name;
- this.sortOrder = sortOrder;
- }
-
- private String name;
-
- private int sortOrder;
-
- public String getName()
- {
- return this.name;
- }
-
- public int getSortOrder()
- {
- return sortOrder;
- }
-
- @Override
- public String toString()
- {
- return this.name;
- }
- };
- private String name;
-
- private String code;
-
- private Group group;
-
- PDBDocField(String name, String code, Group group)
- {
- this.name = name;
- this.code = code;
- this.group = group;
- }
-
- public String getName()
- {
- return name;
- }
-
- public String getCode()
- {
- return code;
- }
-
- public Group getGroup()
- {
- return group;
- }
-
- @Override
- public String toString()
- {
- return name;
- }
- }
-}
public static final String FEATURE_RES_NUM = "RESNUM";
- private static String currentDefaultFomart = DBRefSource.PDB;
+ private static String currentDefaultFormat = DBRefSource.PDB;
/*
* (non-Javadoc)
stopQuery();
return null;
}
- String ext = getCurrentDefaultFomart().equalsIgnoreCase("mmcif") ? ".cif"
+ String ext = getCurrentDefaultFormat().equalsIgnoreCase("mmcif") ? ".cif"
: ".xml";
EBIFetchClient ebi = new EBIFetchClient();
file = ebi.fetchDataAsFile("pdb:" + id,
- getCurrentDefaultFomart().toLowerCase(), "raw", ext)
+ getCurrentDefaultFormat().toLowerCase(), "raw", ext)
.getAbsolutePath();
stopQuery();
if (file == null)
pdbAlignment = new FormatAdapter().readFile(file,
jalview.io.AppletFormatAdapter.FILE,
- getCurrentDefaultFomart());
+ getCurrentDefaultFormat());
if (pdbAlignment != null)
{
List<SequenceI> toremove = new ArrayList<SequenceI>();
return 0;
}
- public static String getCurrentDefaultFomart()
+ public static String getCurrentDefaultFormat()
{
- return currentDefaultFomart;
+ return currentDefaultFormat;
}
- public static void setCurrentDefaultFomart(String currentDefaultFomart)
+ public static void setCurrentDefaultFormat(String currentDefaultFomart)
{
- Pdb.currentDefaultFomart = currentDefaultFomart;
+ Pdb.currentDefaultFormat = currentDefaultFomart;
}
/**
@Override
protected String getXFAMURL()
{
- return "http://pfam.sanger.ac.uk/family/alignment/download/format?alnType=full&format=stockholm&order=t&case=l&gaps=default&entry=";
+ return "http://pfam.xfam.org/family/alignment/download/format?alnType=full&format=stockholm&order=t&case=l&gaps=default&entry=";
}
/*
@Override
protected String getXFAMURL()
{
- return "http://pfam.sanger.ac.uk/family/alignment/download/format?alnType=seed&format=stockholm&order=t&case=l&gaps=default&entry=";
+ return "http://pfam.xfam.org/family/alignment/download/format?alnType=seed&format=stockholm&order=t&case=l&gaps=default&entry=";
}
/*
@Override
protected String getXFAMURL()
{
- return "http://rfam.sanger.ac.uk/family/alignment/download/format?alnType=full&nseLabels=0&format=stockholm&acc=";
+ return "http://rfam.xfam.org/family/alignment/download/format?alnType=full&nseLabels=0&format=stockholm&acc=";
+
}
/*
@Override
protected String getXFAMURL()
{
- return "http://rfam.sanger.ac.uk/family/alignment/download/format?alnType=seed&nseLabels=0&format=stockholm&acc=";
+ return "http://rfam.xfam.org/family/";
// Janelia Farms url
// "http://rfam.janelia.org/cgi-bin/getalignment?type=seed&fmt=stockholm&acc=";
}
+ @Override
+ public String getXFAMURLSUFFIX()
+ {
+ return "/alignment";
+ }
/*
* (non-Javadoc)
*
startQuery();
// TODO: trap HTTP 404 exceptions and return null
AlignmentI rcds = new FormatAdapter().readFile(getXFAMURL()
- + queries.trim().toUpperCase(), FormatAdapter.URL, "STH");
+ + queries.trim().toUpperCase() + getXFAMURLSUFFIX(),
+ jalview.io.FormatAdapter.URL,
+ "STH");
for (int s = 0, sNum = rcds.getHeight(); s < sNum; s++)
{
rcds.getSequenceAt(s).addDBRef(new DBRefEntry(getXfamSource(),
return true;
}
+ /**
+ * default suffix to append the retrieval URL for this source.
+ *
+ * @return "" for most Xfam sources
+ */
+ public String getXFAMURLSUFFIX()
+ {
+ return "";
+ }
+
}
*/
package jalview.ws.jws2;
-import jalview.api.AlignCalcWorkerI;
import jalview.bin.Cache;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.GraphLine;
import compbio.data.sequence.ScoreManager.ScoreHolder;
import compbio.metadata.Argument;
-public class AADisorderClient extends JabawsCalcWorker implements
- AlignCalcWorkerI
+public class AADisorderClient extends JabawsCalcWorker
{
private static final String THRESHOLD = "THRESHOLD";
*/
package jalview.ws.jws2;
-import jalview.api.AlignCalcWorkerI;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.Annotation;
import jalview.gui.AlignFrame;
import compbio.metadata.Argument;
public class JPred301Client extends JabawsMsaInterfaceAlignCalcWorker
- implements AlignCalcWorkerI
{
-
/**
*
* @return default args for this service when run as dynamic web service
return (seqs.size() > 1);
}
+ @Override
public String getServiceActionText()
{
return "calculating consensus secondary structure prediction using JPred service";
* update the consensus annotation from the sequence profile data using
* current visualization settings.
*/
+ @Override
public void updateResultAnnotation(boolean immediate)
{
if (immediate || !calcMan.isWorking(this) && msascoreset != null)
});
wsmenu.add(aaConEnabled);
final JMenuItem modifyParams = new JMenuItem(aaui.getAAeditSettings());
- modifyParams
- .setToolTipText("<html><p>"
- + JvSwingUtils.wrapTooltip(false,
- aaui.getAAeditSettingsTooltip() + "</p>")
- + "</html>");
+ modifyParams.setToolTipText(JvSwingUtils.wrapTooltip(true,
+ aaui.getAAeditSettingsTooltip()));
modifyParams.addActionListener(new ActionListener()
{
return (WebServiceName.indexOf("lustal") > -1); // cheat!
}
+ @Override
public void attachWSMenuEntry(JMenu rmsawsmenu,
final Jws2Instance service, final AlignFrame alignFrame)
{
method.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent e)
{
AlignmentView msa = alignFrame.gatherSequencesForAlignment();
method.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent e)
{
AlignmentView msa = alignFrame.gatherSequencesForAlignment();
}
});
- methodR.setToolTipText(JvSwingUtils.wrapTooltip(
+ String tooltip = JvSwingUtils.wrapTooltip(
true,
- "<p><strong>"
+ "<strong>"
+ (preset.isModifiable() ? MessageManager
.getString("label.user_preset")
: MessageManager
.getString("label.service_preset"))
- + "</strong><br/>" + preset.getDescription()
- + "</p>"));
+ + "</strong><br/>"
+ + preset.getDescription());
+ methodR.setToolTipText(tooltip);
methodR.addActionListener(new ActionListener()
{
+ @Override
public void actionPerformed(ActionEvent e)
{
AlignmentView msa = alignFrame
*/
package jalview.ws.jws2;
-import jalview.api.AlignCalcWorkerI;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.Annotation;
import jalview.gui.AlignFrame;
*
*/
-public class RNAalifoldClient extends JabawsCalcWorker implements
- AlignCalcWorkerI
+public class RNAalifoldClient extends JabawsCalcWorker
{
String methodName;
initViewportParams();
}
+ @Override
public String getCalcId()
{
return CALC_ID;
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2)
- * Copyright (C) 2014 The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-
-package jalview.ws.uimodel;
-
-import jalview.datamodel.SequenceI;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField.Group;
-
-import java.util.Collection;
-import java.util.Objects;
-
-import javax.swing.JTable;
-import javax.swing.table.DefaultTableModel;
-
-import org.json.simple.JSONObject;
-
-/**
- * Represents the response model produced by the PDBRestClient upon successful
- * execution of a given request
- *
- * @author tcnofoegbu
- *
- */
-public class PDBRestResponse
-{
- private int numberOfItemsFound;
-
- private String responseTime;
-
- private Collection<PDBResponseSummary> searchSummary;
-
- public int getNumberOfItemsFound()
- {
- return numberOfItemsFound;
- }
-
- public void setNumberOfItemsFound(int itemFound)
- {
- this.numberOfItemsFound = itemFound;
- }
-
- public String getResponseTime()
- {
- return responseTime;
- }
-
- public void setResponseTime(String responseTime)
- {
- this.responseTime = responseTime;
- }
-
- public Collection<PDBResponseSummary> getSearchSummary()
- {
- return searchSummary;
- }
-
- public void setSearchSummary(Collection<PDBResponseSummary> searchSummary)
- {
- this.searchSummary = searchSummary;
- }
-
- /**
- * Convenience method to obtain a Table model for a given summary List based
- * on the request parameters
- *
- * @param request
- * the PDBRestRequest object which holds useful information for
- * creating a table model
- * @param summariesList
- * the summary list which contains the data for populating the
- * table's rows
- * @return the table model which was dynamically generated
- */
- public static DefaultTableModel getTableModel(PDBRestRequest request,
- Collection<PDBResponseSummary> summariesList)
- {
- final PDBDocField[] cols = request.getWantedFields().toArray(
- new PDBDocField[0]);
- final int colOffset = request.getAssociatedSequence() == null ? 0 : 1;
- DefaultTableModel tableModel = new DefaultTableModel()
- {
- @Override
- public boolean isCellEditable(int row, int column)
- {
- return false;
- }
-
- @Override
- public Class<?> getColumnClass(int columnIndex)
- {
- if (colOffset == 1 && columnIndex == 0)
- {
- return String.class;
- }
- if (cols[columnIndex - colOffset].getGroup().getName()
- .equalsIgnoreCase(Group.QUALITY_MEASURES.getName()))
- {
- return Double.class;
- }
- return String.class;
- }
-
- };
- if (request.getAssociatedSequence() != null)
- {
- tableModel.addColumn("Ref Sequence"); // Create sequence column header if
- // exists in the request
- }
- for (PDBDocField field : request.getWantedFields())
- {
- tableModel.addColumn(field.getName()); // Create sequence column header if
- // exists in the request
- }
-
- for (PDBResponseSummary res : summariesList)
- {
- tableModel.addRow(res.getSummaryData()); // Populate table rows with
- // summary list
- }
-
- return tableModel;
- }
-
- /**
- * Model for a unique response summary
- *
- */
- public class PDBResponseSummary
- {
- private String pdbId;
-
- private Object[] summaryRowData;
-
- private SequenceI associatedSequence;
-
- public PDBResponseSummary(JSONObject pdbJsonDoc, PDBRestRequest request)
- {
- Collection<PDBDocField> diplayFields = request.getWantedFields();
- SequenceI associatedSeq = request.getAssociatedSequence();
- int colCounter = 0;
- summaryRowData = new Object[(associatedSeq != null) ? diplayFields
- .size() + 1 : diplayFields.size()];
- if (associatedSeq != null)
- {
- this.associatedSequence = associatedSeq;
- summaryRowData[0] = associatedSequence;
- colCounter = 1;
- }
-
- for (PDBDocField field : diplayFields)
- {
- String fieldData = (pdbJsonDoc.get(field.getCode()) == null) ? ""
- : pdbJsonDoc.get(field.getCode()).toString();
- if (field.equals(PDBDocField.PDB_ID))
- {
- this.pdbId = fieldData;
- summaryRowData[colCounter++] = this.pdbId;
- }
- else
- {
- if (field.getGroup().getName()
- .equals(Group.QUALITY_MEASURES.getName()))
- {
- try
- {
- if (fieldData == null || fieldData.isEmpty())
- {
- summaryRowData[colCounter++] = null;
- }
- else
- {
- Double value = Double.valueOf(fieldData);
- summaryRowData[colCounter++] = value;
- }
- } catch (Exception e)
- {
- e.printStackTrace();
- System.out.println("offending value:" + fieldData);
- summaryRowData[colCounter++] = 0.0;
- }
- }else{
- summaryRowData[colCounter++] = (fieldData == null || fieldData
- .isEmpty()) ? null : fieldData;
- }
- }
- }
- }
-
- public Object getPdbId()
- {
- return pdbId;
- }
-
- public void setPdbId(String pdbId)
- {
- this.pdbId = pdbId;
- }
-
- public Object[] getSummaryData()
- {
- return summaryRowData;
- }
-
- public void setSummaryData(Object[] summaryData)
- {
- this.summaryRowData = summaryData;
- }
-
- /**
- * Returns a string representation of this object;
- */
- @Override
- public String toString()
- {
- StringBuilder summaryFieldValues = new StringBuilder();
- for (Object summaryField : summaryRowData)
- {
- summaryFieldValues.append(
- summaryField == null ? " " : summaryField.toString())
- .append("\t");
- }
- return summaryFieldValues.toString();
- }
-
- /**
- * Returns hash code value for this object
- */
- @Override
- public int hashCode()
- {
- return Objects.hash(this.pdbId, this.toString());
- }
-
- /**
- * Indicates whether some object is equal to this one
- */
- @Override
- public boolean equals(Object that)
- {
- if (!(that instanceof PDBResponseSummary))
- {
- return false;
- }
- PDBResponseSummary another = (PDBResponseSummary) that;
- return this.toString().equals(another.toString());
- }
-
- }
-
- public static void configureTableColumn(JTable tbl_summary,
- Collection<PDBDocField> wantedFields)
- {
- for (PDBDocField wantedField : wantedFields)
- {
- try
- {
- if (wantedField.equals(PDBDocField.PDB_ID))
- {
- tbl_summary.getColumn(wantedField.getName()).setMinWidth(40);
- tbl_summary.getColumn(wantedField.getName()).setMaxWidth(60);
- tbl_summary.getColumn(wantedField.getName()).setPreferredWidth(45);
- }
- else if (wantedField.equals(PDBDocField.TITLE))
- {
- tbl_summary.getColumn(wantedField.getName()).setMinWidth(300);
- tbl_summary.getColumn(wantedField.getName()).setMaxWidth(1000);
- tbl_summary.getColumn(wantedField.getName()).setPreferredWidth(400);
- }
- else if (wantedField.getGroup() == Group.QUALITY_MEASURES)
- {
- tbl_summary.getColumn(wantedField.getName()).setMinWidth(50);
- tbl_summary.getColumn(wantedField.getName()).setMaxWidth(150);
- tbl_summary.getColumn(wantedField.getName()).setPreferredWidth(85);
- }
- else
- {
- tbl_summary.getColumn(wantedField.getName()).setMinWidth(50);
- tbl_summary.getColumn(wantedField.getName()).setMaxWidth(400);
- tbl_summary.getColumn(wantedField.getName()).setPreferredWidth(95);
- }
- } catch (Exception e)
- {
- e.printStackTrace();
- }
- }
- }
-}
import jalview.datamodel.SequenceI;
import jalview.schemes.ColourSchemeI;
import jalview.schemes.TaylorColourScheme;
+import jalview.structure.StructureViewSettings;
import java.awt.Color;
import java.util.Vector;
public void setUp()
{
System.out.println("setup");
+ StructureViewSettings.setShowSeqFeatures(true);
c = new PDBChain("1GAQ", "A");
}
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
+import jalview.analysis.AlignmentUtils.DnaVariant;
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentAnnotation;
/*
* first with no variants on dna
*/
- LinkedHashMap<Integer, String[][]> variantsMap = AlignmentUtils
+ LinkedHashMap<Integer, List<DnaVariant>[]> variantsMap = AlignmentUtils
.buildDnaVariantsMap(dna, map);
assertTrue(variantsMap.isEmpty());
- // single allele codon 1, on base 1
- SequenceFeature sf = new SequenceFeature("sequence_variant", "", 1, 1,
+ /*
+ * single allele codon 1, on base 1
+ */
+ SequenceFeature sf1 = new SequenceFeature("sequence_variant", "", 1, 1,
+ 0f, null);
+ sf1.setValue("alleles", "T");
+ sf1.setValue("ID", "sequence_variant:rs758803211");
+ dna.addSequenceFeature(sf1);
+
+ /*
+ * two alleles codon 2, on bases 2 and 3 (distinct variants)
+ */
+ SequenceFeature sf2 = new SequenceFeature("sequence_variant", "", 5, 5,
+ 0f, null);
+ sf2.setValue("alleles", "T");
+ sf2.setValue("ID", "sequence_variant:rs758803212");
+ dna.addSequenceFeature(sf2);
+ SequenceFeature sf3 = new SequenceFeature("sequence_variant", "", 6, 6,
+ 0f, null);
+ sf3.setValue("alleles", "G");
+ sf3.setValue("ID", "sequence_variant:rs758803213");
+ dna.addSequenceFeature(sf3);
+
+ /*
+ * two alleles codon 3, both on base 2 (one variant)
+ */
+ SequenceFeature sf4 = new SequenceFeature("sequence_variant", "", 8, 8,
0f, null);
- sf.setValue("alleles", "T");
- dna.addSequenceFeature(sf);
-
- // two alleles codon 2, on bases 2 and 3
- sf = new SequenceFeature("sequence_variant", "", 5, 5, 0f, null);
- sf.setValue("alleles", "T");
- dna.addSequenceFeature(sf);
- sf = new SequenceFeature("sequence_variant", "", 6, 6, 0f, null);
- sf.setValue("alleles", "G");
- dna.addSequenceFeature(sf);
-
- // two alleles codon 3, both on base 2
- sf = new SequenceFeature("sequence_variant", "", 8, 8, 0f, null);
- sf.setValue("alleles", "C, G");
- dna.addSequenceFeature(sf);
+ sf4.setValue("alleles", "C, G");
+ sf4.setValue("ID", "sequence_variant:rs758803214");
+ dna.addSequenceFeature(sf4);
// no alleles on codon 4
- // alleles on codon 5 on all 3 bases
- sf = new SequenceFeature("sequence_variant", "", 13, 13, 0f, null);
- sf.setValue("alleles", "C, G"); // (C duplicates given base value)
- dna.addSequenceFeature(sf);
- sf = new SequenceFeature("sequence_variant", "", 14, 14, 0f, null);
- sf.setValue("alleles", "g, a"); // should force to upper-case
- dna.addSequenceFeature(sf);
- sf = new SequenceFeature("sequence_variant", "", 15, 15, 0f, null);
- sf.setValue("alleles", "A, T");
- dna.addSequenceFeature(sf);
+ /*
+ * alleles on codon 5 on all 3 bases (distinct variants)
+ */
+ SequenceFeature sf5 = new SequenceFeature("sequence_variant", "", 13,
+ 13, 0f, null);
+ sf5.setValue("alleles", "C, G"); // (C duplicates given base value)
+ sf5.setValue("ID", "sequence_variant:rs758803215");
+ dna.addSequenceFeature(sf5);
+ SequenceFeature sf6 = new SequenceFeature("sequence_variant", "", 14,
+ 14, 0f, null);
+ sf6.setValue("alleles", "g, a"); // should force to upper-case
+ sf6.setValue("ID", "sequence_variant:rs758803216");
+ dna.addSequenceFeature(sf6);
+ SequenceFeature sf7 = new SequenceFeature("sequence_variant", "", 15,
+ 15, 0f, null);
+ sf7.setValue("alleles", "A, T");
+ sf7.setValue("ID", "sequence_variant:rs758803217");
+ dna.addSequenceFeature(sf7);
+
+ /*
+ * build map - expect variants on positions 1, 2, 3, 5
+ */
variantsMap = AlignmentUtils.buildDnaVariantsMap(dna, map);
assertEquals(4, variantsMap.size());
- assertTrue(Arrays.deepEquals(new String[][] { { "A", "T" }, { "T" },
- { "G" } }, variantsMap.get(1)));
- assertTrue(Arrays.deepEquals(new String[][] { { "A" }, { "A", "T" },
- { "A", "G" } }, variantsMap.get(2)));
- assertTrue(Arrays.deepEquals(new String[][] { { "T" },
- { "T", "C", "G" }, { "T" } }, variantsMap.get(3)));
- // duplicated bases are not removed here, handled in computePeptideVariants
- assertTrue(Arrays.deepEquals(new String[][] { { "C", "C", "G" },
- { "C", "G", "A" }, { "C", "A", "T" } }, variantsMap.get(5)));
+
+ /*
+ * protein residue 1: variant on codon (ATG) base 1, not on 2 or 3
+ */
+ List<DnaVariant>[] pep1Variants = variantsMap.get(1);
+ assertEquals(3, pep1Variants.length);
+ assertEquals(1, pep1Variants[0].size());
+ assertEquals("A", pep1Variants[0].get(0).base); // codon[1] base
+ assertSame(sf1, pep1Variants[0].get(0).variant); // codon[1] variant
+ assertEquals(1, pep1Variants[1].size());
+ assertEquals("T", pep1Variants[1].get(0).base); // codon[2] base
+ assertNull(pep1Variants[1].get(0).variant); // no variant here
+ assertEquals(1, pep1Variants[2].size());
+ assertEquals("G", pep1Variants[2].get(0).base); // codon[3] base
+ assertNull(pep1Variants[2].get(0).variant); // no variant here
+
+ /*
+ * protein residue 2: variants on codon (AAA) bases 2 and 3
+ */
+ List<DnaVariant>[] pep2Variants = variantsMap.get(2);
+ assertEquals(3, pep2Variants.length);
+ assertEquals(1, pep2Variants[0].size());
+ // codon[1] base recorded while processing variant on codon[2]
+ assertEquals("A", pep2Variants[0].get(0).base);
+ assertNull(pep2Variants[0].get(0).variant); // no variant here
+ // codon[2] base and variant:
+ assertEquals(1, pep2Variants[1].size());
+ assertEquals("A", pep2Variants[1].get(0).base);
+ assertSame(sf2, pep2Variants[1].get(0).variant);
+ // codon[3] base was recorded when processing codon[2] variant
+ // and then the variant for codon[3] added to it
+ assertEquals(1, pep2Variants[2].size());
+ assertEquals("A", pep2Variants[2].get(0).base);
+ assertSame(sf3, pep2Variants[2].get(0).variant);
+
+ /*
+ * protein residue 3: variants on codon (TTT) base 2 only
+ */
+ List<DnaVariant>[] pep3Variants = variantsMap.get(3);
+ assertEquals(3, pep3Variants.length);
+ assertEquals(1, pep3Variants[0].size());
+ assertEquals("T", pep3Variants[0].get(0).base); // codon[1] base
+ assertNull(pep3Variants[0].get(0).variant); // no variant here
+ assertEquals(1, pep3Variants[1].size());
+ assertEquals("T", pep3Variants[1].get(0).base); // codon[2] base
+ assertSame(sf4, pep3Variants[1].get(0).variant); // codon[2] variant
+ assertEquals(1, pep3Variants[2].size());
+ assertEquals("T", pep3Variants[2].get(0).base); // codon[3] base
+ assertNull(pep3Variants[2].get(0).variant); // no variant here
+
+ /*
+ * three variants on protein position 5
+ */
+ List<DnaVariant>[] pep5Variants = variantsMap.get(5);
+ assertEquals(3, pep5Variants.length);
+ assertEquals(1, pep5Variants[0].size());
+ assertEquals("C", pep5Variants[0].get(0).base); // codon[1] base
+ assertSame(sf5, pep5Variants[0].get(0).variant); // codon[1] variant
+ assertEquals(1, pep5Variants[1].size());
+ assertEquals("C", pep5Variants[1].get(0).base); // codon[2] base
+ assertSame(sf6, pep5Variants[1].get(0).variant); // codon[2] variant
+ assertEquals(1, pep5Variants[2].size());
+ assertEquals("C", pep5Variants[2].get(0).base); // codon[3] base
+ assertSame(sf7, pep5Variants[2].get(0).variant); // codon[3] variant
}
/**
@Test(groups = "Functional")
public void testComputePeptideVariants()
{
- String[][] codonVariants = new String[][] { { "A" }, { "G" }, { "T" } };
-
- /*
- * AGT codes for S - this is not included in the variants returned
- */
- List<String> variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[]", variants.toString());
-
- // S is reported if it differs from the current value (A):
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "A");
- assertEquals("[S]", variants.toString());
-
/*
- * synonymous variant is not reported
+ * scenario: AAATTTCCC codes for KFP, with variants
+ * GAA -> E
+ * CAA -> Q
+ * AAG synonymous
+ * AAT -> N
+ * TTC synonymous
+ * CAC,CGC -> H,R (as one variant)
*/
- codonVariants = new String[][] { { "A" }, { "G" }, { "C", "T" } };
- // AGC and AGT both code for S
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "s");
- assertEquals("[]", variants.toString());
-
+ SequenceI peptide = new Sequence("pep/10-12", "KFP");
+
/*
- * equivalent variants are only reported once
+ * two distinct variants for codon 1 position 1
+ * second one has clinical significance
*/
- codonVariants = new String[][] { { "C" }, { "T" },
- { "A", "C", "G", "T" } };
- // CTA CTC CTG CTT all code for L
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[L]", variants.toString());
-
+ SequenceFeature sf1 = new SequenceFeature("sequence_variant", "", 1, 1,
+ 0f, null);
+ sf1.setValue("alleles", "A,G"); // GAA -> E
+ sf1.setValue("ID", "var1.125A>G");
+ SequenceFeature sf2 = new SequenceFeature("sequence_variant", "", 1, 1,
+ 0f, null);
+ sf2.setValue("alleles", "A,C"); // CAA -> Q
+ sf2.setValue("ID", "var2");
+ sf2.setValue("clinical_significance", "Dodgy");
+ SequenceFeature sf3 = new SequenceFeature("sequence_variant", "", 3, 3,
+ 0f, null);
+ sf3.setValue("alleles", "A,G"); // synonymous
+ sf3.setValue("ID", "var3");
+ sf3.setValue("clinical_significance", "None");
+ SequenceFeature sf4 = new SequenceFeature("sequence_variant", "", 3, 3,
+ 0f, null);
+ sf4.setValue("alleles", "A,T"); // AAT -> N
+ sf4.setValue("ID", "sequence_variant:var4"); // prefix gets stripped off
+ sf4.setValue("clinical_significance", "Benign");
+ SequenceFeature sf5 = new SequenceFeature("sequence_variant", "", 6, 6,
+ 0f, null);
+ sf5.setValue("alleles", "T,C"); // synonymous
+ sf5.setValue("ID", "var5");
+ sf5.setValue("clinical_significance", "Bad");
+ SequenceFeature sf6 = new SequenceFeature("sequence_variant", "", 8, 8,
+ 0f, null);
+ sf6.setValue("alleles", "C,A,G"); // CAC,CGC -> H,R
+ sf6.setValue("ID", "var6");
+ sf6.setValue("clinical_significance", "Good");
+
+ List<DnaVariant> codon1Variants = new ArrayList<DnaVariant>();
+ List<DnaVariant> codon2Variants = new ArrayList<DnaVariant>();
+ List<DnaVariant> codon3Variants = new ArrayList<DnaVariant>();
+ List<DnaVariant> codonVariants[] = new ArrayList[3];
+ codonVariants[0] = codon1Variants;
+ codonVariants[1] = codon2Variants;
+ codonVariants[2] = codon3Variants;
+
/*
- * vary codons 1 and 2; variant products are sorted and non-redundant
+ * compute variants for protein position 1
*/
- codonVariants = new String[][] { { "a", "C" }, { "g", "T" }, { "A" } };
- // aga ata cga cta code for R, I, R, L
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[I, L, R]", variants.toString());
-
+ codon1Variants.add(new DnaVariant("A", sf1));
+ codon1Variants.add(new DnaVariant("A", sf2));
+ codon2Variants.add(new DnaVariant("A"));
+ codon2Variants.add(new DnaVariant("A"));
+ codon3Variants.add(new DnaVariant("A", sf3));
+ codon3Variants.add(new DnaVariant("A", sf4));
+ AlignmentUtils.computePeptideVariants(peptide, 1, codonVariants);
+
/*
- * vary codons 2 and 3
+ * compute variants for protein position 2
*/
- codonVariants = new String[][] { { "a" }, { "g", "T" }, { "A", "c" } };
- // aga agc ata atc code for R, S, I, I
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[I, R]", variants.toString());
-
+ codon1Variants.clear();
+ codon2Variants.clear();
+ codon3Variants.clear();
+ codon1Variants.add(new DnaVariant("T"));
+ codon2Variants.add(new DnaVariant("T"));
+ codon3Variants.add(new DnaVariant("T", sf5));
+ AlignmentUtils.computePeptideVariants(peptide, 2, codonVariants);
+
/*
- * vary codons 1 and 3
+ * compute variants for protein position 3
*/
- codonVariants = new String[][] { { "a", "t" }, { "a" }, { "t", "g" } };
- // aat aag tat tag code for N, K, Y, STOP - STOP sorted to end
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[K, N, Y, STOP]", variants.toString());
-
+ codon1Variants.clear();
+ codon2Variants.clear();
+ codon3Variants.clear();
+ codon1Variants.add(new DnaVariant("C"));
+ codon2Variants.add(new DnaVariant("C", sf6));
+ codon3Variants.add(new DnaVariant("C"));
+ AlignmentUtils.computePeptideVariants(peptide, 3, codonVariants);
+
/*
- * vary codons 1, 2 and 3
+ * verify added sequence features for
+ * var1 K -> E
+ * var2 K -> Q
+ * var4 K -> N
+ * var6 P -> H
+ * var6 P -> R
*/
- codonVariants = new String[][] { { "a", "t" }, { "G", "C" },
- { "t", "g" } };
- // agt agg act acg tgt tgg tct tcg code for S, R, T, T, C, W, S, S
- variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
- assertEquals("[C, R, T, W]", variants.toString());
+ SequenceFeature[] sfs = peptide.getSequenceFeatures();
+ assertEquals(5, sfs.length);
+ SequenceFeature sf = sfs[0];
+ assertEquals(1, sf.getBegin());
+ assertEquals(1, sf.getEnd());
+ assertEquals("p.Lys1Glu", sf.getDescription());
+ assertEquals("var1.125A>G", sf.getValue("ID"));
+ assertNull(sf.getValue("clinical_significance"));
+ assertEquals("ID=var1.125A>G", sf.getAttributes());
+ assertEquals(1, sf.links.size());
+ // link to variation is urlencoded
+ assertEquals(
+ "p.Lys1Glu var1.125A>G|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var1.125A%3EG",
+ sf.links.get(0));
+ assertEquals("Jalview", sf.getFeatureGroup());
+ sf = sfs[1];
+ assertEquals(1, sf.getBegin());
+ assertEquals(1, sf.getEnd());
+ assertEquals("p.Lys1Gln", sf.getDescription());
+ assertEquals("var2", sf.getValue("ID"));
+ assertEquals("Dodgy", sf.getValue("clinical_significance"));
+ assertEquals("ID=var2;clinical_significance=Dodgy", sf.getAttributes());
+ assertEquals(1, sf.links.size());
+ assertEquals(
+ "p.Lys1Gln var2|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var2",
+ sf.links.get(0));
+ assertEquals("Jalview", sf.getFeatureGroup());
+ sf = sfs[2];
+ assertEquals(1, sf.getBegin());
+ assertEquals(1, sf.getEnd());
+ assertEquals("p.Lys1Asn", sf.getDescription());
+ assertEquals("var4", sf.getValue("ID"));
+ assertEquals("Benign", sf.getValue("clinical_significance"));
+ assertEquals("ID=var4;clinical_significance=Benign", sf.getAttributes());
+ assertEquals(1, sf.links.size());
+ assertEquals(
+ "p.Lys1Asn var4|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var4",
+ sf.links.get(0));
+ assertEquals("Jalview", sf.getFeatureGroup());
+ sf = sfs[3];
+ assertEquals(3, sf.getBegin());
+ assertEquals(3, sf.getEnd());
+ assertEquals("p.Pro3His", sf.getDescription());
+ assertEquals("var6", sf.getValue("ID"));
+ assertEquals("Good", sf.getValue("clinical_significance"));
+ assertEquals("ID=var6;clinical_significance=Good", sf.getAttributes());
+ assertEquals(1, sf.links.size());
+ assertEquals(
+ "p.Pro3His var6|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var6",
+ sf.links.get(0));
+ // var5 generates two distinct protein variant features
+ assertEquals("Jalview", sf.getFeatureGroup());
+ sf = sfs[4];
+ assertEquals(3, sf.getBegin());
+ assertEquals(3, sf.getEnd());
+ assertEquals("p.Pro3Arg", sf.getDescription());
+ assertEquals("var6", sf.getValue("ID"));
+ assertEquals("Good", sf.getValue("clinical_significance"));
+ assertEquals("ID=var6;clinical_significance=Good", sf.getAttributes());
+ assertEquals(1, sf.links.size());
+ assertEquals(
+ "p.Pro3Arg var6|http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=var6",
+ sf.links.get(0));
+ assertEquals("Jalview", sf.getFeatureGroup());
}
/**
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.analysis;
+
+import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+
+import java.util.Hashtable;
+
+import org.testng.Assert;
+import org.testng.annotations.Test;
+
+/**
+ * @author jprocter
+ *
+ */
+public class SeqsetUtilsTest
+{
+ /**
+ * test for JAL-2046 bug - duplication of sequence features on reconstructed
+ * alignment
+ */
+ @Test(groups = { "Functional" })
+ public void testSeqFeatureAddition()
+ {
+ SequenceI[] sqset = new SequenceI[] {
+ new Sequence("Aseq1", "AREALSEQ"),
+ new Sequence("Aseq2", "AREALSEQ") };
+
+ AlignmentI al = new Alignment(sqset);
+ al.setDataset(null);
+ AlignmentI ds = al.getDataset();
+ SequenceFeature sf1 = new SequenceFeature("f1", "foo", "bleh", 2, 3,
+ "far"), sf2 = new SequenceFeature("f2", "foo", "bleh", 2, 3,
+ "far");
+ ds.getSequenceAt(0).addSequenceFeature(sf1);
+ Hashtable unq = SeqsetUtils.uniquify(sqset, true);
+ SequenceI[] sqset2 = new SequenceI[] {
+ new Sequence(sqset[0].getName(), sqset[0].getSequenceAsString()),
+ new Sequence(sqset[1].getName(), sqset[1].getSequenceAsString()) };
+ Assert.assertTrue(sqset[0].getSequenceFeatures()[0] == sf1);
+ Assert.assertEquals(sqset2[0].getSequenceFeatures(), null);
+ ds.getSequenceAt(0).addSequenceFeature(sf2);
+ Assert.assertEquals(sqset[0].getSequenceFeatures().length, 2);
+ SeqsetUtils.deuniquify(unq, sqset2);
+ // explicitly test that original sequence features still exist because they
+ // are on the shared dataset sequence
+ Assert.assertEquals(sqset[0].getSequenceFeatures().length, 2);
+ Assert.assertEquals(sqset2[0].getSequenceFeatures().length, 2);
+ Assert.assertTrue(sqset[0].getSequenceFeatures()[0] == sqset2[0]
+ .getSequenceFeatures()[0]);
+ Assert.assertTrue(sqset[0].getSequenceFeatures()[1] == sqset2[0]
+ .getSequenceFeatures()[1]);
+ }
+}
import jalview.io.FileLoader;
import jalview.io.FormatAdapter;
-import org.testng.AssertJUnit;
+import org.testng.Assert;
import org.testng.annotations.Test;
public class FeatureScoreModelTest
int[] sf3 = new int[] { -1, -1, -1, -1, -1, -1, 76, 77 };
- @Test(groups = { "Functional" })
- public void testFeatureScoreModel() throws Exception
+ public AlignFrame getTestAlignmentFrame()
{
AlignFrame alf = new FileLoader(false).LoadFileWaitTillLoaded(
alntestFile, FormatAdapter.PASTE);
AlignmentI al = alf.getViewport().getAlignment();
- AssertJUnit.assertEquals(4, al.getHeight());
- AssertJUnit.assertEquals(5, al.getWidth());
+ Assert.assertEquals(al.getHeight(), 4);
+ Assert.assertEquals(al.getWidth(), 5);
for (int i = 0; i < 4; i++)
{
SequenceI ds = al.getSequenceAt(i).getDatasetSequence();
alf.getFeatureRenderer().setVisible("sf2");
alf.getFeatureRenderer().setVisible("sf3");
alf.getFeatureRenderer().findAllFeatures(true);
- AssertJUnit.assertEquals("Number of feature types", 3, alf
- .getFeatureRenderer().getDisplayedFeatureTypes().size());
- AssertJUnit.assertTrue(alf.getCurrentView().areFeaturesDisplayed());
+ Assert.assertEquals(alf.getFeatureRenderer().getDisplayedFeatureTypes()
+ .size(), 3, "Number of feature types");
+ Assert.assertTrue(alf.getCurrentView().areFeaturesDisplayed());
+ return alf;
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFeatureScoreModel() throws Exception
+ {
+ AlignFrame alf = getTestAlignmentFrame();
FeatureScoreModel fsm = new FeatureScoreModel();
- AssertJUnit.assertTrue(fsm.configureFromAlignmentView(alf
+ Assert.assertTrue(fsm.configureFromAlignmentView(alf
.getCurrentView().getAlignPanel()));
alf.selectAllSequenceMenuItem_actionPerformed(null);
float[][] dm = fsm.findDistances(alf.getViewport().getAlignmentView(
true));
- AssertJUnit.assertTrue("FER1_MESCR should be identical with RAPSA (2)",
- dm[0][2] == 0f);
- AssertJUnit
- .assertTrue(
- "FER1_MESCR should be further from SPIOL (1) than it is from RAPSA (2)",
- dm[0][1] > dm[0][2]);
+ Assert.assertTrue(dm[0][2] == 0f,
+ "FER1_MESCR (0) should be identical with RAPSA (2)");
+ Assert.assertTrue(dm[0][1] > dm[0][2],
+ "FER1_MESCR (0) should be further from SPIOL (1) than it is from RAPSA (2)");
+ }
+
+ @Test(groups = { "Functional" })
+ public void testFeatureScoreModel_hiddenFirstColumn() throws Exception
+ {
+ AlignFrame alf = getTestAlignmentFrame();
+ // hiding first two columns shouldn't affect the tree
+ alf.getViewport().hideColumns(0, 1);
+ FeatureScoreModel fsm = new FeatureScoreModel();
+ Assert.assertTrue(fsm.configureFromAlignmentView(alf.getCurrentView()
+ .getAlignPanel()));
+ alf.selectAllSequenceMenuItem_actionPerformed(null);
+ float[][] dm = fsm.findDistances(alf.getViewport().getAlignmentView(
+ true));
+ Assert.assertTrue(dm[0][2] == 0f,
+ "FER1_MESCR (0) should be identical with RAPSA (2)");
+ Assert.assertTrue(dm[0][1] > dm[0][2],
+ "FER1_MESCR (0) should be further from SPIOL (1) than it is from RAPSA (2)");
+ }
+ @Test(groups = { "Functional" })
+ public void testFeatureScoreModel_HiddenColumns() throws Exception
+ {
+ AlignFrame alf = getTestAlignmentFrame();
+ // hide columns and check tree changes
+ alf.getViewport().hideColumns(3, 4);
+ alf.getViewport().hideColumns(0, 1);
+ FeatureScoreModel fsm = new FeatureScoreModel();
+ Assert.assertTrue(fsm.configureFromAlignmentView(alf.getCurrentView()
+ .getAlignPanel()));
+ alf.selectAllSequenceMenuItem_actionPerformed(null);
+ float[][] dm = fsm.findDistances(alf.getViewport().getAlignmentView(
+ true));
+ Assert.assertTrue(dm[0][2] == 0f,
+ "After hiding last two columns FER1_MESCR (0) should still be identical with RAPSA (2)");
+ Assert.assertTrue(dm[0][1] == 0f,
+ "After hiding last two columns FER1_MESCR (0) should now also be identical with SPIOL (1)");
+ for (int s=0;s<3;s++)
+ {
+ Assert.assertTrue(dm[s][3] > 0f, "After hiding last two columns "
+ + alf.getViewport().getAlignment().getSequenceAt(s).getName()
+ + "(" + s + ") should still be distinct from FER1_MAIZE (3)");
+ }
}
}
import jalview.util.MapList;
import java.io.IOException;
+import java.util.ArrayList;
import java.util.Arrays;
import java.util.Iterator;
import java.util.List;
align.addCodonFrame(acf2);
assertTrue(align.getDataset().getCodonFrames().contains(acf));
}
+
+ @Test(groups = "Functional")
+ public void getVisibleStartAndEndIndexTest()
+ {
+ Sequence seq = new Sequence("testSeq", "ABCDEFGHIJKLMNOPQRSTUVWXYZ");
+ AlignmentI align = new Alignment(new SequenceI[] { seq });
+ ArrayList<int[]> hiddenCols = new ArrayList<int[]>();
+
+ int[] startEnd = align.getVisibleStartAndEndIndex(hiddenCols);
+ assertEquals(0, startEnd[0]);
+ assertEquals(25, startEnd[1]);
+
+ hiddenCols.add(new int[] { 0, 0 });
+ startEnd = align.getVisibleStartAndEndIndex(hiddenCols);
+ assertEquals(1, startEnd[0]);
+ assertEquals(25, startEnd[1]);
+
+ hiddenCols.add(new int[] { 6, 9 });
+ hiddenCols.add(new int[] { 11, 12 });
+ startEnd = align.getVisibleStartAndEndIndex(hiddenCols);
+ assertEquals(1, startEnd[0]);
+ assertEquals(25, startEnd[1]);
+
+ hiddenCols.add(new int[] { 24, 25 });
+ startEnd = align.getVisibleStartAndEndIndex(hiddenCols);
+ System.out.println(startEnd[0] + " : " + startEnd[1]);
+ assertEquals(1, startEnd[0]);
+ assertEquals(23, startEnd[1]);
+ }
}
assertEquals(2, cs.findColumnPosition(5));
}
+ /**
+ * Test the code used to locate the reference sequence ruler origin
+ */
+ @Test(groups = { "Functional" })
+ public void testLocateVisibleBoundsofSequence()
+ {
+ ColumnSelection cs = new ColumnSelection();
+ SequenceI seq = new Sequence("RefSeq", "-A-SD-ASD--E---");
+ assertEquals(2, seq.findIndex(seq.getStart()));
+
+ // no hidden columns
+ assertEquals(
+ Arrays.toString(new int[] { seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1, seq.getStart(),
+ seq.getEnd(), seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1 }),
+ Arrays.toString(cs.locateVisibleBoundsOfSequence(seq)));
+
+ // hidden column on gap after end of sequence - should not affect bounds
+ cs.hideColumns(13);
+ assertEquals(
+ Arrays.toString(new int[] { seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1, seq.getStart(),
+ seq.getEnd(), seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1 }),
+ Arrays.toString(cs.locateVisibleBoundsOfSequence(seq)));
+
+ cs.revealAllHiddenColumns();
+ // hidden column on gap before beginning of sequence - should vis bounds by
+ // one
+ cs.hideColumns(0);
+ assertEquals(
+ Arrays.toString(new int[] { seq.findIndex(seq.getStart()) - 2,
+ seq.findIndex(seq.getEnd()) - 2, seq.getStart(),
+ seq.getEnd(), seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1 }),
+ Arrays.toString(cs.locateVisibleBoundsOfSequence(seq)));
+
+ cs.revealAllHiddenColumns();
+ // hide columns around most of sequence - leave one residue remaining
+ cs.hideColumns(1, 3);
+ cs.hideColumns(6, 11);
+ assertEquals("-D",
+ cs.getVisibleSequenceStrings(0, 5, new SequenceI[] { seq })[0]);
+ assertEquals(
+ Arrays.toString(new int[] { 1, 1, 3, 3,
+ seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1 }),
+ Arrays.toString(cs.locateVisibleBoundsOfSequence(seq)));
+ cs.revealAllHiddenColumns();
+
+ // hide whole sequence - should just get location of hidden region
+ // containing sequence
+ cs.hideColumns(1, 11);
+ assertEquals(
+ Arrays.toString(new int[] { 0, 1, 0, 0,
+ seq.findIndex(seq.getStart()) - 1,
+ seq.findIndex(seq.getEnd()) - 1 }),
+ Arrays.toString(cs.locateVisibleBoundsOfSequence(seq)));
+
+ }
+
+ @Test(groups={"Functional"})
+ public void testLocateVisibleBoundsPathologicals()
+ {
+ // test some pathological cases we missed
+ AlignmentI al = new Alignment(new SequenceI[] { new Sequence("refseqGaptest","KTDVTI----------NFI-----G----L")});
+ ColumnSelection cs = new ColumnSelection();
+ cs.hideInsertionsFor(al.getSequenceAt(0));
+ assertEquals(
+ "G",
+ ""
+ + al.getSequenceAt(0).getCharAt(
+ cs.adjustForHiddenColumns(9)));
+
+
+ }
@Test(groups = { "Functional" })
public void testHideColumns()
{
cs.addElement(0);
assertEquals(0, cs.getMin());
}
+
+ @Test(groups = { "Functional" })
+ public void testEquals()
+ {
+ ColumnSelection cs = new ColumnSelection();
+ cs.addElement(0);
+ cs.addElement(513);
+ cs.addElement(1);
+ cs.hideColumns(3);
+ cs.hideColumns(7);
+ cs.hideColumns(5,9);
+
+ // same selections added in a different order
+ ColumnSelection cs2 = new ColumnSelection();
+ cs2.addElement(1);
+ cs2.addElement(513);
+ cs2.addElement(0);
+ cs2.hideColumns(6, 9);
+ cs2.hideColumns(5, 8);
+ cs2.hideColumns(3);
+
+ assertTrue(cs.equals(cs2));
+ assertTrue(cs.equals(cs));
+ assertTrue(cs2.equals(cs));
+ assertTrue(cs2.equals(cs2));
+
+ cs2.addElement(12);
+ assertFalse(cs.equals(cs2));
+ assertFalse(cs2.equals(cs));
+
+ cs2.removeElement(12);
+ assertTrue(cs.equals(cs2));
+
+ cs2.hideColumns(88);
+ assertFalse(cs.equals(cs2));
+ /*
+ * unhiding a column adds it to selection!
+ */
+ cs2.revealHiddenColumns(88);
+ assertFalse(cs.equals(cs2));
+ cs.addElement(88);
+ assertTrue(cs.equals(cs2));
+ }
}
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
+import jalview.util.Comparison;
+
import org.testng.annotations.Test;
/**
*/
public class SeqCigarTest
{
+ @Test(groups = { "Functional" })
+ public void testFindPosition()
+ {
+ SequenceI oseq = new Sequence("MySeq", "ASD---ASD---ASD", 37, 45);
+ oseq.createDatasetSequence();
+ SeqCigar cs = new SeqCigar(oseq);
+ assertEquals(oseq.getSequenceAsString(), cs.getSequenceString('-'));
+ for (int c = 0, cLen = oseq.getLength(); c < cLen; c++)
+ {
+ int os_p = oseq.findPosition(c);
+ int cigar_p = cs.findPosition(c);
+ if (Comparison.isGap(oseq.getCharAt(c)))
+ {
+ assertEquals("Expected gap at position " + os_p + " column " + c,
+ -1, cigar_p);
+ }
+ else
+ {
+ assertEquals("Positions don't match for at column " + c, os_p,
+ cigar_p);
+ }
+ }
+ }
/*
* refactored 'as is' from main method
*
import jalview.datamodel.PDBEntry.Type;
+import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
import java.util.Vector;
+import org.testng.Assert;
import org.testng.annotations.BeforeMethod;
import org.testng.annotations.Test;
assertEquals(1, sfs.length);
assertSame(sf, sfs[0]);
+
/*
* SequenceFeature on sequence and dataset sequence; returns that on
* sequence
+ *
+ * Note JAL-2046: spurious: we have no use case for this at the moment.
+ * This test also buggy - as sf2.equals(sf), no new feature is added
*/
SequenceFeature sf2 = new SequenceFeature();
sq.getDatasetSequence().addSequenceFeature(sf2);
/*
* SequenceFeature on dataset sequence only
+ * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
*/
sq.setSequenceFeatures(null);
- sfs = sq.getSequenceFeatures();
- assertEquals(1, sfs.length);
- assertSame(sf2, sfs[0]);
+ assertNull(sq.getDatasetSequence().getSequenceFeatures());
/*
* Corrupt case - no SequenceFeature, dataset's dataset is the original
* sequence. Test shows no infinite loop results.
*/
sq.getDatasetSequence().setSequenceFeatures(null);
+ /**
+ * is there a usecase for this ? setDatasetSequence should throw an error if
+ * this actually occurs.
+ */
sq.getDatasetSequence().setDatasetSequence(sq); // loop!
assertNull(sq.getSequenceFeatures());
}
sq.setStart(3);
sq.setEnd(4);
+ sq.setDescription("Test sequence description..");
+ sq.setVamsasId("TestVamsasId");
+ sq.setSourceDBRef(new DBRefEntry("PDB", "version0", "1TST"));
+
+ sq.addDBRef(new DBRefEntry("PDB", "version1", "1Tst"));
+ sq.addDBRef(new DBRefEntry("PDB", "version2", "2Tst"));
+ sq.addDBRef(new DBRefEntry("PDB", "version3", "3Tst"));
+ sq.addDBRef(new DBRefEntry("PDB", "version4", "4Tst"));
+
+ sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
+ sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
+ sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
+
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version1", "1Tst"));
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version2", "2Tst"));
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version3", "3Tst"));
+ sq.getDatasetSequence().addDBRef(
+ new DBRefEntry("PDB", "version4", "4Tst"));
+
+ sq.getDatasetSequence().addPDBId(
+ new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
+ sq.getDatasetSequence().addPDBId(
+ new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
+ sq.getDatasetSequence().addPDBId(
+ new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
+ sq.getDatasetSequence().addPDBId(
+ new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
+
+ ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
+ System.out.println(">>>>>> " + sq.getSequenceAsString().length());
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+ Annotation[] annots = annotsList.toArray(new Annotation[0]);
+ sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
+ "Test annot description", annots));
+ sq.getDatasetSequence().addAlignmentAnnotation(
+ new AlignmentAnnotation("Test annot", "Test annot description",
+ annots));
+ Assert.assertEquals(sq.getDescription(), "Test sequence description..");
+ Assert.assertEquals(sq.getDBRefs().length, 4);
+ Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(sq.getAnnotation());
+ Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 4);
+ Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
+ 4);
+ Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
+
Sequence derived = (Sequence) sq.deriveSequence();
+
+ Assert.assertEquals(derived.getDescription(),
+ "Test sequence description..");
+ Assert.assertEquals(derived.getDBRefs().length, 4);
+ Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
+ Assert.assertNotNull(derived.getAnnotation());
+ Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
+ Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 4);
+ Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
+ .size(), 4);
+ Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
+
assertEquals("CD", derived.getSequenceAsString());
assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
assertNull(sq.sequenceFeatures);
- // assertNull(derived.sequenceFeatures);
+ assertNull(derived.sequenceFeatures);
+ // derived sequence should access dataset sequence features
assertNotNull(sq.getSequenceFeatures());
- // derived sequence has a copy of the sequence features (is this right?)
assertArrayEquals(sq.getSequenceFeatures(),
derived.getSequenceFeatures());
}
seq1.setDescription("description");
seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
1.3d));
+ // JAL-2046 - what is the contract for using a derived sequence's
+ // addSequenceFeature ?
seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
12.4f, "group"));
seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
// copy has a copy of the sequence feature:
SequenceFeature[] sfs = copy.getSequenceFeatures();
assertEquals(1, sfs.length);
- assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+ if (seq1.getDatasetSequence()!=null && copy.getDatasetSequence()==seq1.getDatasetSequence()) {
+ assertTrue(sfs[0] == seq1.getSequenceFeatures()[0]);
+ } else {
+ assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+ }
assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0]));
// copy has a copy of the PDB entry
{
@Test(suiteName = "live")
- public void testLiveCheckEnsembl()
+ public void testIsEnsemblAvailable()
{
EnsemblRestClient sf = new EnsemblRestClient()
{
}
}
- @Test(suiteName = "live")
- public void testLiveCheckEnsembl()
- {
- EnsemblRestClient sf = new EnsemblRestClient()
- {
-
- @Override
- public String getDbName()
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- public AlignmentI getSequenceRecords(String queries) throws Exception
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- protected URL getUrl(List<String> ids) throws MalformedURLException
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- protected boolean useGetRequest()
- {
- // TODO Auto-generated method stub
- return false;
- }
-
- @Override
- protected String getRequestMimeType(boolean b)
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- protected String getResponseMimeType()
- {
- // TODO Auto-generated method stub
- return null;
- }
-
- };
- boolean isAvailable = sf.isEnsemblAvailable();
- System.out.println("Ensembl is "
- + (isAvailable ? "UP!"
- : "DOWN or unreachable ******************* BAD!"));
- }
-
@Test(groups = "Functional")
public void getGenomicRangesFromFeatures()
{
sb = new StringBuilder();
EnsemblSeqProxy.reverseComplementAllele(sb, "-GATt"); // revcomp=aATC-
EnsemblSeqProxy.reverseComplementAllele(sb, "hgmd_mutation");
- assertEquals("aATC-,hgmd_mutation", sb.toString());
+ EnsemblSeqProxy.reverseComplementAllele(sb, "PhenCode_variation");
+ assertEquals("aATC-,hgmd_mutation,PhenCode_variation", sb.toString());
}
/**
"{\"primary_id\":\"GO:0000165\",\"dbname\":\"GO\"}]";
//@formatter:on
- @Test(groups = "functional")
+ @Test(groups = "Functional")
public void testGetCrossReferences()
{
System.out.println(JSON);
* 1QCF is the full PDB file including headers, HETATM etc
*/
String[] testFile = new String[] { "./examples/1GAQ.txt",
- "./test/jalview/ext/jmol/1xyz.pdb" };
+ "./test/jalview/ext/jmol/1xyz.pdb",
+ "./test/jalview/ext/jmol/1qcf.pdb" };
//@formatter:off
// a modified and very cut-down extract of 4UJ4
--- /dev/null
+package jalview.fts.core;
+
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.api.FTSDataColumnI.FTSDataColumnGroupI;
+
+import java.util.Collection;
+import java.util.HashSet;
+import java.util.Set;
+
+import org.testng.Assert;
+import org.testng.annotations.BeforeMethod;
+import org.testng.annotations.Test;
+
+public class FTSRestClientTest
+{
+ private FTSRestClient ftsRestClient;
+
+ @BeforeMethod(alwaysRun = true)
+ public void setup()
+ {
+ ftsRestClient = new FTSRestClient()
+ {
+
+ @Override
+ public String getColumnDataConfigFileName()
+ {
+ return "/fts/uniprot_data_columns.txt";
+ }
+
+ @Override
+ public FTSRestResponse executeRequest(FTSRestRequest ftsRequest)
+ throws Exception
+ {
+ return null;
+ }
+ };
+ }
+
+ @Test(groups = { "Functional" })
+ public void getPrimaryKeyColumIndexTest()
+ {
+ Collection<FTSDataColumnI> wantedFields = ftsRestClient
+ .getAllDefaulDisplayedDataColumns();
+ int foundIndex = -1;
+ try
+ {
+ Assert.assertEquals(foundIndex, -1);
+ foundIndex = ftsRestClient.getPrimaryKeyColumIndex(wantedFields,
+ false);
+ Assert.assertEquals(foundIndex, 0);
+ foundIndex = ftsRestClient
+ .getPrimaryKeyColumIndex(wantedFields, true);
+ Assert.assertEquals(foundIndex, 1);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getAllDefaulDisplayedDataColumns()
+ {
+ Assert.assertNotNull(ftsRestClient.getAllDefaulDisplayedDataColumns());
+ Assert.assertTrue(!ftsRestClient.getAllDefaulDisplayedDataColumns()
+ .isEmpty());
+ Assert.assertEquals(ftsRestClient.getAllDefaulDisplayedDataColumns()
+ .size(), 7);
+ }
+
+ @Test(groups = { "Functional" })
+ public void getDataColumnsFieldsAsCommaDelimitedString()
+ {
+ Collection<FTSDataColumnI> wantedFields = ftsRestClient
+ .getAllDefaulDisplayedDataColumns();
+ String actual = ftsRestClient
+ .getDataColumnsFieldsAsCommaDelimitedString(wantedFields);
+ Assert.assertEquals(actual,
+ "id,entry name,protein names,genes,organism,reviewed,length");
+ }
+
+
+ @Test(groups = { "Functional" })
+ public void getAllFTSDataColumns()
+ {
+ Collection<FTSDataColumnI> allFields = ftsRestClient
+ .getAllFTSDataColumns();
+ Assert.assertNotNull(allFields);
+ Assert.assertEquals(allFields.size(), 117);
+ }
+
+ @Test(groups = { "Functional" })
+ public void getSearchableDataColumns()
+ {
+ Collection<FTSDataColumnI> searchalbeFields = ftsRestClient
+ .getSearchableDataColumns();
+ Assert.assertNotNull(searchalbeFields);
+ Assert.assertEquals(searchalbeFields.size(), 30);
+ }
+
+ @Test(groups = { "Functional" })
+ public void getPrimaryKeyColumn()
+ {
+ FTSDataColumnI expectedPKColumn;
+ try
+ {
+ expectedPKColumn = ftsRestClient
+ .getDataColumnByNameOrCode("Uniprot Id");
+ Assert.assertNotNull(ftsRestClient.getPrimaryKeyColumn());
+ Assert.assertEquals(ftsRestClient.getPrimaryKeyColumn(),
+ expectedPKColumn);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getDataColumnByNameOrCode()
+ {
+ try
+ {
+ FTSDataColumnI foundDataCol = ftsRestClient
+ .getDataColumnByNameOrCode("genes");
+ Assert.assertNotNull(foundDataCol);
+ Assert.assertEquals(foundDataCol.getName(), "Gene Names");
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getDataColumnGroupById()
+ {
+ FTSDataColumnGroupI foundDataColGroup;
+ try
+ {
+ foundDataColGroup = ftsRestClient.getDataColumnGroupById("g3");
+ Assert.assertNotNull(foundDataColGroup);
+ Assert.assertEquals(foundDataColGroup.getName(), "Names & Taxonomy");
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getDefaultResponsePageSize()
+ {
+ int defaultResSize = ftsRestClient.getDefaultResponsePageSize();
+ Assert.assertEquals(defaultResSize, 500);
+ }
+
+ @Test(groups = { "Functional" })
+ public void getColumnMinWidthTest()
+ {
+ try
+ {
+ FTSDataColumnI foundDataCol = ftsRestClient
+ .getDataColumnByNameOrCode("Protein names");
+ Assert.assertNotNull(foundDataCol);
+ int actualColMinWidth = foundDataCol.getMinWidth();
+ Assert.assertEquals(actualColMinWidth, 300);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getColumnMaxWidthTest()
+ {
+ try
+ {
+ FTSDataColumnI foundDataCol = ftsRestClient
+ .getDataColumnByNameOrCode("Protein names");
+ Assert.assertNotNull(foundDataCol);
+ int actualColMinWidth = foundDataCol.getMaxWidth();
+ Assert.assertEquals(actualColMinWidth, 1500);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getColumnPreferredWidthTest()
+ {
+ try
+ {
+ FTSDataColumnI foundDataCol = ftsRestClient
+ .getDataColumnByNameOrCode("Protein names");
+ Assert.assertNotNull(foundDataCol);
+ int actualColMinWidth = foundDataCol.getPreferredWidth();
+ Assert.assertEquals(actualColMinWidth, 500);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void getColumnClassTest()
+ {
+ try
+ {
+ FTSDataColumnI foundDataCol = ftsRestClient
+ .getDataColumnByNameOrCode("Protein names");
+ Assert.assertNotNull(foundDataCol);
+ Assert.assertEquals(foundDataCol.getDataType().getDataTypeClass(),
+ String.class);
+ foundDataCol = ftsRestClient.getDataColumnByNameOrCode("length");
+ Assert.assertNotNull(foundDataCol);
+ Assert.assertEquals(foundDataCol.getDataType().getDataTypeClass(),
+ Integer.class);
+ // foundDataCol = ftsRestClient.getDataColumnByNameOrCode("length");
+ // Assert.assertNotNull(foundDataCol);
+ // Assert.assertEquals(foundDataCol.getDataColumnClass(), Double.class);
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ Assert.fail("Exception thrown while testing...");
+ }
+ }
+
+ @Test(groups = { "Functional" })
+ public void coverageForEqualsAndHashFunction()
+ {
+ Set<FTSDataColumnI> uniqueSet = new HashSet<FTSDataColumnI>();
+ Collection<FTSDataColumnI> searchableCols = ftsRestClient
+ .getSearchableDataColumns();
+ for (FTSDataColumnI foundCol : searchableCols)
+ {
+ uniqueSet.add(foundCol);
+ uniqueSet.add(foundCol);
+ }
+ Assert.assertTrue(!uniqueSet.isEmpty());
+ Assert.assertEquals(uniqueSet.size(), 30);
+ }
+
+ @Test(groups = { "Functional" })
+ public void coverageForMiscellaneousBranches()
+ {
+ String actual = ftsRestClient.getPrimaryKeyColumn().toString();
+ Assert.assertEquals(actual, "Uniprot Id");
+
+ String actualGroupStr;
+ try
+ {
+ actualGroupStr = ftsRestClient.getDataColumnGroupById("g4")
+ .toString();
+ Assert.assertEquals(actualGroupStr, "Procedures & Softwares");
+ actualGroupStr = ftsRestClient.getDataColumnGroupById(
+ "unavailable group").toString();
+ } catch (Exception e)
+ {
+ Assert.assertTrue(true);
+ }
+
+ String actualResourseFile = ftsRestClient
+ .getResourceFile("/fts/uniprot_data_columns.txt");
+ Assert.assertNotNull(actualResourseFile);
+ Assert.assertTrue(actualResourseFile.length() > 31);
+ }
+
+ @Test(groups = { "Functional" }, expectedExceptions = Exception.class)
+ public void coverageForExceptionBranches() throws Exception
+ {
+ try
+ {
+ ftsRestClient.getDataColumnByNameOrCode("unavailable column");
+ } catch (Exception e)
+ {
+ System.out.println(e.getMessage());
+ String expectedMessage = "Couldn't find data column with name : unavailable column";
+ Assert.assertEquals(e.getMessage(), expectedMessage);
+ }
+ try
+ {
+ ftsRestClient.getDataColumnGroupById("unavailable column group Id");
+ } catch (Exception e)
+ {
+ System.out.println(e.getMessage());
+ String expectedMessage = "Couldn't find data column group with id : unavailable column group Id";
+ Assert.assertEquals(e.getMessage(), expectedMessage);
+ }
+
+ ftsRestClient.getDataColumnByNameOrCode("unavailable column");
+
+ ftsRestClient.getResourceFile("unavailable resource file");
+
+ }
+
+}
* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
-package jalview.gui;
+package jalview.fts.service.pdb;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertTrue;
+import jalview.fts.service.pdb.PDBFTSPanel;
+
import javax.swing.JInternalFrame;
import javax.swing.JTextField;
import org.testng.annotations.BeforeMethod;
import org.testng.annotations.Test;
-public class PDBSearchPanelTest
+public class PDBFTSPanelTest
{
@BeforeMethod(alwaysRun = true)
@Test(groups = { "Functional" })
public void populateCmbSearchTargetOptionsTest()
{
- PDBSearchPanel searchPanel = new PDBSearchPanel(null);
+ PDBFTSPanel searchPanel = new PDBFTSPanel(null);
assertTrue(searchPanel.getCmbSearchTarget().getItemCount() > 0);
searchPanel.populateCmbSearchTargetOptions();
}
public void testDecodeSearchTerm()
{
String expectedString = "1xyz OR text:2xyz OR text:3xyz";
- String outcome = PDBSearchPanel.decodeSearchTerm("1xyz:A;2xyz;3xyz",
+ String outcome = PDBFTSPanel.decodeSearchTerm("1xyz:A;2xyz;3xyz",
"text");
// System.out.println("1 >>>>>>>>>>> " + outcome);
assertEquals(expectedString, outcome);
expectedString = "1xyz";
- outcome = PDBSearchPanel.decodeSearchTerm("1xyz", "text");
+ outcome = PDBFTSPanel.decodeSearchTerm("1xyz", "text");
// System.out.println("2 >>>>>>>>>>> " + outcome);
assertEquals(expectedString, outcome);
}
{
String expectedString = "1xyz:A";
- String outcome = PDBSearchPanel.getPDBIdwithSpecifiedChain("1xyz",
+ String outcome = PDBFTSPanel.getPDBIdwithSpecifiedChain("1xyz",
"2xyz;3xyz;1xyz:A");
System.out.println("1 >>>>>>>>>>> " + outcome);
assertEquals(expectedString, outcome);
expectedString = "2xyz";
- outcome = PDBSearchPanel.getPDBIdwithSpecifiedChain("2xyz",
+ outcome = PDBFTSPanel.getPDBIdwithSpecifiedChain("2xyz",
"1xyz:A;2xyz;3xyz");
System.out.println("2 >>>>>>>>>>> " + outcome);
assertEquals(expectedString, outcome);
expectedString = "2xyz:A";
- outcome = PDBSearchPanel.getPDBIdwithSpecifiedChain("2xyz", "2xyz:A");
+ outcome = PDBFTSPanel.getPDBIdwithSpecifiedChain("2xyz", "2xyz:A");
System.out.println("3 >>>>>>>>>>> " + outcome);
assertEquals(expectedString, outcome);
}
- @Test(groups = { "Network", "External" }, timeOut = 5000)
+ @Test(groups = { "External" }, timeOut = 7000)
public void txt_search_ActionPerformedTest()
{
- PDBSearchPanel searchPanel = new PDBSearchPanel(null);
+ PDBFTSPanel searchPanel = new PDBFTSPanel(null);
JInternalFrame mainFrame = searchPanel.getMainFrame();
JTextField txt_search = searchPanel.getTxtSearch();
assertTrue(mainFrame.getTitle().length() == 20);
assertTrue(mainFrame.getTitle()
.equalsIgnoreCase("PDB Sequence Fetcher"));
-
txt_search.setText("ABC");
-
+ try
+ {
+ // wait for web-service to handle response
+ Thread.sleep(3000);
+ } catch (InterruptedException e)
+ {
+ e.printStackTrace();
+ }
assertTrue(mainFrame.getTitle().length() > 20);
assertTrue(!mainFrame.getTitle().equalsIgnoreCase(
"PDB Sequence Fetcher"));
* along with Jalview. If not, see <http://www.gnu.org/licenses/>.
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
-package jalview.ws.dbsources;
+package jalview.fts.service.pdb;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertTrue;
-import jalview.ws.dbsources.PDBRestClient.PDBDocField;
-import jalview.ws.uimodel.PDBRestRequest;
-import jalview.ws.uimodel.PDBRestResponse;
+import jalview.fts.api.FTSDataColumnI;
+import jalview.fts.core.FTSRestRequest;
+import jalview.fts.core.FTSRestResponse;
import java.io.BufferedReader;
import java.io.FileReader;
import com.sun.jersey.api.client.config.ClientConfig;
import com.sun.jersey.api.client.config.DefaultClientConfig;
-public class PDBRestClientTest
+public class PDBFTSRestClientTest
{
@BeforeMethod(alwaysRun = true)
@Test(groups = { "External", "Network" })
public void executeRequestTest()
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.MOLECULE_TYPE);
- wantedFields.add(PDBDocField.PDB_ID);
- wantedFields.add(PDBDocField.GENUS);
- wantedFields.add(PDBDocField.GENE_NAME);
- wantedFields.add(PDBDocField.TITLE);
-
- PDBRestRequest request = new PDBRestRequest();
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("molecule_type"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("genus"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("gene_name"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("title"));
+ } catch (Exception e1)
+ {
+ e1.printStackTrace();
+ }
+
+ FTSRestRequest request = new FTSRestRequest();
request.setAllowEmptySeq(false);
request.setResponseSize(100);
request.setFieldToSearchBy("text:");
request.setSearchTerm("abc");
request.setWantedFields(wantedFields);
- PDBRestResponse response;
+ FTSRestResponse response;
try
{
- response = new PDBRestClient().executeRequest(request);
+ response = PDBFTSRestClient.getInstance().executeRequest(request);
} catch (Exception e)
{
e.printStackTrace();
@Test(groups = { "Functional" })
public void getPDBDocFieldsAsCommaDelimitedStringTest()
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.MOLECULE_TYPE);
- wantedFields.add(PDBDocField.PDB_ID);
- wantedFields.add(PDBDocField.GENUS);
- wantedFields.add(PDBDocField.GENE_NAME);
- wantedFields.add(PDBDocField.TITLE);
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("molecule_type"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("genus"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("gene_name"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("title"));
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
String expectedResult = "molecule_type,pdb_id,genus,gene_name,title";
- String actualResult = PDBRestClient
- .getPDBDocFieldsAsCommaDelimitedString(wantedFields);
+ String actualResult = PDBFTSRestClient.getInstance()
+ .getDataColumnsFieldsAsCommaDelimitedString(wantedFields);
assertEquals("", expectedResult, actualResult);
}
@Test(groups = { "External, Network" })
public void parsePDBJsonExceptionStringTest()
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.MOLECULE_TYPE);
- wantedFields.add(PDBDocField.PDB_ID);
- wantedFields.add(PDBDocField.GENUS);
- wantedFields.add(PDBDocField.GENE_NAME);
- wantedFields.add(PDBDocField.TITLE);
-
- PDBRestRequest request = new PDBRestRequest();
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("molecule_type"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("genus"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("gene_name"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("title"));
+ } catch (Exception e1)
+ {
+ e1.printStackTrace();
+ }
+
+ FTSRestRequest request = new FTSRestRequest();
request.setAllowEmptySeq(false);
request.setResponseSize(100);
request.setFieldToSearchBy("text:");
e.printStackTrace();
}
- String parsedErrorResponse = PDBRestClient
+ String parsedErrorResponse = PDBFTSRestClient
.parseJsonExceptionString(jsonErrorResponse);
String expectedErrorMsg = "\n============= PDB Rest Client RunTime error =============\n"
}
@Test(
- groups = { "External", "Network" },
+ groups = { "External" },
expectedExceptions = Exception.class)
public void testForExpectedRuntimeException() throws Exception
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.PDB_ID);
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
- PDBRestRequest request = new PDBRestRequest();
+ FTSRestRequest request = new FTSRestRequest();
request.setFieldToSearchBy("text:");
request.setSearchTerm("abc OR text:go:abc");
request.setWantedFields(wantedFields);
- new PDBRestClient().executeRequest(request);
+ PDBFTSRestClient.getInstance().executeRequest(request);
}
+ // JBP: Is this actually external ? Looks like it is mocked
@Test(groups = { "External" })
public void parsePDBJsonResponseTest()
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.MOLECULE_TYPE);
- wantedFields.add(PDBDocField.PDB_ID);
- wantedFields.add(PDBDocField.GENUS);
- wantedFields.add(PDBDocField.GENE_NAME);
- wantedFields.add(PDBDocField.TITLE);
-
- PDBRestRequest request = new PDBRestRequest();
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("molecule_type"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("genus"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("gene_name"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("title"));
+ } catch (Exception e1)
+ {
+ e1.printStackTrace();
+ }
+
+ FTSRestRequest request = new FTSRestRequest();
request.setAllowEmptySeq(false);
request.setWantedFields(wantedFields);
{
e.printStackTrace();
}
- PDBRestResponse response = PDBRestClient.parsePDBJsonResponse(
+ FTSRestResponse response = PDBFTSRestClient.parsePDBJsonResponse(
jsonString, request);
assertTrue(response.getSearchSummary() != null);
assertTrue(response.getNumberOfItemsFound() == 931);
@Test(groups = { "Functional" })
public void getPDBIdColumIndexTest()
{
- List<PDBDocField> wantedFields = new ArrayList<PDBDocField>();
- wantedFields.add(PDBDocField.MOLECULE_TYPE);
- wantedFields.add(PDBDocField.GENUS);
- wantedFields.add(PDBDocField.GENE_NAME);
- wantedFields.add(PDBDocField.TITLE);
- wantedFields.add(PDBDocField.PDB_ID);
- assertEquals(5, PDBRestClient.getPDBIdColumIndex(wantedFields, true));
- assertEquals(4, PDBRestClient.getPDBIdColumIndex(wantedFields, false));
+ List<FTSDataColumnI> wantedFields = new ArrayList<FTSDataColumnI>();
+ try
+ {
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("molecule_type"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("genus"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("gene_name"));
+ wantedFields.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("title"));
+ wantedFields
+.add(PDBFTSRestClient.getInstance()
+ .getDataColumnByNameOrCode("pdb_id"));
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ }
+ try
+ {
+ assertEquals(5,
+ PDBFTSRestClient.getInstance()
+ .getPrimaryKeyColumIndex(wantedFields, true));
+ assertEquals(4,
+ PDBFTSRestClient.getInstance()
+ .getPrimaryKeyColumIndex(wantedFields, false));
+ } catch (Exception e)
+ {
+ // TODO Auto-generated catch block
+ e.printStackTrace();
+ }
}
@Test(groups = { "External" })
// Build request parameters for the REST Request
WebResource webResource = client
- .resource(PDBRestClient.PDB_SEARCH_ENDPOINT)
+ .resource(PDBFTSRestClient.PDB_SEARCH_ENDPOINT)
.queryParam("wt", "json").queryParam("rows", String.valueOf(1))
.queryParam("q", "text:abc AND molecule_sequence:['' TO *]");
JSONObject pdbJsonDoc = docIter.next();
- for (PDBDocField field : PDBDocField.values())
+ for (FTSDataColumnI field : PDBFTSRestClient.getInstance()
+ .getAllFTSDataColumns())
{
- if (field == PDBDocField.ALL)
+ if (field.getName().equalsIgnoreCase("ALL"))
{
continue;
}
--- /dev/null
+package jalview.gui;
+
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertTrue;
+
+import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+
+import java.util.List;
+
+import org.testng.annotations.Test;
+
+public class AlignFrameTest
+{
+
+ @Test
+ public void testHideFeatureColumns()
+ {
+ SequenceI seq1 = new Sequence("Seq1", "ABCDEFGHIJ");
+ SequenceI seq2 = new Sequence("Seq2", "ABCDEFGHIJ");
+ seq1.addSequenceFeature(new SequenceFeature("Metal", "", 1, 5,
+ Float.NaN, null));
+ seq2.addSequenceFeature(new SequenceFeature("Metal", "", 6, 10,
+ Float.NaN, null));
+ seq1.addSequenceFeature(new SequenceFeature("Turn", "", 2, 4,
+ Float.NaN, null));
+ seq2.addSequenceFeature(new SequenceFeature("Turn", "", 7, 9,
+ Float.NaN, null));
+ AlignmentI al = new Alignment(new SequenceI[] { seq1, seq2 });
+ AlignFrame af = new AlignFrame(al, al.getWidth(), al.getHeight());
+
+ /*
+ * hiding a feature not present does nothing
+ */
+ assertFalse(af.hideFeatureColumns("exon", true));
+ assertTrue(af.getViewport().getColumnSelection().isEmpty());
+ assertTrue(af.getViewport().getColumnSelection().getHiddenColumns()
+ .isEmpty());
+ assertFalse(af.hideFeatureColumns("exon", false));
+ assertTrue(af.getViewport().getColumnSelection().isEmpty());
+ assertTrue(af.getViewport().getColumnSelection().getHiddenColumns()
+ .isEmpty());
+
+ /*
+ * hiding a feature in all columns does nothing
+ */
+ assertFalse(af.hideFeatureColumns("Metal", true));
+ assertTrue(af.getViewport().getColumnSelection().isEmpty());
+ List<int[]> hidden = af.getViewport().getColumnSelection()
+ .getHiddenColumns();
+ assertTrue(hidden.isEmpty());
+
+ /*
+ * hide a feature present in some columns
+ * sequence positions [2-4], [7-9] are column positions
+ * [1-3], [6-8] base zero
+ */
+ assertTrue(af.hideFeatureColumns("Turn", true));
+ hidden = af.getViewport().getColumnSelection()
+ .getHiddenColumns();
+ assertEquals(2, hidden.size());
+ assertEquals(1, hidden.get(0)[0]);
+ assertEquals(3, hidden.get(0)[1]);
+ assertEquals(6, hidden.get(1)[0]);
+ assertEquals(8, hidden.get(1)[1]);
+ }
+}
sc.setStructuresDiscovered(true);
sc.populateFilterComboBox();
+ try
+ {
+ Thread.sleep(2000);
+ } catch (InterruptedException e)
+ {
+ e.printStackTrace();
+ }
optionsSize = sc.getCmbFilterOption().getItemCount();
assertTrue(optionsSize > 3); // if structures are found, filter options
// should be populated
import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertTrue;
+import jalview.api.FeatureRenderer;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.SequenceDummy;
sf = sfs[4];
assertEquals("Fer2 Status: True Positive Pfam 8_8%LINK%",
sf.description);
- assertEquals("Pfam 8_8|http://pfam.sanger.ac.uk/family/PF00111",
+ assertEquals("Pfam 8_8|http://pfam.xfam.org/family/PF00111",
sf.links.get(0).toString());
assertEquals(8, sf.begin);
assertEquals(83, sf.end);
sfs = al.getSequenceAt(2).getDatasetSequence().getSequenceFeatures();
assertEquals(1, sfs.length);
sf = sfs[0];
- assertEquals("uniprot", sf.description);
+ // ID used for description if available
+ assertEquals("$23", sf.description);
assertEquals(55, sf.begin);
assertEquals(130, sf.end);
assertEquals("uniprot", sf.featureGroup);
parseResult);
checkDatasetfromSimpleGff3(dataset);
}
+
+ @Test(groups = { "Functional" })
+ public void testPrintJalviewFormat() throws Exception
+ {
+ File f = new File("examples/uniref50.fa");
+ AlignmentI al = readAlignmentFile(f);
+ AlignFrame af = new AlignFrame(al, 500, 500);
+ Map<String, Object> colours = af.getFeatureRenderer()
+ .getFeatureColours();
+ String features = "METAL\tcc9900\n"
+ + "GAMMA-TURN\tred|0,255,255|20.0|95.0|below|66.0\n"
+ + "Pfam\tred\n"
+ + "STARTGROUP\tuniprot\n"
+ + "Iron\tFER_CAPAA\t-1\t39\t39\tMETAL\n"
+ + "Turn\tFER_CAPAA\t-1\t36\t38\tGAMMA-TURN\n"
+ + "<html>Pfam domain<a href=\"http://pfam.xfam.org/family/PF00111\">Pfam_3_4</a></html>\tFER_CAPAA\t-1\t20\t20\tPfam\n"
+ + "ENDGROUP\tuniprot\n";
+ FeaturesFile featuresFile = new FeaturesFile(features,
+ FormatAdapter.PASTE);
+ featuresFile.parse(al.getDataset(), colours, false);
+
+ /*
+ * first with no features displayed
+ */
+ FeatureRenderer fr = af.alignPanel.getFeatureRenderer();
+ Map<String, Object> visible = fr
+ .getDisplayedFeatureCols();
+ String exported = featuresFile.printJalviewFormat(
+ al.getSequencesArray(), visible);
+ String expected = "No Features Visible";
+ assertEquals(expected, exported);
+
+ /*
+ * set METAL (in uniprot group) and GAMMA-TURN visible, but not Pfam
+ */
+ fr.setVisible("METAL");
+ fr.setVisible("GAMMA-TURN");
+ visible = fr.getDisplayedFeatureCols();
+ exported = featuresFile.printJalviewFormat(al.getSequencesArray(),
+ visible);
+ expected = "METAL\tcc9900\n"
+ + "GAMMA-TURN\tff0000|00ffff|20.0|95.0|below|66.0\n"
+ + "\nSTARTGROUP\tuniprot\n"
+ + "Iron\tFER_CAPAA\t-1\t39\t39\tMETAL\t0.0\n"
+ + "Turn\tFER_CAPAA\t-1\t36\t38\tGAMMA-TURN\t0.0\n"
+ + "ENDGROUP\tuniprot\n";
+ assertEquals(expected, exported);
+
+ /*
+ * now set Pfam visible
+ */
+ fr.setVisible("Pfam");
+ visible = fr.getDisplayedFeatureCols();
+ exported = featuresFile.printJalviewFormat(al.getSequencesArray(),
+ visible);
+ /*
+ * note the order of feature types is uncontrolled - derives from
+ * FeaturesDisplayed.featuresDisplayed which is a HashSet
+ */
+ expected = "METAL\tcc9900\n"
+ + "Pfam\tff0000\n"
+ + "GAMMA-TURN\tff0000|00ffff|20.0|95.0|below|66.0\n"
+ + "\nSTARTGROUP\tuniprot\n"
+ + "Iron\tFER_CAPAA\t-1\t39\t39\tMETAL\t0.0\n"
+ + "Turn\tFER_CAPAA\t-1\t36\t38\tGAMMA-TURN\t0.0\n"
+ + "<html>Pfam domain<a href=\"http://pfam.xfam.org/family/PF00111\">Pfam_3_4</a></html>\tFER_CAPAA\t-1\t20\t20\tPfam\t0.0\n"
+ + "ENDGROUP\tuniprot\n";
+ assertEquals(expected, exported);
+ }
}
*/
package jalview.io;
+import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertTrue;
}
/**
- * Additional tests for (a) Jalview features file with no colour
- * specifications (old style 'groups' file) and (b) Jalview features file with
- * embedded GFF
+ * Additional tests for Jalview features file
*/
@Test(groups = "Functional")
public void testIdentify_featureFile()
{
IdentifyFile ider = new IdentifyFile();
- // Jalview format with features only, no feature colours
+ /*
+ * Jalview format with features only, no feature colours
+ */
String data = "Iron-sulfur (2Fe-2S)\tFER_CAPAA\t-1\t39\t39\tMETAL\n"
+ "Iron-phosphorus (2Fe-P)\tID_NOT_SPECIFIED\t2\t86\t87\tMETALLIC\n";
- Assert.assertEquals(IdentifyFile.FeaturesFile, ider.identify(data, AppletFormatAdapter.PASTE));
+ assertEquals(IdentifyFile.FeaturesFile,
+ ider.identify(data, AppletFormatAdapter.PASTE));
- // Jalview feature colour followed by GFF format feature data
+ /*
+ * Jalview feature colour followed by GFF format feature data
+ */
data = "METAL\tcc9900\n" + "GFF\n"
+ "FER_CAPAA\tuniprot\tMETAL\t44\t45\t4.0\t.\t.\n";
- Assert.assertEquals(IdentifyFile.FeaturesFile,
+ assertEquals(IdentifyFile.FeaturesFile,
+ ider.identify(data, AppletFormatAdapter.PASTE));
+
+ /*
+ * Feature with '<' in the name (JAL-2098)
+ */
+ data = "kD < 3\tred\n" + "Low kD\tFER_CAPAA\t-1\t39\t39\tkD < 3\n";
+ assertEquals(IdentifyFile.FeaturesFile,
ider.identify(data, AppletFormatAdapter.PASTE));
}
*/
assertTrue(Jalview2XML.isVersionStringLaterThan(null, null));
assertTrue(Jalview2XML.isVersionStringLaterThan("2.8.3", null));
+ assertTrue(Jalview2XML.isVersionStringLaterThan(null, "2.8.3"));
assertTrue(Jalview2XML.isVersionStringLaterThan(null,
"Development Build"));
assertTrue(Jalview2XML.isVersionStringLaterThan(null,
--- /dev/null
+package jalview.io;
+
+import static org.testng.AssertJUnit.assertEquals;
+
+import jalview.datamodel.SequenceFeature;
+
+import java.util.Hashtable;
+import java.util.Map;
+
+import org.testng.annotations.Test;
+
+public class SequenceAnnotationReportTest
+{
+ @Test(groups = "Functional")
+ public void testAppendFeature_disulfideBond()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ sb.append("123456");
+ SequenceFeature sf = new SequenceFeature("disulfide bond", "desc", 1,
+ 3, 1.2f, "group");
+
+ // residuePos == 2 does not match start or end of feature, nothing done:
+ sar.appendFeature(sb, 2, null, sf);
+ assertEquals("123456", sb.toString());
+
+ // residuePos == 1 matches start of feature, text appended (but no <br>)
+ // feature score is not included
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("123456disulfide bond 1:3", sb.toString());
+
+ // residuePos == 3 matches end of feature, text appended
+ // <br> is prefixed once sb.length() > 6
+ sar.appendFeature(sb, 3, null, sf);
+ assertEquals("123456disulfide bond 1:3<br>disulfide bond 1:3",
+ sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_status()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
+ Float.NaN, "group");
+ sf.setStatus("Confirmed");
+
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("METAL 1 3; Fe2-S; (Confirmed)", sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_withScore()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3, 1.3f,
+ "group");
+
+ Map<String, float[][]> minmax = new Hashtable<String, float[][]>();
+ sar.appendFeature(sb, 1, minmax, sf);
+ /*
+ * map has no entry for this feature type - score is not shown:
+ */
+ assertEquals("METAL 1 3; Fe2-S", sb.toString());
+
+ /*
+ * map has entry for this feature type - score is shown:
+ */
+ minmax.put("METAL", new float[][] { { 0f, 1f }, null });
+ sar.appendFeature(sb, 1, minmax, sf);
+ // <br> is appended to a buffer > 6 in length
+ assertEquals("METAL 1 3; Fe2-S<br>METAL 1 3; Fe2-S Score=1.3",
+ sb.toString());
+
+ /*
+ * map has min == max for this feature type - score is not shown:
+ */
+ minmax.put("METAL", new float[][] { { 2f, 2f }, null });
+ sb.setLength(0);
+ sar.appendFeature(sb, 1, minmax, sf);
+ assertEquals("METAL 1 3; Fe2-S", sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_noScore()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
+ Float.NaN, "group");
+
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("METAL 1 3; Fe2-S", sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_clinicalSignificance()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
+ Float.NaN, "group");
+ sf.setValue("clinical_significance", "Benign");
+
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("METAL 1 3; Fe2-S; Benign", sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_withScoreStatusClinicalSignificance()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3, 1.3f,
+ "group");
+ sf.setStatus("Confirmed");
+ sf.setValue("clinical_significance", "Benign");
+ Map<String, float[][]> minmax = new Hashtable<String, float[][]>();
+ minmax.put("METAL", new float[][] { { 0f, 1f }, null });
+ sar.appendFeature(sb, 1, minmax, sf);
+
+ assertEquals("METAL 1 3; Fe2-S Score=1.3; (Confirmed); Benign",
+ sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_DescEqualsType()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL", "METAL", 1, 3,
+ Float.NaN, "group");
+
+ // description is not included if it duplicates type:
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("METAL 1 3", sb.toString());
+
+ sb.setLength(0);
+ sf.setDescription("Metal");
+ // test is case-sensitive:
+ sar.appendFeature(sb, 1, null, sf);
+ assertEquals("METAL 1 3; Metal", sb.toString());
+ }
+
+ @Test(groups = "Functional")
+ public void testAppendFeature_stripHtml()
+ {
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ StringBuffer sb = new StringBuffer();
+ SequenceFeature sf = new SequenceFeature("METAL",
+ "<html><body>hello<em>world</em></body></html>", 1, 3,
+ Float.NaN, "group");
+
+ sar.appendFeature(sb, 1, null, sf);
+ // !! strips off </body> but not <body> ??
+ assertEquals("METAL 1 3; <body>hello<em>world</em>",
+ sb.toString());
+
+ sb.setLength(0);
+ sf.setDescription("<br>&kHD>6");
+ sar.appendFeature(sb, 1, null, sf);
+ // if no <html> tag, html-encodes > and < (only):
+ assertEquals("METAL 1 3; <br>&kHD>6", sb.toString());
+ }
+}
@Test(groups = { "Functional" })
public void compareTransferredToRefPDBAnnot() throws Exception
{
+ StructureViewSettings.setShowSeqFeatures(true);
AlignFrame ref = new FileLoader(false)
.LoadFileWaitTillLoaded("test/jalview/ext/jmol/1QCF.pdb",
jalview.io.FormatAdapter.FILE);
@BeforeMethod(alwaysRun = true)
public void setUp()
{
+ StructureViewSettings.setShowSeqFeatures(true);
ssm = new StructureSelectionManager();
}
assertEquals("#800080", ColorUtils.toTkCode(new Color(128, 0, 128))); // purple
assertEquals("#00ff00", ColorUtils.toTkCode(new Color(0, 255, 0))); // lime
}
+
+ @Test(groups = { "Functional" })
+ public void testGetGraduatedColour()
+ {
+ Color minColour = new Color(100, 100, 100);
+ Color maxColour = new Color(180, 200, 220);
+
+ /*
+ * value half-way between min and max
+ */
+ Color col = ColorUtils.getGraduatedColour(20f, 10f, minColour, 30f,
+ maxColour);
+ assertEquals(140, col.getRed());
+ assertEquals(150, col.getGreen());
+ assertEquals(160, col.getBlue());
+
+ /*
+ * value two-thirds of the way between min and max
+ */
+ col = ColorUtils
+ .getGraduatedColour(30f, 10f, minColour, 40f, maxColour);
+ assertEquals(153, col.getRed());
+ // Color constructor rounds float value to nearest int
+ assertEquals(167, col.getGreen());
+ assertEquals(180, col.getBlue());
+
+ /*
+ * value = min
+ */
+ col = ColorUtils
+ .getGraduatedColour(10f, 10f, minColour, 30f, maxColour);
+ assertEquals(minColour, col);
+
+ /*
+ * value = max
+ */
+ col = ColorUtils
+ .getGraduatedColour(30f, 10f, minColour, 30f, maxColour);
+ assertEquals(maxColour, col);
+
+ /*
+ * value < min
+ */
+ col = ColorUtils.getGraduatedColour(0f, 10f, minColour, 30f, maxColour);
+ assertEquals(minColour, col);
+
+ /*
+ * value > max
+ */
+ col = ColorUtils
+ .getGraduatedColour(40f, 10f, minColour, 30f,
+ maxColour);
+ assertEquals(maxColour, col);
+
+ /*
+ * min = max
+ */
+ col = ColorUtils
+ .getGraduatedColour(40f, 10f, minColour, 10f, maxColour);
+ assertEquals(minColour, col);
+ }
}
* AGCTU. Test is not case-sensitive and ignores gaps.
*/
@Test(groups = { "Functional" })
- public void testIsNucleotide()
+ public void testIsNucleotide_sequences()
{
SequenceI seq = new Sequence("eightypercent", "agctuAGCPV");
assertFalse(Comparison.isNucleotide(new SequenceI[] { seq }));
0.001f);
}
+ @Test(groups = { "Functional" })
+ public void testIsNucleotide()
+ {
+ assertTrue(Comparison.isNucleotide('a'));
+ assertTrue(Comparison.isNucleotide('A'));
+ assertTrue(Comparison.isNucleotide('c'));
+ assertTrue(Comparison.isNucleotide('C'));
+ assertTrue(Comparison.isNucleotide('g'));
+ assertTrue(Comparison.isNucleotide('G'));
+ assertTrue(Comparison.isNucleotide('t'));
+ assertTrue(Comparison.isNucleotide('T'));
+ assertTrue(Comparison.isNucleotide('u'));
+ assertTrue(Comparison.isNucleotide('U'));
+ assertFalse(Comparison.isNucleotide('-'));
+ assertFalse(Comparison.isNucleotide('P'));
+ }
+
/**
* Test the percentage identity calculation for two sequences
*/
assertEquals(87.5f, Comparison.PID(seq1, seq2, 0, length, false, true),
0.001f);
}
+
+ @Test(groups = { "Functional" })
+ public void testIsNucleotideSequence()
+ {
+ assertFalse(Comparison.isNucleotideSequence(null, true));
+ assertTrue(Comparison.isNucleotideSequence("", true));
+ assertTrue(Comparison.isNucleotideSequence("aAgGcCtTuU", true));
+ assertTrue(Comparison.isNucleotideSequence("aAgGcCtTuU", false));
+ assertFalse(Comparison.isNucleotideSequence("xAgGcCtTuU", false));
+ assertFalse(Comparison.isNucleotideSequence("aAgGcCtTuUx", false));
+ assertTrue(Comparison.isNucleotideSequence("a A-g.GcCtTuU", true));
+ assertFalse(Comparison.isNucleotideSequence("a A-g.GcCtTuU", false));
+ }
}
--- /dev/null
+package jalview.util;
+
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.fail;
+
+import java.util.List;
+
+import org.testng.annotations.Test;
+
+public class DnaUtilsTest
+{
+ /**
+ * Tests for parsing an ENA/GenBank location specifier
+ *
+ * @see http://www.insdc.org/files/feature_table.html#3.4
+ */
+ @Test(groups = { "Functional" })
+ public void testParseLocation()
+ {
+ /*
+ * single locus
+ */
+ List<int[]> ranges = DnaUtils.parseLocation("467");
+ assertEquals(1, ranges.size());
+ assertEquals(467, ranges.get(0)[0]);
+ assertEquals(467, ranges.get(0)[1]);
+
+ /*
+ * simple range
+ */
+ ranges = DnaUtils.parseLocation("12..78");
+ assertEquals(1, ranges.size());
+ assertEquals(12, ranges.get(0)[0]);
+ assertEquals(78, ranges.get(0)[1]);
+
+ /*
+ * join of simple ranges
+ */
+ ranges = DnaUtils.parseLocation("join(12..78,134..202,322..345)");
+ assertEquals(3, ranges.size());
+ assertEquals(12, ranges.get(0)[0]);
+ assertEquals(78, ranges.get(0)[1]);
+ assertEquals(134, ranges.get(1)[0]);
+ assertEquals(202, ranges.get(1)[1]);
+ assertEquals(322, ranges.get(2)[0]);
+ assertEquals(345, ranges.get(2)[1]);
+
+ /*
+ * complement of a simple range
+ */
+ ranges = DnaUtils.parseLocation("complement(34..126)");
+ assertEquals(1, ranges.size());
+ assertEquals(126, ranges.get(0)[0]);
+ assertEquals(34, ranges.get(0)[1]);
+
+ /*
+ * complement of a join
+ */
+ ranges = DnaUtils
+ .parseLocation("complement(join(2691..4571,4918..5163))");
+ assertEquals(2, ranges.size());
+ assertEquals(5163, ranges.get(0)[0]);
+ assertEquals(4918, ranges.get(0)[1]);
+ assertEquals(4571, ranges.get(1)[0]);
+ assertEquals(2691, ranges.get(1)[1]);
+
+ /*
+ * join of two complements
+ */
+ ranges = DnaUtils
+ .parseLocation("join(complement(4918..5163),complement(2691..4571))");
+ assertEquals(2, ranges.size());
+ assertEquals(5163, ranges.get(0)[0]);
+ assertEquals(4918, ranges.get(0)[1]);
+ assertEquals(4571, ranges.get(1)[0]);
+ assertEquals(2691, ranges.get(1)[1]);
+
+ /*
+ * join complement to non-complement
+ * @see http://www.ncbi.nlm.nih.gov/genbank/genomesubmit_annotation/ Transpliced Genes
+ */
+ ranges = DnaUtils
+ .parseLocation("join(complement(36618..36700),86988..87064)");
+ assertEquals(2, ranges.size());
+ assertEquals(36700, ranges.get(0)[0]);
+ assertEquals(36618, ranges.get(0)[1]);
+ assertEquals(86988, ranges.get(1)[0]);
+ assertEquals(87064, ranges.get(1)[1]);
+
+ /*
+ * beyond 5' or 3' locus
+ */
+ ranges = DnaUtils.parseLocation("<34..126");
+ assertEquals(1, ranges.size());
+ assertEquals(34, ranges.get(0)[0]);
+ assertEquals(126, ranges.get(0)[1]);
+ ranges = DnaUtils.parseLocation("35..>127");
+ assertEquals(1, ranges.size());
+ assertEquals(35, ranges.get(0)[0]);
+ assertEquals(127, ranges.get(0)[1]);
+
+ /*
+ * valid things we don't yet handle
+ */
+ assertNull(DnaUtils.parseLocation("34.126"));
+ assertNull(DnaUtils.parseLocation("34^126"));
+ assertNull(DnaUtils.parseLocation("order(34..126,130..180)"));
+
+ /*
+ * invalid things
+ */
+ assertNull(DnaUtils.parseLocation(""));
+ assertNull(DnaUtils.parseLocation("JOIN(1..2)"));
+ assertNull(DnaUtils.parseLocation("join(1..2"));
+ assertNull(DnaUtils.parseLocation("join(1..2("));
+ assertNull(DnaUtils.parseLocation("complement(1..2"));
+ assertNull(DnaUtils.parseLocation("complement(1..2("));
+ try
+ {
+ assertNull(DnaUtils.parseLocation(null));
+ fail("Expected exception");
+ } catch (NullPointerException e)
+ {
+ // expected
+ }
+
+ /*
+ * nested joins are not allowed; just as well since this fails to parse
+ * (splitting tokens by comma fragments the inner join expression)
+ */
+ assertNull(DnaUtils
+ .parseLocation("join(1..2,join(4..5,10..12),18..22)"));
+ /*
+ * complement may not enclose multiple ranges
+ * parsing fails for the same reason
+ */
+ assertNull(DnaUtils
+ .parseLocation("join(complement(36618..36700,4000..4200),86988..87064)"));
+ }
+
+}
assertEquals(0,
StringUtils.parseInt(String.valueOf(Integer.MAX_VALUE) + "1"));
}
+
+ @Test(groups = { "Functional" })
+ public void testCompareVersions()
+ {
+ assertEquals(0, StringUtils.compareVersions(null, null));
+ assertEquals(0, StringUtils.compareVersions("2.8.3", null));
+
+ /*
+ * same version returns 0
+ */
+ assertEquals(0, StringUtils.compareVersions("2.8", "2.8"));
+ assertEquals(0, StringUtils.compareVersions("2.8.3", "2.8.3"));
+ assertEquals(0, StringUtils.compareVersions("2.8.3b1", "2.8.3b1", "b"));
+ assertEquals(0, StringUtils.compareVersions("2.8.3B1", "2.8.3b1", "b"));
+ assertEquals(0, StringUtils.compareVersions("2.8.3b1", "2.8.3B1", "b"));
+
+ /*
+ * v1 < v2 returns -1
+ */
+ assertEquals(-1, StringUtils.compareVersions("2.8.3", "2.8.4"));
+ assertEquals(-1, StringUtils.compareVersions("2.8.3", "2.9"));
+ assertEquals(-1, StringUtils.compareVersions("2.8.3", "2.9.2"));
+ assertEquals(-1, StringUtils.compareVersions("2.8", "2.8.3"));
+ assertEquals(-1, StringUtils.compareVersions("2.8.3", "2.8.3b1", "b"));
+ assertEquals(-1, StringUtils.compareVersions("2.8.3b1", "2.8.3b2", "b"));
+ assertEquals(-1, StringUtils.compareVersions("2.8", "2.8.0", "b"));
+ assertEquals(-1, StringUtils.compareVersions("2", "12"));
+ assertEquals(-1, StringUtils.compareVersions("3.2.4", "3.12.11"));
+
+ /*
+ * v1 > v2 returns +1
+ */
+ assertEquals(1, StringUtils.compareVersions("2.8.3", "2.8"));
+ assertEquals(1, StringUtils.compareVersions("2.8.0", "2.8"));
+ assertEquals(1, StringUtils.compareVersions("2.8.4", "2.8.3"));
+ assertEquals(1, StringUtils.compareVersions("2.8.3b1", "2.8.3", "b"));
+ assertEquals(1, StringUtils.compareVersions("2.8.3", "2.8.2b1", "b"));
+ assertEquals(1, StringUtils.compareVersions("2.8.0b2", "2.8.0b1", "b"));
+ assertEquals(1, StringUtils.compareVersions("12", "2"));
+ assertEquals(1, StringUtils.compareVersions("3.12.11", "3.2.4"));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testToSentenceCase()
+ {
+ assertEquals("John", StringUtils.toSentenceCase("john"));
+ assertEquals("John", StringUtils.toSentenceCase("JOHN"));
+ assertEquals("John and james",
+ StringUtils.toSentenceCase("JOHN and JAMES"));
+ assertEquals("J", StringUtils.toSentenceCase("j"));
+ assertEquals("", StringUtils.toSentenceCase(""));
+ assertNull(StringUtils.toSentenceCase(null));
+ }
}
--- /dev/null
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
+package jalview.ws.dbsources;
+
+import jalview.datamodel.AlignmentI;
+
+import org.testng.Assert;
+import org.testng.annotations.Test;
+
+public class XfamFetcherTest
+{
+ @Test(groups = { "External" })
+ public void testRfamSeed() throws Exception
+ {
+ // RfamFull rff = new RfamFull();
+ RfamSeed rfs = new RfamSeed();
+
+ AlignmentI seedrf = rfs.getSequenceRecords(rfs.getTestQuery());
+ Assert.assertNotNull(seedrf, "Seed Alignment for " + rfs.getTestQuery()
+ + " didn't retrieve.");
+ Assert.assertTrue(seedrf.getHeight() > 1,
+ "Seed Alignment for " + rfs.getTestQuery()
+ + " didn't contain more than one sequence.");
+ }
+
+ @Test(groups = { "External" })
+ public void testPfamFullAndSeed() throws Exception
+ {
+ PfamFull pff = new PfamFull();
+ PfamSeed pfseed = new PfamSeed();
+
+ AlignmentI fullpf = pff.getSequenceRecords(pff.getTestQuery());
+ Assert.assertNotNull(fullpf, "Full Alignment for " + pff.getTestQuery()
+ + " didn't retrieve.");
+ Assert.assertTrue(fullpf.getHeight() > 1,
+ "Full Alignment for " + pff.getTestQuery()
+ + " didn't have more than one sequence.");
+ AlignmentI seedpf = pfseed.getSequenceRecords(pff.getTestQuery());
+ Assert.assertNotNull(seedpf, "Seed Alignment for " + pff.getTestQuery()
+ + " didn't retrieve.");
+
+ Assert.assertTrue(seedpf.getHeight() < fullpf.getHeight(),
+ "Expected Full alignment to have more sequences than seed for "
+ + pff.getTestQuery());
+ }
+}
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
-@Test(groups = { "Network" })
+@Test(groups = { "External" })
public class DisorderAnnotExportImport
{
public static String testseqs = "examples/uniref50.fa";
<string><![CDATA[664]]></string>
</property>
<property name="sourceName">
- <string><![CDATA[groovy-all-1.8.2.jar]]></string>
+ <string><![CDATA[groovy-all-2.4.6-indy.jar]]></string>
</property>
<property name="overrideUnixPermissions">
<boolean>false</boolean>
<boolean>true</boolean>
</property>
<property name="destinationName">
- <string><![CDATA[groovy-all-1.8.2.jar]]></string>
+ <string><![CDATA[groovy-all-2.4.6-indy.jar]]></string>
</property>
<property name="fileSize">
<long>6149494</long>
</property>
</object>
</method>
+ <method name="addElement">
+ <object class="com.zerog.ia.installer.actions.InstallZipfile" objectID="1000ddddfab939">
+ <property name="belongsToUninstallPhase">
+ <boolean>false</boolean>
+ </property>
+ <property name="rollbackEnabledCancel">
+ <boolean>true</boolean>
+ </property>
+ <property name="rollbackEnabledError">
+ <boolean>true</boolean>
+ </property>
+ <property name="ruleExpression">
+ <string><![CDATA[]]></string>
+ </property>
+ <property name="unixPermissions">
+ <string><![CDATA[664]]></string>
+ </property>
+ <property name="sourceName">
+ <string><![CDATA[servlet-api-3.1.jar]]></string>
+ </property>
+ <property name="overrideUnixPermissions">
+ <boolean>false</boolean>
+ </property>
+ <property name="sourcePath">
+ <string><![CDATA[/home/cruisecontrol/jalview/lib/]]></string>
+ </property>
+ <property name="shouldUninstall">
+ <boolean>true</boolean>
+ </property>
+ <property name="rollbackEnabledCancel">
+ <boolean>true</boolean>
+ </property>
+ <property name="rollbackEnabledError">
+ <boolean>true</boolean>
+ </property>
+ <property name="destinationName">
+ <string><![CDATA[servlet-api-3.1.jar]]></string>
+ </property>
+ <property name="fileSize">
+ <long>16046</long>
+ </property>
+ <property name="macBinary">
+ <boolean>false</boolean>
+ </property>
+ <property name="targetCheckKind">
+ <int>0</int>
+ </property>
+ <property name="ruleExpression">
+ <string><![CDATA[]]></string>
+ </property>
+ </object>
+ </method>
</object>
</property>
<property name="rulesFailedMessage">
<object refID="1f46efeefab93"/>
<object refID="1936efeefab93"/>
<object refID="1000ddddfab93"/>
+ <object refID="1000ddddfab939"/>
<object refID="10936efeefab93"/>
<object refID="11936efeefab93"/>
<object refID="12936efeefab93"/>
<object refID="1f46efeefab93"/>
<object refID="1936efeefab93"/>
<object refID="1000ddddfab93"/>
+ <object refID="1000ddddfab939"/>
<object refID="10936efeefab93"/>
<object refID="11936efeefab93"/>
<object refID="12936efeefab93"/>
git://source.jalview.org / jalview.git / commitdiff
