JAL-3700 additions and corrections to unit tests

 (trivial) Conflicts:
	test/jalview/util/MappingUtilsTest.java

diff --git a/src/jalview/datamodel/AlignedCodonFrame.java b/src/jalview/datamodel/AlignedCodonFrame.java
index 25f1c27..96c9792 100644 (file)
--- a/src/jalview/datamodel/AlignedCodonFrame.java
+++ b/src/jalview/datamodel/AlignedCodonFrame.java
@@ -20,13 +20,13 @@
  */
 package jalview.datamodel;
 
-import jalview.util.MapList;
-import jalview.util.MappingUtils;
-
 import java.util.AbstractList;
 import java.util.ArrayList;
 import java.util.List;
 
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
+
 /**
  * Stores mapping between the columns of a protein alignment and a DNA alignment
  * and a list of individual codon to amino acid mappings between sequences.
@@ -163,7 +163,7 @@ public class AlignedCodonFrame
       }
 
       /*
-       * check that each mapped range lieS with the sequence range
+       * check that each mapped range lies within the sequence range
        * (necessary for circular CDS - example EMBL:J03321:AAA91567)
        * and mapped length covers (at least) sequence length
        */

diff --git a/test/jalview/datamodel/AlignedCodonFrameTest.java b/test/jalview/datamodel/AlignedCodonFrameTest.java
index fb4073a..e3fa027 100644 (file)
--- a/test/jalview/datamodel/AlignedCodonFrameTest.java
+++ b/test/jalview/datamodel/AlignedCodonFrameTest.java
@@ -22,20 +22,22 @@ package jalview.datamodel;
 
 import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertNotNull;
 import static org.testng.AssertJUnit.assertNull;
 import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
-import jalview.gui.JvOptionPane;
-import jalview.util.MapList;
-
 import java.util.Arrays;
 import java.util.List;
 
 import org.testng.annotations.BeforeClass;
 import org.testng.annotations.Test;
 
+import jalview.datamodel.AlignedCodonFrame.SequenceToSequenceMapping;
+import jalview.gui.JvOptionPane;
+import jalview.util.MapList;
+
 public class AlignedCodonFrameTest
 {
 
@@ -486,4 +488,61 @@ public class AlignedCodonFrameTest
     assertEquals(1, acf.getMappingsFromSequence(seq1).size());
     assertSame(before, acf.getMappingsFromSequence(seq1).get(0));
   }
+  
+  @Test(groups = { "Functional" })
+  public void testGetCoveringMapping()
+  {
+    SequenceI dna = new Sequence("dna", "acttcaATGGCGGACtaattt");
+    SequenceI cds = new Sequence("cds/7-15", "ATGGCGGAC");
+    cds.setDatasetSequence(dna);
+    SequenceI pep = new Sequence("pep", "MAD");
+    
+    /*
+     * with null argument or no mappings
+     */
+    AlignedCodonFrame acf = new AlignedCodonFrame();
+    assertNull(acf.getCoveringMapping(null,  null));
+    assertNull(acf.getCoveringMapping(dna,  null));
+    assertNull(acf.getCoveringMapping(null,  pep));
+    assertNull(acf.getCoveringMapping(dna,  pep));
+
+    /*
+     * with a non-covering mapping e.g. overlapping exon
+     */
+    MapList map = new MapList(new int[] { 7, 9 }, new int[] {
+        1, 1 }, 3, 1);
+    acf.addMap(dna, pep, map);
+    assertNull(acf.getCoveringMapping(dna,  pep));
+    
+    acf = new AlignedCodonFrame();
+    MapList map2 = new MapList(new int[] { 13, 18 }, new int[] {
+        2, 2 }, 3, 1);
+    acf.addMap(dna, pep, map2);
+    assertNull(acf.getCoveringMapping(dna,  pep));
+    
+    /*
+     * with a covering mapping from CDS (dataset) to protein
+     */
+    acf = new AlignedCodonFrame();
+    MapList map3 = new MapList(new int[] { 7, 15 }, new int[] {
+        1, 3 }, 3, 1);
+    acf.addMap(dna, pep, map3);
+    assertNull(acf.getCoveringMapping(dna,  pep));
+    SequenceToSequenceMapping mapping = acf.getCoveringMapping(cds,  pep);
+    assertNotNull(mapping);
+    
+    /*
+     * with a mapping that extends to stop codon
+     */
+    acf = new AlignedCodonFrame();
+    MapList map4 = new MapList(new int[] { 7, 18 }, new int[] {
+        1, 3 }, 3, 1);
+    acf.addMap(dna, pep, map4);
+    assertNull(acf.getCoveringMapping(dna,  pep));
+    assertNull(acf.getCoveringMapping(cds,  pep));
+    SequenceI cds2 = new Sequence("cds/7-18", "ATGGCGGACtaa");
+    cds2.setDatasetSequence(dna);
+    mapping = acf.getCoveringMapping(cds2,  pep);
+    assertNotNull(mapping);
+  }
 }

diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java
index dd789d6..813edf8 100644 (file)
--- a/test/jalview/util/MappingUtilsTest.java
+++ b/test/jalview/util/MappingUtilsTest.java
@@ -26,6 +26,16 @@ import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.AssertJUnit.fail;
 
+import java.awt.Color;
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Iterator;
+import java.util.List;
+
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
 import jalview.api.AlignViewportI;
 import jalview.commands.EditCommand;
 import jalview.commands.EditCommand.Action;
@@ -47,16 +57,6 @@ import jalview.io.FileFormat;
 import jalview.io.FileFormatI;
 import jalview.io.FormatAdapter;
 
-import java.awt.Color;
-import java.io.IOException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Iterator;
-import java.util.List;
-
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
-
 public class MappingUtilsTest
 {
 
@@ -90,8 +90,9 @@ public class MappingUtilsTest
     MapList map = new MapList(new int[] { 5, 10 }, new int[] { 12, 13 }, 3,
             1);
     acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map);
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     /*
      * Check protein residue 12 maps to codon 5-7, 13 to codon 8-10
@@ -140,11 +141,14 @@ public class MappingUtilsTest
      * Map dna bases [6, 8, 9], [11, 13, 115] to protein residues 8 and 9
      */
     AlignedCodonFrame acf = new AlignedCodonFrame();
-    MapList map = new MapList(new int[] { 6, 6, 8, 9, 11, 11, 13, 13, 15,
-        15 }, new int[] { 8, 9 }, 3, 1);
+    MapList map = new MapList(
+            new int[]
+            { 6, 6, 8, 9, 11, 11, 13, 13, 15, 15 }, new int[] { 8, 9 }, 3,
+            1);
     acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map);
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     /*
      * Check protein residue 8 maps to [6, 8, 9]
@@ -184,8 +188,8 @@ public class MappingUtilsTest
     for (int i = 5; i < 18; i++)
     {
       sr = MappingUtils.buildSearchResults(seq1, i, acfList);
-      int residue = (i == 6 || i == 8 || i == 9) ? 8 : (i == 11 || i == 13
-              || i == 15 ? 9 : 0);
+      int residue = (i == 6 || i == 8 || i == 9) ? 8
+              : (i == 11 || i == 13 || i == 15 ? 9 : 0);
       if (residue == 0)
       {
         assertEquals(0, sr.getResults().size());
@@ -221,18 +225,19 @@ public class MappingUtilsTest
     MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 1 }, 3, 1);
     for (int seq = 0; seq < 3; seq++)
     {
-      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
-              .getSequenceAt(seq).getDatasetSequence(), map);
+      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+              protein.getSequenceAt(seq).getDatasetSequence(), map);
     }
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     AlignViewportI dnaView = new AlignViewport(cdna);
     AlignViewportI proteinView = new AlignViewport(protein);
     protein.setCodonFrames(acfList);
 
     /*
-     * Select Seq1 and Seq3 in the protein (startRes=endRes=0)
+     * Select Seq1 and Seq3 in the protein
      */
     SequenceGroup sg = new SequenceGroup();
     sg.setColourText(true);
@@ -240,6 +245,7 @@ public class MappingUtilsTest
     sg.setOutlineColour(Color.LIGHT_GRAY);
     sg.addSequence(protein.getSequenceAt(0), false);
     sg.addSequence(protein.getSequenceAt(2), false);
+    sg.setEndRes(protein.getWidth() - 1);
 
     /*
      * Verify the mapped sequence group in dna
@@ -253,7 +259,7 @@ public class MappingUtilsTest
     assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0));
     assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1));
     assertEquals(0, mappedGroup.getStartRes());
-    assertEquals(2, mappedGroup.getEndRes());
+    assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon)
 
     /*
      * Verify mapping sequence group from dna to protein
@@ -286,8 +292,8 @@ public class MappingUtilsTest
   protected AlignmentI loadAlignment(final String data, FileFormatI format)
           throws IOException
   {
-    AlignmentI a = new FormatAdapter().readFile(data,
-            DataSourceType.PASTE, format);
+    AlignmentI a = new FormatAdapter().readFile(data, DataSourceType.PASTE,
+            format);
     a.setDataset(null);
     return a;
   }
@@ -332,8 +338,8 @@ public class MappingUtilsTest
     cs.clear();
     colsel.clear();
     colsel.addElement(2);
-    MappingUtils.mapColumnSelection(colsel, hidden, proteinView,
-            dnaView, cs, hs);
+    MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+            cs, hs);
     assertEquals("[]", cs.getSelected().toString());
 
     /*
@@ -343,8 +349,8 @@ public class MappingUtilsTest
     cs.clear();
     colsel.clear();
     colsel.addElement(3);
-    MappingUtils.mapColumnSelection(colsel, hidden, proteinView,
-            dnaView, cs, hs);
+    MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+            cs, hs);
     assertEquals("[5, 6, 7, 8, 9, 10]", cs.getSelected().toString());
 
     /*
@@ -355,10 +361,10 @@ public class MappingUtilsTest
     colsel.clear();
     colsel.addElement(1);
     colsel.addElement(3);
-    MappingUtils.mapColumnSelection(colsel, hidden, proteinView,
-            dnaView, cs, hs);
-    assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]", cs.getSelected()
-            .toString());
+    MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView,
+            cs, hs);
+    assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]",
+            cs.getSelected().toString());
   }
 
   /**
@@ -387,23 +393,27 @@ public class MappingUtilsTest
     // map first dna to first protein seq
     AlignedCodonFrame acf = new AlignedCodonFrame();
     MapList map = new MapList(new int[] { 10, 12, 15, 15, 17, 18 },
-            new int[] { 40, 41 }, 3, 1);
-    acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(), protein
-            .getSequenceAt(0).getDatasetSequence(), map);
+            new int[]
+            { 40, 41 }, 3, 1);
+    acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(),
+            protein.getSequenceAt(0).getDatasetSequence(), map);
 
     // map second dna to second protein seq
-    map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 }, new int[] { 50,
-        51 }, 3, 1);
-    acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(), protein
-            .getSequenceAt(1).getDatasetSequence(), map);
+    map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 },
+            new int[]
+            { 50, 51 }, 3, 1);
+    acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(),
+            protein.getSequenceAt(1).getDatasetSequence(), map);
 
     // map third dna to third protein seq
-    map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 }, new int[] { 60,
-        61 }, 3, 1);
-    acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(), protein
-            .getSequenceAt(2).getDatasetSequence(), map);
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 },
+            new int[]
+            { 60, 61 }, 3, 1);
+    acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(),
+            protein.getSequenceAt(2).getDatasetSequence(), map);
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     dnaView = new AlignViewport(cdna);
     proteinView = new AlignViewport(protein);
@@ -466,24 +476,21 @@ public class MappingUtilsTest
   public void testFlattenRanges()
   {
     assertEquals("[1, 2, 3, 4]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4 })));
-    assertEquals(
-            "[1, 2, 3, 4]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 2, 3,
-                4 })));
-    assertEquals(
-            "[1, 2, 3, 4]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 1, 2,
-                2, 3, 3, 4, 4 })));
-    assertEquals(
-            "[1, 2, 3, 4, 7, 8, 9, 12]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7,
-                9, 12, 12 })));
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 1, 4 })));
+    assertEquals("[1, 2, 3, 4]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 1, 2, 3, 4 })));
+    assertEquals("[1, 2, 3, 4]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 1, 1, 2, 2, 3, 3, 4, 4 })));
+    assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 1, 4, 7, 9, 12, 12 })));
     // trailing unpaired start position is ignored:
-    assertEquals(
-            "[1, 2, 3, 4, 7, 8, 9, 12]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7,
-                9, 12, 12, 15 })));
+    assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 1, 4, 7, 9, 12, 12, 15 })));
   }
 
   /**
@@ -509,11 +516,12 @@ public class MappingUtilsTest
     MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1);
     for (int seq = 0; seq < 3; seq++)
     {
-      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
-              .getSequenceAt(seq).getDatasetSequence(), map);
+      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+              protein.getSequenceAt(seq).getDatasetSequence(), map);
     }
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     AlignViewportI dnaView = new AlignViewport(cdna);
     AlignViewportI proteinView = new AlignViewport(protein);
@@ -586,17 +594,19 @@ public class MappingUtilsTest
             FileFormat.Fasta);
     cdna.setDataset(null);
     AlignmentI protein = loadAlignment(
-            ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", FileFormat.Fasta);
+            ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n",
+            FileFormat.Fasta);
     protein.setDataset(null);
     AlignedCodonFrame acf = new AlignedCodonFrame();
     MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
     for (int seq = 0; seq < 3; seq++)
     {
-      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein
-              .getSequenceAt(seq).getDatasetSequence(), map);
+      acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(),
+              protein.getSequenceAt(seq).getDatasetSequence(), map);
     }
-    List<AlignedCodonFrame> acfList = Arrays.asList(new AlignedCodonFrame[]
-    { acf });
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
 
     AlignViewportI dnaView = new AlignViewport(cdna);
     AlignViewportI proteinView = new AlignViewport(protein);
@@ -699,8 +709,8 @@ public class MappingUtilsTest
     /*
      * Seq1 has three mappings
      */
-    List<AlignedCodonFrame> result = MappingUtils.findMappingsForSequence(
-            seq1, mappings);
+    List<AlignedCodonFrame> result = MappingUtils
+            .findMappingsForSequence(seq1, mappings);
     assertEquals(3, result.size());
     assertTrue(result.contains(acf1));
     assertTrue(result.contains(acf2));
@@ -777,22 +787,22 @@ public class MappingUtilsTest
      */
     List<AlignedCodonFrame> result = MappingUtils
             .findMappingsForSequenceAndOthers(null, mappings,
-                    Arrays.asList(new SequenceI[] { seq1, seq2 }));
+                    Arrays.asList(new SequenceI[]
+                    { seq1, seq2 }));
     assertTrue(result.isEmpty());
 
     result = MappingUtils.findMappingsForSequenceAndOthers(seq1, null,
-            Arrays.asList(new SequenceI[] { seq1, seq2 }));
+            Arrays.asList(new SequenceI[]
+            { seq1, seq2 }));
     assertTrue(result.isEmpty());
 
     /*
      * Seq1 has three mappings, but filter argument will only accept
      * those to seq2
      */
-    result = MappingUtils.findMappingsForSequenceAndOthers(
-            seq1,
-            mappings,
-            Arrays.asList(new SequenceI[] { seq1, seq2,
-                seq1.getDatasetSequence() }));
+    result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings,
+            Arrays.asList(new SequenceI[]
+            { seq1, seq2, seq1.getDatasetSequence() }));
     assertEquals(2, result.size());
     assertTrue(result.contains(acf1));
     assertTrue(result.contains(acf2));
@@ -821,7 +831,8 @@ public class MappingUtilsTest
     dna.createDatasetSequence();
     protein.createDatasetSequence();
     AlignedCodonFrame acf = new AlignedCodonFrame();
-    MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3, 1);
+    MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3,
+            1);
     acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
     List<AlignedCodonFrame> mappings = new ArrayList<>();
     mappings.add(acf);
@@ -836,7 +847,8 @@ public class MappingUtilsTest
      */
     EditCommand ec = new EditCommand();
     final Edit edit = ec.new Edit(Action.INSERT_GAP,
-            new SequenceI[] { protein }, 4, 2, '-');
+            new SequenceI[]
+            { protein }, 4, 2, '-');
     ec.appendEdit(edit, prot, true, null);
 
     /*
@@ -862,34 +874,29 @@ public class MappingUtilsTest
   public void testFlattenRanges_reverseStrand()
   {
     assertEquals("[4, 3, 2, 1]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 1 })));
-    assertEquals(
-            "[4, 3, 2, 1]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 3, 2,
-                1 })));
-    assertEquals(
-            "[4, 3, 2, 1]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 4, 3,
-                3, 2, 2, 1, 1 })));
-    assertEquals(
-            "[12, 9, 8, 7, 4, 3, 2, 1]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12,
-                9, 7, 4, 1 })));
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 4, 1 })));
+    assertEquals("[4, 3, 2, 1]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 4, 3, 2, 1 })));
+    assertEquals("[4, 3, 2, 1]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 4, 4, 3, 3, 2, 2, 1, 1 })));
+    assertEquals("[12, 9, 8, 7, 4, 3, 2, 1]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 12, 12, 9, 7, 4, 1 })));
     // forwards and backwards anyone?
-    assertEquals(
-            "[4, 5, 6, 3, 2, 1]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 6, 3,
-                1 })));
+    assertEquals("[4, 5, 6, 3, 2, 1]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 4, 6, 3, 1 })));
     // backwards and forwards
-    assertEquals(
-            "[3, 2, 1, 4, 5, 6]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 3, 1, 4,
-                6 })));
+    assertEquals("[3, 2, 1, 4, 5, 6]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 3, 1, 4, 6 })));
     // trailing unpaired start position is ignored:
-    assertEquals(
-            "[12, 9, 8, 7, 4, 3, 2]",
-            Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12,
-                9, 7, 4, 2, 1 })));
+    assertEquals("[12, 9, 8, 7, 4, 3, 2]",
+            Arrays.toString(MappingUtils.flattenRanges(new int[]
+            { 12, 12, 9, 7, 4, 2, 1 })));
   }
 
   /**
@@ -1157,85 +1164,115 @@ public class MappingUtilsTest
     /*
      * both forward ranges
      */
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        1, 10 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        2, 10 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        1, 9 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        4, 5 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        0, 9 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        -10, -9 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        1, 11 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        11, 12 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 1, 10 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 2, 10 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 1, 9 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 4, 5 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 0, 9 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { -10, -9 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 1, 11 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 11, 12 }));
 
     /*
      * forward range, reverse query
      */
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        10, 1 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        9, 1 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        10, 2 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        5, 5 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        11, 1 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] {
-        10, 0 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 10, 1 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 9, 1 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 10, 2 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 5, 5 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 11, 1 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 10, 0 }));
 
     /*
      * reverse range, forward query
      */
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        1, 10 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        1, 9 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        2, 10 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        6, 6 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        6, 11 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        11, 20 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        -3, -2 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 1, 10 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 1, 9 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 2, 10 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 6, 6 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 6, 11 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 11, 20 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { -3, -2 }));
 
     /*
      * both reverse
      */
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        10, 1 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        9, 1 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        10, 2 }));
-    assertTrue(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        3, 3 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        11, 1 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        10, 0 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        12, 11 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] {
-        -5, -8 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 10, 1 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 9, 1 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 10, 2 }));
+    assertTrue(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 3, 3 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 11, 1 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 10, 0 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { 12, 11 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 10, 1 }, new int[] { -5, -8 }));
 
     /*
      * bad arguments
      */
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10, 12 },
-            new int[] {
-        1, 10 }));
-    assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 },
-            new int[] { 1 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10, 12 }, new int[] { 1, 10 }));
+    assertFalse(
+            MappingUtils.rangeContains(new int[]
+            { 1, 10 }, new int[] { 1 }));
     assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null));
     assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 }));
   }
@@ -1314,4 +1351,101 @@ public class MappingUtilsTest
       // expected
     }
   }
+
+  /**
+   * Test mapping a sequence group where sequences in and outside the group
+   * share a dataset sequence (e.g. alternative CDS for the same gene)
+   * 
+   * @throws IOException
+   */
+  @Test(groups = { "Functional" })
+  public void testMapSequenceGroup_sharedDataset() throws IOException
+  {
+    /*
+     * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+     * viewport). CDS sequences share the same 'gene' dataset sequence.
+     */
+    SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+    SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+    SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+    SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+    cds1.setDatasetSequence(dna);
+    cds2.setDatasetSequence(dna);
+    cds3.setDatasetSequence(dna);
+
+    SequenceI pep1 = new Sequence("pep1", "KF");
+    SequenceI pep2 = new Sequence("pep2", "FG");
+    SequenceI pep3 = new Sequence("pep3", "GP");
+
+    /*
+     * add mappings from coding positions of dna to respective peptides
+     */
+    AlignedCodonFrame acf = new AlignedCodonFrame();
+    acf.addMap(dna, pep1,
+            new MapList(new int[]
+            { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+    acf.addMap(dna, pep2,
+            new MapList(new int[]
+            { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+    acf.addMap(dna, pep3,
+            new MapList(new int[]
+            { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
+
+    AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+    AlignmentI protein = new Alignment(
+            new SequenceI[]
+            { pep1, pep2, pep3 });
+    AlignViewportI cdnaView = new AlignViewport(cdna);
+    AlignViewportI proteinView = new AlignViewport(protein);
+    protein.setCodonFrames(acfList);
+
+    /*
+     * Select pep1 and pep3 in the protein alignment
+     */
+    SequenceGroup sg = new SequenceGroup();
+    sg.setColourText(true);
+    sg.setIdColour(Color.GREEN);
+    sg.setOutlineColour(Color.LIGHT_GRAY);
+    sg.addSequence(pep1, false);
+    sg.addSequence(pep3, false);
+    sg.setEndRes(protein.getWidth() - 1);
+
+    /*
+     * Verify the mapped sequence group in dna is cds1 and cds3
+     */
+    SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+            proteinView, cdnaView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(2, mappedGroup.getSequences().size());
+    assertSame(cds1, mappedGroup.getSequences().get(0));
+    assertSame(cds3, mappedGroup.getSequences().get(1));
+    // columns 1-6 selected (0-5 base zero)
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(5, mappedGroup.getEndRes());
+
+    /*
+     * Select mapping sequence group from dna to protein
+     */
+    sg.clear();
+    sg.addSequence(cds2, false);
+    sg.addSequence(cds1, false);
+    sg.setStartRes(0);
+    sg.setEndRes(cdna.getWidth() - 1);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, proteinView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(2, mappedGroup.getSequences().size());
+    assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+    assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(1, mappedGroup.getEndRes()); // two columns
+  }
 }