JAL-653 code tidy / tests for 'realise gff mappings'

diff --git a/src/jalview/gui/AlignViewport.java b/src/jalview/gui/AlignViewport.java
index 5944b80..9ee88db 100644 (file)
--- a/src/jalview/gui/AlignViewport.java
+++ b/src/jalview/gui/AlignViewport.java
@@ -863,17 +863,6 @@ public class AlignViewport extends AlignmentViewport implements
      */
     if (Cache.getDefault(Preferences.ENABLE_SPLIT_FRAME, true))
     {
-      // if (toAdd.getDataset() == null)
-      // {
-      // // need to create ds seqs
-      // for (SequenceI sq : toAdd.getSequences())
-      // {
-      // if (sq.getDatasetSequence() == null)
-      // {
-      // sq.createDatasetSequence();
-      // }
-      // }
-      // }
       if (AlignmentUtils.isMappable(toAdd, getAlignment()))
       {
         if (openLinkedAlignment(toAdd, title))
@@ -919,9 +908,9 @@ public class AlignViewport extends AlignmentViewport implements
   }
 
   /**
-   * If the alignment holds any mappings to a dummy (placeholder) sequence that
-   * matches the given sequence, then update the mapping to point to the
-   * sequence. Returns the number of mappings updated.
+   * If the alignment holds any mappings to a virtual (placeholder) sequence
+   * that matches all or part of the given sequence, then update the mapping to
+   * point to the sequence. Returns the number of mappings updated.
    * 
    * @param al
    * @param seq
@@ -930,8 +919,7 @@ public class AlignViewport extends AlignmentViewport implements
   protected int realiseMappingsTo(AlignmentI al, SequenceI seq)
   {
     int count = 0;
-    Set<AlignedCodonFrame> mappings = al.getDataset().getCodonFrames();
-    // TODO are mappings on alignment or alignment dataset?!?
+    Set<AlignedCodonFrame> mappings = al.getCodonFrames();
     for (AlignedCodonFrame mapping : mappings)
     {
       /*

diff --git a/test/jalview/datamodel/AlignedCodonFrameTest.java b/test/jalview/datamodel/AlignedCodonFrameTest.java
index 69e584a..4984e5e 100644 (file)
--- a/test/jalview/datamodel/AlignedCodonFrameTest.java
+++ b/test/jalview/datamodel/AlignedCodonFrameTest.java
@@ -23,6 +23,7 @@ package jalview.datamodel;
 import static org.testng.AssertJUnit.assertEquals;
 import static org.testng.AssertJUnit.assertFalse;
 import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 
 import jalview.util.MapList;
@@ -213,6 +214,10 @@ public class AlignedCodonFrameTest
             17));
   }
 
+  /**
+   * Tests for the method that tests whether any mapping to a dummy sequence can
+   * be 'realised' to a given real sequence
+   */
   @Test(groups = { "Functional" })
   public void testIsRealisableWith()
   {
@@ -238,27 +243,69 @@ public class AlignedCodonFrameTest
     seq1proxy.setName("Seq1a");
     assertFalse(acf.isRealisableWith(seq1));
     seq1proxy.setName("Seq1");
-    seq1.setName("Seq1a");
+
+    SequenceI seq1ds = seq1.getDatasetSequence();
+    seq1ds.setName("Seq1a");
     assertFalse(acf.isRealisableWith(seq1));
-    seq1.setName("Seq1");
+    seq1ds.setName("Seq1");
 
     /*
      * test should fail if no sequence overlap with mapping of bases 7-12
      * use artificial start/end values to test this
      */
-    seq1.setStart(1);
-    seq1.setEnd(6);
+    seq1ds.setStart(1);
+    seq1ds.setEnd(6);
     // seq1 precedes mapped region:
     assertFalse(acf.isRealisableWith(seq1));
-    seq1.setEnd(7);
+    seq1ds.setEnd(7);
     // seq1 includes first mapped base:
     assertTrue(acf.isRealisableWith(seq1));
-    seq1.setStart(13);
-    seq1.setEnd(18);
+    seq1ds.setStart(13);
+    seq1ds.setEnd(18);
     // seq1 follows mapped region:
     assertFalse(acf.isRealisableWith(seq1));
-    seq1.setStart(12);
+    seq1ds.setStart(12);
     // seq1 includes last mapped base:
     assertTrue(acf.isRealisableWith(seq1));
   }
+
+  /**
+   * Tests for the method that converts mappings to a dummy sequence to mappings
+   * to a compatible real sequence
+   */
+  @Test(groups = { "Functional" })
+  public void testRealiseWith()
+  {
+    SequenceI seq1 = new Sequence("Seq1", "tttCAACCCGGGtttaaa");
+    SequenceI seq2 = new Sequence("Seq2", "QPG");
+    SequenceI seq1proxy = new SequenceDummy("Seq1");
+    seq1.createDatasetSequence();
+    seq2.createDatasetSequence();
+
+    /*
+     * Make two mappings from Seq2 peptide to dummy sequence Seq1
+     */
+    AlignedCodonFrame acf = new AlignedCodonFrame();
+
+    // map PG to codons 7-12 (CCCGGG)
+    MapList mapping1 = new MapList(new int[] { 7, 12 }, new int[] { 2, 3 },
+            3, 1);
+    acf.addMap(seq1proxy, seq2, mapping1);
+
+    // map QP to codons 4-9 (CAACCC)
+    MapList mapping2 = new MapList(new int[] { 4, 9 }, new int[] { 1, 2 },
+            3, 1);
+    acf.addMap(seq1proxy, seq2, mapping2);
+
+    assertEquals(2, acf.getdnaSeqs().length);
+    assertSame(seq1proxy, acf.getdnaSeqs()[0]);
+    assertSame(seq1proxy, acf.getdnaSeqs()[1]);
+    assertEquals(2, acf.getProtMappings().length);
+
+    // 'realise' these mappings with the compatible sequence seq1
+    // two mappings should be updated:
+    assertEquals(2, acf.realiseWith(seq1));
+    assertSame(seq1.getDatasetSequence(), acf.getdnaSeqs()[0]);
+    assertSame(seq1.getDatasetSequence(), acf.getdnaSeqs()[1]);
+  }
 }

diff --git a/test/jalview/io/ExonerateGffTest.java b/test/jalview/io/ExonerateGffTest.java
index 799eeed..70c0ec2 100644 (file)
--- a/test/jalview/io/ExonerateGffTest.java
+++ b/test/jalview/io/ExonerateGffTest.java
@@ -1,12 +1,15 @@
 package jalview.io;
 
 import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
 import jalview.datamodel.AlignedCodonFrame;
+import jalview.datamodel.Alignment;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.Mapping;
+import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceDummy;
 import jalview.datamodel.SequenceI;
 import jalview.gui.AlignFrame;
@@ -36,12 +39,13 @@ public class ExonerateGffTest
     String proteinSeq = ">prot1/10-16\nYCWRSGA";
     AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded(
             proteinSeq, FormatAdapter.PASTE);
+
     /*
-     * exonerate map of residues 11-15 (CWRSG) to bases 10-24 in sequence 'dna1'
-     * starting at position 10 (forward strand)
+     * exonerate GFF output mapping residues 11-15 (CWRSG) 
+     * to bases 24-10 in sequence 'dna1' (reverse strand)
      */
     String exonerateGff = "##gff-version 2\n"
-            + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t+\t.\talignment_id 0 ; Target dna1 ; Align 11 10 5";
+            + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5";
     af.loadJalviewDataFile(exonerateGff, FormatAdapter.PASTE, null, null);
 
     /*
@@ -59,14 +63,26 @@ public class ExonerateGffTest
     assertEquals("dna1", mappedDna.getName());
     Mapping[] mapList = mapping.getProtMappings();
     assertEquals(1, mapList.length);
-    // 11 in protein should map to codon [10, 11, 12] in dna
+    // 11 in protein should map to codon [24, 23, 22] in dna
     int[] mappedRegion = mapList[0].getMap().locateInFrom(11, 11);
-    assertArrayEquals(new int[] { 10, 12 }, mappedRegion);
-    // 15 in protein should map to codon [22, 23, 24] in dna
+    assertArrayEquals(new int[] { 24, 22 }, mappedRegion);
+    // 15 in protein should map to codon [12, 11, 10] in dna
     mappedRegion = mapList[0].getMap().locateInFrom(15, 15);
-    assertArrayEquals(new int[] { 22, 24 }, mappedRegion);
+    assertArrayEquals(new int[] { 12, 10 }, mappedRegion);
 
     // so far so good; TODO: programmatically add mapped sequences
     // and verify the mappings are 'realised'
+    SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT");
+    AlignmentI al = new Alignment(new SequenceI[] { dna1 });
+    al.setDataset(null);
+
+    /*
+     * Now 'realise' the virtual mapping to the real DNA sequence;
+     * interactively this could be by a drag or fetch of the sequence data
+     */
+    mapping.realiseWith(dna1);
+    // verify the mapping is now from the real, not the dummy sequence
+    assertSame(dna1.getDatasetSequence(),
+            mapping.getDnaForAaSeq(dataset.getSequenceAt(0)));
   }
 }