+/* Convention for properties. Read from gradle.properties, use lower_case_underlines for property names.
+ * For properties set within build.gradle, use camelCaseNoSpace.
+ */
import org.apache.tools.ant.filters.ReplaceTokens
import org.gradle.internal.os.OperatingSystem
import org.gradle.plugins.ide.internal.generator.PropertiesPersistableConfigurationObject
mavenCentral()
mavenLocal()
}
- dependencies {
- classpath 'org.openclover:clover:4.4.1'
- }
}
}
}
+ ////
+ // Import releaseProps from the RELEASE file
+ // or a file specified via JALVIEW_RELEASE_FILE if defined
+ // Expect jalview.version and target release branch in jalview.release
+ def releaseProps = new Properties();
+ def releasePropFile = findProperty("JALVIEW_RELEASE_FILE");
+ def defaultReleasePropFile = "${jalviewDirAbsolutePath}/RELEASE";
+ try {
+ (new File(releasePropFile!=null ? releasePropFile : defaultReleasePropFile)).withInputStream {
+ releaseProps.load(it)
+ }
+ } catch (Exception fileLoadError) {
+ throw new Error("Couldn't load release properties file "+(releasePropFile==null ? defaultReleasePropFile : "from custom location: releasePropFile"),fileLoadError);
+ }
+ ////
+ // Set JALVIEW_VERSION if it is not already set
+ if (findProperty(JALVIEW_VERSION)==null || "".equals(JALVIEW_VERSION)) {
+ JALVIEW_VERSION = releaseProps.get("jalview.version")
+ }
+
// this property set when running Eclipse headlessly
j2sHeadlessBuildProperty = string("net.sf.j2s.core.headlessbuild")
// this property set by Eclipse
J2S_ENABLED = (project.hasProperty('j2s.compiler.status') && project['j2s.compiler.status'] != null && project['j2s.compiler.status'] == "enable")
if (J2S_ENABLED) {
println("J2S ENABLED")
- }
-
+ }
/* *-/
System.properties.sort { it.key }.each {
key, val -> println("SYSTEM PROPERTY ${key}='${val}'")
sourceDir = string("${jalviewDir}/${bareSourceDir}")
resourceDir = string("${jalviewDir}/${resource_dir}")
bareTestSourceDir = string(test_source_dir)
- testSourceDir = string("${jalviewDir}/${bareTestSourceDir}")
+ testDir = string("${jalviewDir}/${bareTestSourceDir}")
- // clover
- cloverInstrDir = file("${buildDir}/${cloverSourcesInstrDir}")
- cloverDb = string("${buildDir}/clover/clover.db")
classesDir = string("${jalviewDir}/${classes_dir}")
- if (clover.equals("true")) {
- use_clover = true
- classesDir = string("${buildDir}/${cloverClassesDir}")
- } else {
- use_clover = false
- classesDir = string("${jalviewDir}/${classes_dir}")
- }
- classes = classesDir
+ // clover
+ useClover = clover.equals("true")
+ cloverBuildDir = "${buildDir}/clover"
+ cloverInstrDir = file("${cloverBuildDir}/clover-instr")
+ cloverClassesDir = file("${cloverBuildDir}/clover-classes")
+ cloverReportDir = file("${buildDir}/reports/clover")
+ cloverTestInstrDir = file("${cloverBuildDir}/clover-test-instr")
+ cloverTestClassesDir = file("${cloverBuildDir}/clover-test-classes")
+ //cloverTestClassesDir = cloverClassesDir
+ cloverDb = string("${cloverBuildDir}/clover.db")
+
+ resourceClassesDir = useClover ? cloverClassesDir : classesDir
+
+ testSourceDir = useClover ? cloverTestInstrDir : testDir
+ testClassesDir = useClover ? cloverTestClassesDir : "${jalviewDir}/${test_output_dir}"
getdownWebsiteDir = string("${jalviewDir}/${getdown_website_dir}/${JAVA_VERSION}")
buildDist = true
getdownAppBase = string("${bamboo_channelbase}/${bamboo_planKey}${bamboo_getdown_channel_suffix}/${JAVA_VERSION}")
jvlChannelName += "_${getdownChannelName}"
// automatically add the test group Not-bamboo for exclusion
- if ("".equals(testngExcludedGroups)) {
- testngExcludedGroups = "Not-bamboo"
+ if ("".equals(testng_excluded_groups)) {
+ testng_excluded_groups = "Not-bamboo"
}
install4jExtraScheme = "jalviewb"
break
case "RELEASE":
getdownAppDistDir = getdown_app_dir_release
reportRsyncCommand = true
- // Don't ignore transpile errors for release build
- if (jalviewjs_ignore_transpile_errors.equals("true")) {
- jalviewjs_ignore_transpile_errors = "false"
- println("Setting jalviewjs_ignore_transpile_errors to 'false'")
- }
install4jSuffix = ""
install4jDSStore = "DS_Store"
install4jDMGBackgroundImage = "jalview_dmg_background.png"
getdownChannelName = CHANNEL.toLowerCase()+"/${JALVIEW_VERSION}"
getdownDir = string("${getdownChannelName}/${JAVA_VERSION}")
getdownAppBase = string("${getdown_channel_base}/${getdownDir}")
- if (!file("${ARCHIVEDIR}/${packageDir}").exists()) {
+ if (!file("${ARCHIVEDIR}/${package_dir}").exists()) {
throw new GradleException("Must provide an ARCHIVEDIR value to produce an archive distribution")
} else {
- packageDir = string("${ARCHIVEDIR}/${packageDir}")
- buildProperties = string("${buildDir}/archive/${build_properties_file}")
+ package_dir = string("${ARCHIVEDIR}/${package_dir}")
+ buildProperties = string("${ARCHIVEDIR}/${classes_dir}/${build_properties_file}")
buildDist = false
}
reportRsyncCommand = true
getdownChannelName = string("archive/${JALVIEW_VERSION}")
getdownDir = string("${getdownChannelName}/${JAVA_VERSION}")
getdownAppBase = file(getdownWebsiteDir).toURI().toString()
- if (!file("${ARCHIVEDIR}/${packageDir}").exists()) {
+ if (!file("${ARCHIVEDIR}/${package_dir}").exists()) {
throw new GradleException("Must provide an ARCHIVEDIR value to produce an archive distribution")
} else {
- packageDir = string("${ARCHIVEDIR}/${packageDir}")
- buildProperties = string("${buildDir}/archive/${build_properties_file}")
+ package_dir = string("${ARCHIVEDIR}/${package_dir}")
+ buildProperties = string("${ARCHIVEDIR}/${classes_dir}/${build_properties_file}")
buildDist = false
}
reportRsyncCommand = true
case "DEVELOP":
reportRsyncCommand = true
+
+ // DEVELOP-RELEASE is usually associated with a Jalview release series so set the version
+ JALVIEW_VERSION=JALVIEW_VERSION+"-develop"
+
+ install4jSuffix = "Develop"
install4jDSStore = "DS_Store-DEVELOP"
install4jDMGBackgroundImage = "jalview_dmg_background-DEVELOP.png"
install4jExtraScheme = "jalviewd"
jalviewjs_ignore_transpile_errors = "false"
println("Setting jalviewjs_ignore_transpile_errors to 'false'")
}
- JALVIEW_VERSION = "TEST"
+ JALVIEW_VERSION = JALVIEW_VERSION+"-test"
install4jSuffix = "Test"
install4jDSStore = "DS_Store-TEST-RELEASE"
install4jDMGBackgroundImage = "jalview_dmg_background-TEST.png"
case ~/^SCRATCH(|-[-\w]*)$/:
getdownChannelName = CHANNEL
+ JALVIEW_VERSION = JALVIEW_VERSION+"-"+CHANNEL
+
getdownDir = string("${getdownChannelName}/${JAVA_VERSION}")
getdownAppBase = string("${getdown_channel_base}/${getdownDir}")
reportRsyncCommand = true
break
case "LOCAL":
+ JALVIEW_VERSION = "TEST"
getdownAppBase = file(getdownWebsiteDir).toURI().toString()
getdownLauncher = string("${jalviewDir}/${getdown_lib_dir}/${getdown_launcher_local}")
install4jExtraScheme = "jalviewl"
- buildingHTML = string("${jalviewDir}/${docDir}/building.html")
- helpFile = string("${classesDir}/${help_dir}/help.jhm")
+ buildingHTML = string("${jalviewDir}/${doc_dir}/building.html")
+ helpFile = string("${resourceClassesDir}/${help_dir}/help.jhm")
helpParentDir = string("${jalviewDir}/${help_parent_dir}")
helpSourceDir = string("${helpParentDir}/${help_dir}")
srcDirs += helpParentDir
}
- jar.destinationDir = file("${jalviewDir}/${packageDir}")
+ jar.destinationDir = file("${jalviewDir}/${package_dir}")
compileClasspath = files(sourceSets.main.java.outputDir)
- //compileClasspath += files(sourceSets.main.resources.srcDirs)
compileClasspath += fileTree(dir: "${jalviewDir}/${libDir}", include: ["*.jar"])
runtimeClasspath = compileClasspath
clover {
java {
- srcDirs = [ cloverInstrDir ]
- outputDir = file("${buildDir}/${cloverClassesDir}")
+ srcDirs cloverInstrDir
+ outputDir = cloverClassesDir
}
resources {
srcDirs = sourceSets.main.resources.srcDirs
}
- compileClasspath = configurations.cloverRuntime + files( sourceSets.clover.java.outputDir )
- compileClasspath += files(sourceSets.main.java.outputDir)
- compileClasspath += sourceSets.main.compileClasspath
- compileClasspath += fileTree(dir: "${jalviewDir}/${utilsDir}", include: ["**/*.jar"])
+
+ compileClasspath = files( sourceSets.clover.java.outputDir )
+ //compileClasspath += files( testClassesDir )
compileClasspath += fileTree(dir: "${jalviewDir}/${libDir}", include: ["*.jar"])
+ compileClasspath += fileTree(dir: "${jalviewDir}/${clover_lib_dir}", include: ["*.jar"])
+ compileClasspath += fileTree(dir: "${jalviewDir}/${utils_dir}/testnglibs", include: ["**/*.jar"])
runtimeClasspath = compileClasspath
}
test {
java {
srcDirs testSourceDir
- outputDir = file("${jalviewDir}/${testOutputDir}")
+ outputDir = file(testClassesDir)
}
resources {
- srcDirs = sourceSets.main.resources.srcDirs
+ srcDirs = useClover ? sourceSets.clover.resources.srcDirs : sourceSets.main.resources.srcDirs
}
compileClasspath = files( sourceSets.test.java.outputDir )
-
- if (use_clover) {
- compileClasspath = sourceSets.clover.compileClasspath
- } else {
- compileClasspath += files(sourceSets.main.java.outputDir)
- }
-
- compileClasspath += fileTree(dir: "${jalviewDir}/${libDir}", include: ["*.jar"])
- compileClasspath += fileTree(dir: "${jalviewDir}/${utilsDir}/testnglibs", include: ["**/*.jar"])
- compileClasspath += fileTree(dir: "${jalviewDir}/${utilsDir}/testlibs", include: ["**/*.jar"])
+ compileClasspath += useClover ? sourceSets.clover.compileClasspath : sourceSets.main.compileClasspath
+ compileClasspath += fileTree(dir: "${jalviewDir}/${utils_dir}/testnglibs", include: ["**/*.jar"])
runtimeClasspath = compileClasspath
}
-}
-
-// clover bits
-dependencies {
- if (use_clover) {
- cloverCompile 'org.openclover:clover:4.4.1'
- testCompile 'org.openclover:clover:4.4.1'
- }
-}
-
-
-configurations {
- cloverRuntime
- cloverRuntime.extendsFrom cloverCompile
}
javaRuntimeName = eclipseJavaRuntimeName
// add in jalview project specific properties/preferences into eclipse core preferences
- // and also the codestyle XML file
file {
withProperties { props ->
def jalview_prefs = new Properties()
/* end of eclipse preferences hack */
-task cloverInstr {
- // only instrument source, we build test classes as normal
- inputs.files files (sourceSets.main.allJava,sourceSets.test.allJava) // , fileTree(dir:"$jalviewDir/$testSourceDir", include: ["**/*.java"]))
- outputs.dir cloverInstrDir
+// clover bits
+
+task cleanClover {
doFirst {
- delete cloverInstrDir
- def argsList = [
- "--initstring",
- cloverDb,
- "-d",
- cloverInstrDir.getPath(),
- ]
- argsList.addAll(
- inputs.files.files.collect(
- { file -> file.absolutePath }
- )
+ delete cloverBuildDir
+ delete cloverReportDir
+ }
+}
+
+
+task cloverInstrJava(type: JavaExec) {
+ group = "Verification"
+ description = "Create clover instrumented source java files"
+
+ dependsOn cleanClover
+
+ inputs.files(sourceSets.main.allJava)
+ outputs.dir(cloverInstrDir)
+
+ //classpath = fileTree(dir: "${jalviewDir}/${clover_lib_dir}", include: ["*.jar"])
+ classpath = sourceSets.clover.compileClasspath
+ main = "com.atlassian.clover.CloverInstr"
+
+ def argsList = [
+ "--encoding",
+ "UTF-8",
+ "--initstring",
+ cloverDb,
+ "--destdir",
+ cloverInstrDir.getPath(),
+ ]
+ def srcFiles = sourceSets.main.allJava.files
+ argsList.addAll(
+ srcFiles.collect(
+ { file -> file.absolutePath }
)
- String[] args = argsList.toArray()
- println("About to instrument "+args.length +" files")
- com.atlassian.clover.CloverInstr.mainImpl(args)
+ )
+ args argsList.toArray()
+
+ doFirst {
+ delete cloverInstrDir
+ println("Clover: About to instrument "+srcFiles.size() +" files")
+ }
+}
+
+
+task cloverInstrTests(type: JavaExec) {
+ group = "Verification"
+ description = "Create clover instrumented source test files"
+
+ dependsOn cleanClover
+
+ inputs.files(testDir)
+ outputs.dir(cloverTestInstrDir)
+
+ classpath = sourceSets.clover.compileClasspath
+ main = "com.atlassian.clover.CloverInstr"
+
+ def argsList = [
+ "--encoding",
+ "UTF-8",
+ "--initstring",
+ cloverDb,
+ "--srcdir",
+ testDir,
+ "--destdir",
+ cloverTestInstrDir.getPath(),
+ ]
+ args argsList.toArray()
+
+ doFirst {
+ delete cloverTestInstrDir
+ println("Clover: About to instrument test files")
}
}
+task cloverInstr {
+ group = "Verification"
+ description = "Create clover instrumented all source files"
+
+ dependsOn cloverInstrJava
+ dependsOn cloverInstrTests
+}
+
+
cloverClasses.dependsOn cloverInstr
-task cloverReport {
+task cloverConsoleReport(type: JavaExec) {
group = "Verification"
- description = "Creates the Clover report"
- inputs.dir "${buildDir}/clover"
- outputs.dir "${reportsDir}/clover"
+ description = "Creates clover console report"
+
onlyIf {
file(cloverDb).exists()
}
- doFirst {
- def argsList = [
- "--initstring",
- cloverDb,
- "-o",
- "${reportsDir}/clover"
- ]
- String[] args = argsList.toArray()
- com.atlassian.clover.reporters.html.HtmlReporter.runReport(args)
- // and generate ${reportsDir}/clover/clover.xml
- args = [
- "--initstring",
- cloverDb,
- "-o",
- "${reportsDir}/clover/clover.xml"
- ].toArray()
- com.atlassian.clover.reporters.xml.XMLReporter.runReport(args)
+ inputs.dir cloverClassesDir
+
+ classpath = sourceSets.clover.runtimeClasspath
+ main = "com.atlassian.clover.reporters.console.ConsoleReporter"
+
+ if (cloverreport_mem.length() > 0) {
+ maxHeapSize = cloverreport_mem
+ }
+ if (cloverreport_jvmargs.length() > 0) {
+ jvmArgs Arrays.asList(cloverreport_jvmargs.split(" "))
+ }
+
+ def argsList = [
+ "--alwaysreport",
+ "--initstring",
+ cloverDb,
+ "--unittests"
+ ]
+
+ args argsList.toArray()
+}
+
+
+task cloverHtmlReport(type: JavaExec) {
+ group = "Verification"
+ description = "Creates clover HTML report"
+
+ onlyIf {
+ file(cloverDb).exists()
+ }
+
+ def cloverHtmlDir = cloverReportDir
+ inputs.dir cloverClassesDir
+ outputs.dir cloverHtmlDir
+
+ classpath = sourceSets.clover.runtimeClasspath
+ main = "com.atlassian.clover.reporters.html.HtmlReporter"
+
+ if (cloverreport_mem.length() > 0) {
+ maxHeapSize = cloverreport_mem
+ }
+ if (cloverreport_jvmargs.length() > 0) {
+ jvmArgs Arrays.asList(cloverreport_jvmargs.split(" "))
+ }
+
+ def argsList = [
+ "--alwaysreport",
+ "--initstring",
+ cloverDb,
+ "--outputdir",
+ cloverHtmlDir
+ ]
+
+ if (cloverreport_html_options.length() > 0) {
+ argsList += cloverreport_html_options.split(" ")
+ }
+
+ args argsList.toArray()
+}
+
+
+task cloverXmlReport(type: JavaExec) {
+ group = "Verification"
+ description = "Creates clover XML report"
+
+ onlyIf {
+ file(cloverDb).exists()
+ }
+
+ def cloverXmlFile = "${cloverReportDir}/clover.xml"
+ inputs.dir cloverClassesDir
+ outputs.file cloverXmlFile
+
+ classpath = sourceSets.clover.runtimeClasspath
+ main = "com.atlassian.clover.reporters.xml.XMLReporter"
+
+ if (cloverreport_mem.length() > 0) {
+ maxHeapSize = cloverreport_mem
+ }
+ if (cloverreport_jvmargs.length() > 0) {
+ jvmArgs Arrays.asList(cloverreport_jvmargs.split(" "))
+ }
+
+ def argsList = [
+ "--alwaysreport",
+ "--initstring",
+ cloverDb,
+ "--outfile",
+ cloverXmlFile
+ ]
+
+ if (cloverreport_xml_options.length() > 0) {
+ argsList += cloverreport_xml_options.split(" ")
}
+
+ args argsList.toArray()
+}
+
+
+task cloverReport {
+ group = "Verification"
+ description = "Creates clover reports"
+
+ dependsOn cloverXmlReport
+ dependsOn cloverHtmlReport
}
options.compilerArgs += additional_compiler_args
print ("Setting target compatibility to "+targetCompatibility+"\n")
}
- classpath += configurations.cloverRuntime
-}
-
-
-task cleanClover {
- doFirst {
- delete cloverInstrDir
- delete cloverDb
- }
+ //classpath += configurations.cloverRuntime
}
// end clover bits
compileJava {
-
+ // JBP->BS should the print statement in doFirst refer to compile_target_compatibility ?
sourceCompatibility = compile_source_compatibility
targetCompatibility = compile_target_compatibility
options.compilerArgs = additional_compiler_args
options.encoding = "UTF-8"
doFirst {
- print ("Setting target compatibility to "+targetCompatibility+"\n")
+ print ("Setting target compatibility to "+compile_target_compatibility+"\n")
}
}
compileTestJava {
- if (use_clover) {
- dependsOn compileCloverJava
- classpath += configurations.cloverRuntime
- } else {
- classpath += sourceSets.main.runtimeClasspath
- }
+ sourceCompatibility = compile_source_compatibility
+ targetCompatibility = compile_target_compatibility
+ options.compilerArgs = additional_compiler_args
doFirst {
- sourceCompatibility = compile_source_compatibility
- targetCompatibility = compile_target_compatibility
- options.compilerArgs = additional_compiler_args
print ("Setting target compatibility to "+targetCompatibility+"\n")
}
}
task convertBuildingMD(type: Exec) {
dependsOn cleanBuildingHTML
- def buildingMD = "${jalviewDir}/${docDir}/building.md"
- def css = "${jalviewDir}/${docDir}/github.css"
+ def buildingMD = "${jalviewDir}/${doc_dir}/building.md"
+ def css = "${jalviewDir}/${doc_dir}/github.css"
def pandoc = null
pandoc_exec.split(",").each {
task syncDocs(type: Sync) {
dependsOn convertBuildingMD
- def syncDir = "${classesDir}/${docDir}"
- from fileTree("${jalviewDir}/${docDir}")
+ def syncDir = "${classesDir}/${doc_dir}"
+ from fileTree("${jalviewDir}/${doc_dir}")
into syncDir
}
task copyHelp(type: Copy) {
def inputDir = helpSourceDir
- def outputDir = "${classesDir}/${help_dir}"
+ def outputDir = "${resourceClassesDir}/${help_dir}"
from(inputDir) {
exclude '**/*.gif'
exclude '**/*.jpg'
task syncLib(type: Sync) {
- def syncDir = "${classesDir}/${libDistDir}"
+ def syncDir = "${resourceClassesDir}/${libDistDir}"
from fileTree("${jalviewDir}/${libDistDir}")
into syncDir
}
dependsOn createBuildProperties
from resourceDir
include "**/*.*"
- into "${classesDir}"
+ into "${resourceClassesDir}"
preserve {
include "**"
}
//testReportDirName = "test-reports" // note that test workingDir will be $jalviewDir
test {
dependsOn prepare
- dependsOn compileJava
- if (use_clover) {
- dependsOn cloverInstr
- }
+ //dependsOn compileJava ////? DELETE
- if (use_clover) {
- print("Running tests " + (use_clover?"WITH":"WITHOUT") + " clover [clover="+use_clover+"]\n")
+ if (useClover) {
+ dependsOn cloverClasses
+ } else { //?
+ dependsOn compileJava //?
}
useTestNG() {
- includeGroups testngGroups
- excludeGroups testngExcludedGroups
+ includeGroups testng_groups
+ excludeGroups testng_excluded_groups
preserveOrder true
useDefaultListeners=true
}
targetCompatibility = compile_target_compatibility
jvmArgs += additional_compiler_args
+ doFirst {
+ if (useClover) {
+ println("Running tests " + (useClover?"WITH":"WITHOUT") + " clover")
+ }
+ }
}
task compileLinkCheck(type: JavaCompile) {
options.fork = true
- classpath = files("${jalviewDir}/${utilsDir}")
- destinationDir = file("${jalviewDir}/${utilsDir}")
- source = fileTree(dir: "${jalviewDir}/${utilsDir}", include: ["HelpLinksChecker.java", "BufferedLineReader.java"])
+ classpath = files("${jalviewDir}/${utils_dir}")
+ destinationDir = file("${jalviewDir}/${utils_dir}")
+ source = fileTree(dir: "${jalviewDir}/${utils_dir}", include: ["HelpLinksChecker.java", "BufferedLineReader.java"])
- inputs.file("${jalviewDir}/${utilsDir}/HelpLinksChecker.java")
- inputs.file("${jalviewDir}/${utilsDir}/HelpLinksChecker.java")
- outputs.file("${jalviewDir}/${utilsDir}/HelpLinksChecker.class")
- outputs.file("${jalviewDir}/${utilsDir}/BufferedLineReader.class")
+ inputs.file("${jalviewDir}/${utils_dir}/HelpLinksChecker.java")
+ inputs.file("${jalviewDir}/${utils_dir}/HelpLinksChecker.java")
+ outputs.file("${jalviewDir}/${utils_dir}/HelpLinksChecker.class")
+ outputs.file("${jalviewDir}/${utils_dir}/BufferedLineReader.class")
}
task linkCheck(type: JavaExec) {
dependsOn prepare, compileLinkCheck
- def helpLinksCheckerOutFile = file("${jalviewDir}/${utilsDir}/HelpLinksChecker.out")
- classpath = files("${jalviewDir}/${utilsDir}")
+ def helpLinksCheckerOutFile = file("${jalviewDir}/${utils_dir}/HelpLinksChecker.out")
+ classpath = files("${jalviewDir}/${utils_dir}")
main = "HelpLinksChecker"
workingDir = jalviewDir
args = [ "${classesDir}/${help_dir}", "-nointernet" ]
// import the pubhtmlhelp target
ant.properties.basedir = "${jalviewDir}"
ant.properties.helpBuildDir = "${jalviewDirAbsolutePath}/${classes_dir}/${help_dir}"
-ant.importBuild "${utilsDir}/publishHelp.xml"
+ant.importBuild "${utils_dir}/publishHelp.xml"
task cleanPackageDir(type: Delete) {
doFirst {
- delete fileTree(dir: "${jalviewDir}/${packageDir}", include: "*.jar")
+ delete fileTree(dir: "${jalviewDir}/${package_dir}", include: "*.jar")
}
}
dependsOn createBuildProperties
manifest {
- attributes "Main-Class": mainClass,
+ attributes "Main-Class": main_class,
"Permissions": "all-permissions",
"Application-Name": "Jalview Desktop",
"Codebase": application_codebase
}
- destinationDir = file("${jalviewDir}/${packageDir}")
+ destinationDir = file("${jalviewDir}/${package_dir}")
archiveName = rootProject.name+".jar"
exclude "cache*/**"
exclude "**/*.jar.*"
inputs.dir(classesDir)
- outputs.file("${jalviewDir}/${packageDir}/${archiveName}")
+ outputs.file("${jalviewDir}/${package_dir}/${archiveName}")
}
task copyJars(type: Copy) {
from fileTree(dir: classesDir, include: "**/*.jar").files
- into "${jalviewDir}/${packageDir}"
+ into "${jalviewDir}/${package_dir}"
}
// doing a Sync instead of Copy as Copy doesn't deal with "outputs" very well
task syncJars(type: Sync) {
from fileTree(dir: "${jalviewDir}/${libDistDir}", include: "**/*.jar").files
- into "${jalviewDir}/${packageDir}"
+ into "${jalviewDir}/${package_dir}"
preserve {
include jar.archiveName
}
dependsOn cleanPackageDir
dependsOn syncJars
dependsOn jar
- outputs.dir("${jalviewDir}/${packageDir}")
+ outputs.dir("${jalviewDir}/${package_dir}")
}
manifest {
attributes 'Implementation-Version': JALVIEW_VERSION
}
- mainClassName = shadowJarMainClass
+ mainClassName = shadow_jar_main_class
mergeServiceFiles()
classifier = "all-"+JALVIEW_VERSION+"-j"+JAVA_VERSION
minimize()
}
def codeFiles = []
- fileTree(file(packageDir)).each{ f ->
+ fileTree(file(package_dir)).each{ f ->
if (f.isDirectory()) {
def files = fileTree(dir: f, include: ["*"]).getFiles()
codeFiles += files
// getdown-launcher.jar should not be in main application class path so the main application can move it when updated. Listed as a resource so it gets updated.
//getdownTextString += "class = " + file(getdownLauncher).getName() + "\n"
getdownTextString += "resource = ${getdown_launcher_new}\n"
- getdownTextString += "class = ${mainClass}\n"
+ getdownTextString += "class = ${main_class}\n"
def getdown_txt = file("${getdownWebsiteDir}/getdown.txt")
getdown_txt.write(getdownTextString)
}
if (buildDist) {
- inputs.dir("${jalviewDir}/${packageDir}")
+ inputs.dir("${jalviewDir}/${package_dir}")
}
outputs.dir(getdownWebsiteDir)
outputs.dir(getdownFilesDir)
// a helper task to allow getdown digest of any dir: `gradle getdownDigestDir -PDIGESTDIR=/path/to/my/random/getdown/dir
task getdownDigestDir(type: JavaExec) {
+ group "Help"
+ description "A task to run a getdown Digest on a dir with getdown.txt. Provide a DIGESTDIR property via -PDIGESTDIR=..."
+
def digestDirPropertyName = "DIGESTDIR"
- description = "Digest a local dir (-P${digestDirPropertyName}=...) for getdown"
doFirst {
classpath = files(getdownLauncher)
def digestDir = findProperty(digestDirPropertyName)
// NB we're deleting the /other/ one!
// Also remove the examples subdir from non-release versions
def customizedIdToDelete = "PROGRAM_GROUP_RELEASE"
- if (CHANNEL=="RELEASE") {
+ // 2.11.1.0 NOT releasing with the Examples folder in the Program Group
+ if (false && CHANNEL=="RELEASE") { // remove 'false && ' to include Examples folder in RELEASE channel
customizedIdToDelete = "PROGRAM_GROUP_NON_RELEASE"
} else {
// remove the examples subdir from Full File Set
beginToken: '_',
endToken: '_',
tokens: [
- 'MAIN': '"'+mainClass+'"',
+ 'MAIN': '"'+main_class+'"',
'CODE': "null",
'NAME': jalviewjsJalviewTemplateName+" [core ${coreName}]",
'COREKEY': jalviewjs_core_key,
`utils/install4j/` | files used by the packaging tool, install4j
`build.gradle` | the build file used by gradle
`gradle.properties` | configurable properties for the build process
+ `RELEASE` | propertyfile configuring JALVIEW_VERSION (from jalview.version) and the release branch (from jalview.release). An alternative file can be specified via JALVIEW_RELEASE_FILE property
Note that you need a Java 11 JDK to compile Jalview whether your target build is Java 1.8 or Java 11.
Note that bamboo_planKey should be set by the build plan with `-Pbamboo_planKey=${bamboo.planKey}`
- application subdir as `alt`
- Getdown launcher cannot use a `file://` scheme appbase.
-* `DEVELOP`: This is for creating a `develop` appbase channel on the main web server. This won't become live until the actual getdown artefact is synced to the web server.
+* `DEVELOP`: This is for creating a `develop` appbase channel on the main web server. This won't become live until the actual getdown artefact is synced to the web server.
It will set
- `appbase` as `http://www.jalview.org/getdown/develop/JAVA_VERSION`
- application subdir as `alt`
gradle getdown -PCHANNEL=SCRATCH-my_test_version
```
+#### JALVIEW_VERSION and the RELEASE file
+Any Jalview build will include the value of JALVIEW_VERSION in various places, including the 'About' and Jalview Desktop window title, and in filenames for the stand-alone executable jar. You can specify a custom version for a build via the JALVIEW_VERSION property, but for most situations, JALVIEW_VERSION will be automatically configured according to the value of the CHANNEL property, using the `jalview.version` property specified in the RELEASE file:
+ - `CHANNEL=RELEASE` will set version to jalview.version
+ - `CHANNEL=TEST or DEVELOP` will append '-test' or '-develop' to jalview.version
+
+It is also possible to specify a custom location for the RELEASE file via an optional JALVIEW_RELEASE_FILE property.
+
#### `install4jMediaTypes`
If you are building *install4j* installers (requires *install4j* to be installed) then this property specifies a comma-separated
list of media types (i.e. platform specific installers) *install4j* should actually build.
--- /dev/null
+import jalview.datamodel.SequenceFeature
+import jalview.gui.Desktop
+def af = jalview.bin.Jalview.currentAlignFrame
+def av = af.viewport
+def fr = Desktop.getAlignFrameFor(av.codingComplement).getFeatureRenderer()
+def counts = 0
+def countm = 0
+for (seq in av.alignment.sequences)
+{
+ ds = seq.datasetSequence
+ for (res = ds.start ; res <= ds.end; res++)
+ {
+ mf = fr.findComplementFeaturesAtResidue(seq, res)
+ if (mf != null)
+ {
+ for (feature in mf.features)
+ {
+ variant = mf.findProteinVariants(feature)
+ if (!"".equals(variant))
+ {
+ type = variant.contains("=") ? "synonymous_variant" : "missense_variant"
+ if (type.equals("synonymous_variant")) counts++ else countm++;
+ sf = new SequenceFeature(type, variant, res, res, null)
+ seq.addSequenceFeature(sf)
+ }
+ }
+ }
+ }
+}
+af.getFeatureRenderer().featuresAdded()
+af.alignPanel.paintAlignment(true, true)
+println "Added " + countm + " missense and " + counts + " synonymous variants"
\ No newline at end of file
-org.gradle.jvmargs=-Xmx1536m -Xms512m -Dfile.encoding=UTF-8
-#systemProp.file.encoding=UTF-8
+# Convention for properties. Read from gradle.properties, use lower_case_underlines for property names.
+# For properties set within build.gradle, use camelCaseNoSpace.
+#
jalviewDir = .
jalview_keyalg = SHA1withRSA
jalview_keydig = SHA1
-testngGroups = Functional
-testngExcludedGroups =
+testng_groups = Functional
+testng_excluded_groups =
j8libDir = j8lib
j11libDir = j11lib
resource_dir = resources
help_parent_dir = help
help_dir = help
-docDir = doc
-schemaDir = schemas
+doc_dir = doc
classes_dir = classes
-examplesDir = examples
clover = false
-use_clover = false
-cloverReportJVMHeap = 2g
-cloverReportJVMArgs = -Dfile.encoding=UTF-8
-cloverReportHTMLOptions =
-cloverReportXMLOptions =
-cloverClassesDir = clover-classes
-cloverSourcesInstrDir = sources-instr
-packageDir = dist
+clover_classes_dir = clover-classes
+clover_sources_instr_dir = clover-instr
+clover_report_dir = clover-report
+clover_lib_dir = utils/clover/lib
+cloverreport_mem = 2g
+cloverreport_jvmargs = -Dfile.encoding=UTF-8
+cloverreport_html_options =
+cloverreport_xml_options =
+package_dir = dist
ARCHIVEDIR =
-outputJar = jalview.jar
-testOutputDir = tests
-utilsDir = utils
+test_output_dir = tests
+utils_dir = utils
build_properties_file = .build_properties
application_codebase = *.jalview.org
-mainClass = jalview.bin.Jalview
-shadowJarMainClass = jalview.bin.Launcher
-launcherClass = jalview.bin.Jalview
+main_class = jalview.bin.Jalview
+shadow_jar_main_class = jalview.bin.Launcher
jalview_name = Jalview
jalviewjs_eclipse_dropins_dir = utils/jalviewjs/eclipse/dropins
jalviewjs_swingjs_zip = swingjs/SwingJS-site.zip
-jalviewjs_j2s_plugin = swingjs/net.sf.j2s.core-j11.jar
+jalviewjs_j2s_plugin = swingjs/net.sf.j2s.core.jar
jalviewjs_libjs_dir = utils/jalviewjs/libjs
jalviewjs_site_resource_dir = utils/jalviewjs/site-resources
jalviewjs_classlists_dir = utils/jalviewjs/classlists
jalviewjs_ignore_transpile_errors = true
j2s.compiler.status = enable
-j2s.compiler.java.version = 11
#j2s.site.directory = null ## site defined from buildDir+'/jalviewjs/'+jalviewjs_site_dir
#j2s.log.methods.declared = j2s_methods_declared.log
#j2s.log.methods.called = j2s_methods_called.log
<mapID target="seqfeatures" url="html/features/seqfeatures.html"/>
<mapID target="seqfeatedit" url="html/features/editingFeatures.html"/>
<mapID target="seqfeatcreat" url="html/features/creatinFeatures.html"/>
+ <mapID target="seqfeatures.report" url="html/features/seqfeaturereport.html"/>
<mapID target="seqfeatures.settings" url="html/features/featuresettings.html"/>
<mapID target="seqfeatures.settings.selcols" url="html/features/featuresettings.html#selectbyfeature"/>
<mapID target="viewingpdbs" url="html/features/viewingpdbs.html"/>
<tocitem text="Feature Colourschemes" target="features.featureschemes" />
<tocitem text="User Defined Sequence Features" target="seqfeatcreat" />
<tocitem text="Editing Sequence Features" target="seqfeatedit" />
+ <tocitem text="HTML Feature Attributes report" target="seqfeatures.report" />
<tocitem text="HTML annotation report" target="io.seqreport" />
</tocitem>
for more information.
</p>
<p>
+ <strong>Working with variants without CSQ fields</strong>
+ </p>
+ <p>
+ <a name="computepepvariants">Jalview 2.11.1's new virtual
+ features</a> mean that peptide sequences are no longer annotated
+ directly with protein missense variants. This makes it harder to
+ filter variants when they do not already include the CSQ field. You
+ can rescue the pre-2.11.1 functionality by:
+ </p>
+ <ol>
+ <li>Download the script at
+ https://www.jalview.org/examples/groovy/ComputePeptideVariants.groovy</li>
+ <li>Executing the script via the <a href="groovy.html">Groovy
+ Console</a> on a linked CDS/Protein view to create missense and
+ synonymous peptide variant features.
+ </li>
+ </ol>
+ <p>
<strong>Working with variants from organisms other than
H.sapiens.</strong>
</p>
--- /dev/null
+<html>
+<!--
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
+<head>
+<title>Sequence Feature Reports</title>
+</head>
+<body>
+ <p>
+ <strong>Sequence Feature Reports</strong> <br /> Sequence features
+ can carry a number of attributes. To view all the attributes for a
+ particular sequence feature, mouse over the feature and <em>right-click</em>
+ to open the <a href="../menus/popupMenu.html#featuredetails">Popup Menu</a> and
+ select the feature's entry from the <em>Feature Details</em>
+ submenu.
+ </p>
+ <img src="seqfeaturesrep.png" width="460"
+ alt="Full details for a particular Sequence Feature can be displayed as HTML in a report window" />
+ <p>
+ <em>Virtual Feature Reports</em><br /> When a sequence feature
+ report is shown for features mapped between CDS and Protein
+ sequences, the report will include both the original and mapped
+ feature's location.
+ </p>
+ <p>
+ <strong>Copying and pasting annotation to other programs</strong><br>
+ The <strong>File→Save</strong> option in the sequence
+ annotation report window allows the report to be saved as HTML,
+ which will preserve links and any other metadata. It is also
+ possible to copy and paste the text to other programs, but in some
+ cases, the HTML will not be preserved. In that case, you can toggle
+ the display of HTML source code with the <strong>Edit→Show
+ HTML Source</strong> drop down menu entry.
+ </p>
+ <em>Feature Reports were added in Jalview 2.11.</em>
+</body>
+</html>
settings tabs and corresponding views showing 'Virtual Features'
from each view overlaid on the other (created with Jalview 2.11.1.0).</em>
</p>
- <p>When virtual features are enabled, they are also shown on any
- linked 3D structure views when 'Colour by Sequence' is enabled, and
+ <p>
+ When virtual features are enabled, they are also shown on any linked
+ 3D structure views when 'Colour by Sequence' is enabled, and
exported as GFF and Jalview Features files (mapped to their
- associated virtual coordinates).</p>
+ associated virtual coordinates). Both the original and the mapped
+ locations are also included in <a href="seqfeaturereport.html">Sequence
+ Feature Reports</a>.
+ </p>
<p>
<strong>Operations supported in Split Frame Mode</strong>
</p>
<p>
<strong>Popup Menu</strong><br> <em>This menu is visible
when right clicking either within a selected region on the
- alignment or on a selected sequence name. It may not be accessible
+ alignment, on a sequence name, and also when right-clicking a sequence feature. It may not be accessible
when in 'Cursor Mode' (toggled with the F2 key).</em><br /> <em><strong>Mac
Users:</strong> pressing CTRL whilst clicking the mouse/track pad is the
same as a right-click. See your system's settings to configure
your track-pad's corners to generate right-clicks.</em>
</p>
<ul>
- <li><strong>Selection</strong>
+ <li><strong>Selection<br/></strong>
+ <em>This menu is only visible when right-clicking a selected sequence or region of the alignment. </em>
<ul>
<li><a name="sqreport"><strong>Sequence
Details...<br>
according to gaps in just the current sequence)</em></li>
<li><strong>Hide Sequences</strong><br> <em>Hides the
currently selected sequences in this alignment view.</em><strong><br>
- </strong></li>
+ </strong><br/> <br/></li>
+
+ <li><strong><a name="featuredetails"> Feature Details</a><br /></strong>
+ <em>Each entry opens a <a
+ href="../features/seqfeaturereport.html">Sequence Feature
+ Report</a> for visible features under the mouse.<br />Only visible
+ when right-clicking a region where <a
+ href="../features/seqfeatures.html">Sequence Features</a> are
+ shown.
+ </em>
+ </li>
</ul>
+
</body>
</html>
<tr>
<td width="60" align="center" nowrap><strong><a
id="Jalview.2.11.1">2.11.1</a><a id="Jalview.2.11.1.0">.0</a><br />
- <em>9/04/2020</em></strong></td>
+ <em>22/04/2020</em></strong></td>
<td align="left" valign="top">
<ul>
<li>
- <!-- JAL-3187,JAL-3305,JAL-3304,JAL-3302 -->Map 'virtual'
- codon features shown on protein (or vice versa) for display
- in alignments, on structure views and for export.
+ <!-- JAL-3187,JAL-3305,JAL-3304,JAL-3302,JAL-3567 -->Map
+ 'virtual' codon features shown on protein (or vice versa)
+ for display in alignments, on structure views (including
+ transfer to UCSF chimera), in feature reports and for
+ export.
</li>
<li>
<!-- JAL-3121 -->Feature attributes from VCF files can be
<!-- JAL-3549 -->Warn if Sort by Score or Density attempted
with no feature types visible
</li>
+ <li>
+ <!-- JAL-3574 -->Improved support for filtering feature attributes with large integer values
+ </li>
</ul><em>Jalview Installer</em>
<ul>
<li>
to stdout containing the consensus sequence for each
alignment in a Jalview session
</li>
+ <li>
+ <!-- JAL-3578 -->ComputePeptideVariants.groovy to translate
+ genomic sequence_variant annotation from CDS as
+ missense_variant or synonymous_variant on protein products.
+ </li>
</ul>
</td>
<td align="left" valign="top">
'Show hidden markers' option is not ticked
</li>
<li>
+ <!-- JAL-247 -->Hidden sequence markers not shown in EPS and
+ PNG output when 'Automatically set ID width' is set in
+ jalview preferences or properties file
+ </li>
+ <li>
<!-- JAL-3571 -->Feature Editor dialog can be opened when
'Show Sequence Features' option is not ticked
</li>
<!-- JAL-3406 -->Credits missing some authors in Jalview
help documentation for 2.11.0 release
</li>
+ <li>
+ <!-- JAL-3529 -->Export of Pfam alignment as Stockholm
+ includes Pfam ID as sequence's accession rather than its
+ Uniprot Accession
+ </li>
</ul> <em>Java 11 Compatibility issues</em>
<ul>
<li>
<a href="features/splitView.html#virtualfeats">Sequence
Features dialog</a>. This allows more analyses of nucleotide and
peptide sequence features on alignments in a more flexible and
- memory efficient way than in earlier versions.</li>
+ memory efficient way than in earlier versions.<br />
+ <em>Note: Virtual features work best when variants are
+ annotated with CSQ fields. Please <a
+ href="features/importvcf.html#computepepvariants">see this
+ Groovy script workaround</a> if you are working with VCF files
+ without CSQ fields.
+ </em></li>
<li><strong>Improved VCF data import</strong><br /> <a
href="features/importvcf.html#attribs">Standard attributes for
filtering variants</a> (e.g. position, QUAL field etc) are now
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.analysis;
public interface GeneticCodeI
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.analysis;
import jalview.bin.Cache;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.api;
import jalview.datamodel.SearchResultsI;
*/
package jalview.appletgui;
+import java.awt.CheckboxMenuItem;
+import java.awt.Frame;
+import java.awt.Menu;
+import java.awt.MenuItem;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.ItemEvent;
+import java.awt.event.ItemListener;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Collection;
+import java.util.Collections;
+import java.util.LinkedHashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.SortedMap;
+import java.util.TreeMap;
+import java.util.Vector;
+
import jalview.analysis.AAFrequency;
import jalview.analysis.AlignmentAnnotationUtils;
import jalview.analysis.AlignmentUtils;
import jalview.util.MessageManager;
import jalview.util.UrlLink;
-import java.awt.CheckboxMenuItem;
-import java.awt.Frame;
-import java.awt.Menu;
-import java.awt.MenuItem;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.awt.event.ItemEvent;
-import java.awt.event.ItemListener;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Collection;
-import java.util.Collections;
-import java.util.LinkedHashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.SortedMap;
-import java.util.TreeMap;
-import java.util.Vector;
-
public class APopupMenu extends java.awt.PopupMenu
implements ActionListener, ItemListener
{
contents.append(MessageManager
.formatMessage("label.annotation_for_displayid", new Object[]
{ seq.getDisplayId(true) }));
- new SequenceAnnotationReport(null).createSequenceAnnotationReport(
+ new SequenceAnnotationReport(false).createSequenceAnnotationReport(
contents, seq, true, true, ap.seqPanel.seqCanvas.fr);
contents.append("</p>");
}
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.bin;
import java.lang.management.ManagementFactory;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.bin;
import java.awt.Image;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.bin;
import java.io.File;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.bin;
/**
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel;
import jalview.util.MapList;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel;
import jalview.util.MapList;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel;
+import java.util.HashSet;
+import java.util.List;
+import java.util.Set;
+
import jalview.io.gff.Gff3Helper;
import jalview.schemes.ResidueProperties;
+import jalview.util.MapList;
import jalview.util.MappingUtils;
import jalview.util.StringUtils;
-import java.util.HashSet;
-import java.util.List;
-import java.util.Set;
-
/**
* A data bean to hold a list of mapped sequence features (e.g. CDS features
* mapped from protein), and the mapping between the sequences. It also provides
*/
public class MappedFeatures
{
+ /*
+ * VEP CSQ:HGVSp (if present) is a short-cut to the protein variant consequence
+ */
private static final String HGV_SP = "HGVSp";
private static final String CSQ = "CSQ";
/*
- * the mapping from one sequence to another
+ * the sequence the mapped features are on
*/
- public final Mapping mapping;
+ private final SequenceI featureSequence;
- /**
- * the sequence mapped from
+ /*
+ * the mapping between sequences;
+ * NB this could be in either sense (from or to featureSequence)
*/
- public final SequenceI fromSeq;
+ private final Mapping mapping;
/*
- * features on the sequence mapped to that overlap the mapped positions
+ * features on featureSequence that overlap the mapped positions
*/
public final List<SequenceFeature> features;
* Constructor
*
* @param theMapping
- * @param from
- * the sequence mapped from (e.g. CDS)
+ * sequence mapping (which may be either to, or from, the sequence
+ * holding the linked features)
+ * @param featureSeq
+ * the sequence hosting the virtual features
* @param pos
- * the residue position in the sequence mapped to
+ * the residue position in the sequence mapped to
* @param res
- * the residue character at position pos
+ * the residue character at position pos
* @param theFeatures
- * list of mapped features found in the 'from' sequence at
- * the mapped position(s)
+ * list of mapped features found in the 'featureSeq' sequence at the
+ * mapped position(s)
*/
- public MappedFeatures(Mapping theMapping, SequenceI from, int pos,
+ public MappedFeatures(Mapping theMapping, SequenceI featureSeq, int pos,
char res, List<SequenceFeature> theFeatures)
{
mapping = theMapping;
- fromSeq = from;
+ featureSequence = featureSeq;
toPosition = pos;
toResidue = res;
features = theFeatures;
{
codonPos = codonPositions;
baseCodon = new char[3];
- int cdsStart = fromSeq.getStart();
+ int cdsStart = featureSequence.getStart();
baseCodon[0] = Character
- .toUpperCase(fromSeq.getCharAt(codonPos[0] - cdsStart));
+ .toUpperCase(featureSequence.getCharAt(codonPos[0] - cdsStart));
baseCodon[1] = Character
- .toUpperCase(fromSeq.getCharAt(codonPos[1] - cdsStart));
+ .toUpperCase(featureSequence.getCharAt(codonPos[1] - cdsStart));
baseCodon[2] = Character
- .toUpperCase(fromSeq.getCharAt(codonPos[2] - cdsStart));
+ .toUpperCase(featureSequence.getCharAt(codonPos[2] - cdsStart));
}
else
{
/**
* Computes and returns comma-delimited HGVS notation peptide variants derived
* from codon allele variants. If no variants are found, answers an empty
- * string.
+ * string. The peptide variant is either simply read from the "CSQ:HGVSp"
+ * attribute if present, else computed based on the "alleles" attribute if
+ * present. If neither attribute is found, no variant (empty string) is
+ * returned.
*
* @param sf
- * a sequence feature (which must be one of those held in this
- * object)
+ * a sequence feature (which must be one of those held in this
+ * object)
* @return
*/
public String findProteinVariants(SequenceFeature sf)
return vars.toString();
}
+
+ /**
+ * Answers the name of the linked sequence holding any mapped features
+ *
+ * @return
+ */
+ public String getLinkedSequenceName()
+ {
+ return featureSequence == null ? null : featureSequence.getName();
+ }
+
+ /**
+ * Answers the mapped ranges (as one or more [start, end] positions) which
+ * correspond to the given [begin, end] range of the linked sequence.
+ *
+ * <pre>
+ * Example: MappedFeatures with CDS features mapped to peptide
+ * CDS/200-220 gtc aac TGa acGt att AAC tta
+ * mapped to PEP/6-7 WN by mapping [206, 207, 210, 210, 215, 217] to [6, 7]
+ * getMappedPositions(206, 206) should return [6, 6]
+ * getMappedPositions(200, 214) should return [6, 6]
+ * getMappedPositions(210, 215) should return [6, 7]
+ * </pre>
+ *
+ * @param begin
+ * @param end
+ * @return
+ */
+ public int[] getMappedPositions(int begin, int end)
+ {
+ MapList map = mapping.getMap();
+ return mapping.to == featureSequence ? map.locateInFrom(begin, end)
+ : map.locateInTo(begin, end);
+ }
+
+ /**
+ * Answers true if the linked features are on coding sequence, false if on
+ * peptide
+ *
+ * @return
+ */
+ public boolean isFromCds()
+ {
+ if (mapping.getMap().getFromRatio() == 3)
+ {
+ return mapping.to != featureSequence;
+ }
+ return mapping.to == featureSequence;
+ }
}
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel;
/**
@Override
public boolean involvesSequence(SequenceI sequence)
{
+ final int start = sequence.getStart();
+ final int end = sequence.getEnd();
+
SequenceI ds = sequence.getDatasetSequence();
- for (SearchResultMatchI _m : matches)
+ for (SearchResultMatchI m : matches)
{
- SequenceI matched = _m.getSequence();
- if (matched != null && (matched == sequence || matched == ds))
+ SequenceI matched = m.getSequence();
+ if (matched != null && (matched == sequence || matched == ds)
+ && (m.getEnd() >= start) && (m.getStart() <= end))
{
return true;
}
*/
package jalview.datamodel;
-import jalview.datamodel.features.FeatureAttributeType;
-import jalview.datamodel.features.FeatureAttributes;
-import jalview.datamodel.features.FeatureLocationI;
-import jalview.datamodel.features.FeatureSourceI;
-import jalview.datamodel.features.FeatureSources;
-import jalview.util.StringUtils;
-
import java.util.Comparator;
import java.util.LinkedHashMap;
import java.util.Map;
import java.util.TreeMap;
import java.util.Vector;
+import jalview.datamodel.features.FeatureAttributeType;
+import jalview.datamodel.features.FeatureAttributes;
+import jalview.datamodel.features.FeatureLocationI;
+import jalview.datamodel.features.FeatureSourceI;
+import jalview.datamodel.features.FeatureSources;
+import jalview.util.StringUtils;
+
/**
* A class that models a single contiguous feature on a sequence. If flag
* 'contactFeature' is true, the start and end positions are interpreted instead
}
/**
- * Answers an html-formatted report of feature details
+ * Answers an html-formatted report of feature details. If parameter
+ * {@code mf} is not null, the feature is a virtual linked feature, and
+ * details included both the original location and the mapped location
+ * (CDS/peptide).
*
* @param seqName
+ * @param mf
*
* @return
*/
- public String getDetailsReport(String seqName)
+ public String getDetailsReport(String seqName, MappedFeatures mf)
{
FeatureSourceI metadata = FeatureSources.getInstance()
.getSource(source);
StringBuilder sb = new StringBuilder(128);
sb.append("<br>");
sb.append("<table>");
- sb.append(String.format(ROW_DATA, "Location", seqName,
+ String name = mf == null ? seqName : mf.getLinkedSequenceName();
+ sb.append(String.format(ROW_DATA, "Location", name,
begin == end ? begin
: begin + (isContactFeature() ? ":" : "-") + end));
+
+ String consequence = "";
+ if (mf != null)
+ {
+ int[] beginRange = mf.getMappedPositions(begin, begin);
+ int[] endRange = mf.getMappedPositions(end, end);
+ int from = beginRange[0];
+ int to = endRange[endRange.length - 1];
+ String s = mf.isFromCds() ? "Peptide Location" : "Coding location";
+ sb.append(String.format(ROW_DATA, s, seqName, from == to ? from
+ : from + (isContactFeature() ? ":" : "-") + to));
+ if (mf.isFromCds())
+ {
+ consequence = mf.findProteinVariants(this);
+ }
+ }
sb.append(String.format(ROW_DATA, "Type", type, ""));
String desc = StringUtils.stripHtmlTags(description);
sb.append(String.format(ROW_DATA, "Description", desc, ""));
sb.append(String.format(ROW_DATA, "Group", featureGroup, ""));
}
+ if (!consequence.isEmpty())
+ {
+ sb.append(String.format(ROW_DATA, "Consequence",
+ "<i>Translated by Jalview</i>", consequence));
+ }
+
if (otherDetails != null)
{
TreeMap<String, Object> ordered = new TreeMap<>(
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
/**
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import java.util.ArrayList;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import jalview.datamodel.SequenceFeature;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import jalview.datamodel.SequenceFeature;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import jalview.datamodel.SequenceFeature;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import jalview.datamodel.SequenceFeature;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import java.util.HashMap;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
public interface FeatureSourceI
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.datamodel.features;
import java.util.HashMap;
*/
package jalview.datamodel.features;
-import jalview.datamodel.SequenceFeature;
-
import java.util.ArrayList;
import java.util.Collections;
import java.util.HashSet;
import intervalstore.api.IntervalStoreI;
import intervalstore.impl.BinarySearcher;
+import intervalstore.impl.BinarySearcher.Compare;
import intervalstore.impl.IntervalStore;
+import jalview.datamodel.SequenceFeature;
/**
* A data store for a set of sequence features that supports efficient lookup of
* binary search the sorted list to find the insertion point
*/
int insertPosition = BinarySearcher.findFirst(contactFeatureStarts,
- f -> f.getBegin() >= feature.getBegin());
+ true, Compare.GE, feature.getBegin());
contactFeatureStarts.add(insertPosition, feature);
* binary search the sorted list to find the insertion point
*/
insertPosition = BinarySearcher.findFirst(contactFeatureEnds,
- f -> f.getEnd() >= feature.getEnd());
+ false, Compare.GE, feature.getEnd());
contactFeatureEnds.add(insertPosition, feature);
return true;
*/
// int pos = binarySearch(features,
// SearchCriterion.byFeature(feature, RangeComparator.BY_START_POSITION));
- int pos = BinarySearcher.findFirst(features,
- val -> val.getBegin() >= feature.getBegin());
+ int pos = BinarySearcher.findFirst(features, true, Compare.GE,
+ feature.getBegin());
int len = features.size();
while (pos < len)
{
* whose end point is not before the target range
*/
int index = BinarySearcher.findFirst(contactFeatureEnds,
- f -> f.getEnd() >= from);
+ false, Compare.GE, (int) from);
while (index < contactFeatureEnds.size())
{
List<SequenceFeature> result)
{
int index = BinarySearcher.findFirst(contactFeatureStarts,
- f -> f.getBegin() >= from);
+ true, Compare.GE, (int) from);
while (index < contactFeatureStarts.size())
{
*/
package jalview.datamodel.features;
-import jalview.datamodel.SequenceFeature;
-import jalview.io.gff.SequenceOntologyFactory;
-import jalview.io.gff.SequenceOntologyI;
-
import java.util.ArrayList;
+import java.util.Collections;
import java.util.HashSet;
import java.util.List;
import java.util.Map;
import java.util.TreeMap;
import intervalstore.api.IntervalI;
+import jalview.datamodel.SequenceFeature;
+import jalview.io.gff.SequenceOntologyFactory;
+import jalview.io.gff.SequenceOntologyI;
/**
* A class that stores sequence features in a way that supports efficient
*/
public class SequenceFeatures implements SequenceFeaturesI
{
-
/*
* map from feature type to structured store of features for that type
* null types are permitted (but not a good idea!)
public static void sortFeatures(List<? extends IntervalI> features,
final boolean forwardStrand)
{
- IntervalI.sortIntervals(features, forwardStrand);
+ Collections.sort(features,
+ forwardStrand
+ ? IntervalI.COMPARE_BEGIN_ASC_END_DESC
+ : IntervalI.COMPARE_END_DESC);
}
/**
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.android;
/*
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.android;
/*
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.android;
/*
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.android;
/*
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.ensembl;
import jalview.datamodel.AlignmentI;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.ensembl;
import jalview.datamodel.AlignmentI;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.ext.htsjdk;
import jalview.bin.Cache;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.gui;
import jalview.util.MessageManager;
*/
package jalview.gui;
-import jalview.datamodel.AlignmentAnnotation;
-import jalview.datamodel.Sequence;
-import jalview.datamodel.SequenceGroup;
-import jalview.datamodel.SequenceI;
-import jalview.gui.SeqPanel.MousePos;
-import jalview.io.SequenceAnnotationReport;
-import jalview.util.MessageManager;
-import jalview.util.Platform;
-import jalview.viewmodel.AlignmentViewport;
-import jalview.viewmodel.ViewportRanges;
-
import java.awt.BorderLayout;
import java.awt.event.ActionEvent;
import java.awt.event.ActionListener;
import javax.swing.Timer;
import javax.swing.ToolTipManager;
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceGroup;
+import jalview.datamodel.SequenceI;
+import jalview.gui.SeqPanel.MousePos;
+import jalview.io.SequenceAnnotationReport;
+import jalview.util.MessageManager;
+import jalview.util.Platform;
+import jalview.viewmodel.AlignmentViewport;
+import jalview.viewmodel.ViewportRanges;
+
/**
* This panel hosts alignment sequence ids and responds to mouse clicks on them,
* as well as highlighting ids matched by a search from the Find menu.
ScrollThread scrollThread = null;
- String linkImageURL;
-
int offy;
// int width;
this.av = av;
alignPanel = parent;
setIdCanvas(new IdCanvas(av));
- linkImageURL = getClass().getResource("/images/link.gif").toString();
- seqAnnotReport = new SequenceAnnotationReport(linkImageURL);
+ seqAnnotReport = new SequenceAnnotationReport(true);
setLayout(new BorderLayout());
add(getIdCanvas(), BorderLayout.CENTER);
addMouseListener(this);
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.gui;
import java.awt.Font;
*/
package jalview.gui;
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.BitSet;
+import java.util.Collection;
+import java.util.Collections;
+import java.util.Hashtable;
+import java.util.LinkedHashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.Objects;
+import java.util.SortedMap;
+import java.util.TreeMap;
+import java.util.Vector;
+
+import javax.swing.ButtonGroup;
+import javax.swing.JCheckBoxMenuItem;
+import javax.swing.JInternalFrame;
+import javax.swing.JLabel;
+import javax.swing.JMenu;
+import javax.swing.JMenuItem;
+import javax.swing.JPanel;
+import javax.swing.JPopupMenu;
+import javax.swing.JRadioButtonMenuItem;
+import javax.swing.JScrollPane;
+
import jalview.analysis.AAFrequency;
import jalview.analysis.AlignmentAnnotationUtils;
import jalview.analysis.AlignmentUtils;
import jalview.util.UrlLink;
import jalview.viewmodel.seqfeatures.FeatureRendererModel;
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.BitSet;
-import java.util.Collection;
-import java.util.Collections;
-import java.util.Hashtable;
-import java.util.LinkedHashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.Objects;
-import java.util.SortedMap;
-import java.util.TreeMap;
-import java.util.Vector;
-
-import javax.swing.ButtonGroup;
-import javax.swing.JCheckBoxMenuItem;
-import javax.swing.JInternalFrame;
-import javax.swing.JLabel;
-import javax.swing.JMenu;
-import javax.swing.JMenuItem;
-import javax.swing.JPanel;
-import javax.swing.JPopupMenu;
-import javax.swing.JRadioButtonMenuItem;
-import javax.swing.JScrollPane;
-
/**
* The popup menu that is displayed on right-click on a sequence id, or in the
* sequence alignment.
}
/**
- * Add a link to show feature details for each sequence feature
+ * Add a menu item to show feature details for each sequence feature. Any
+ * linked 'virtual' features (CDS/protein) are also optionally found and
+ * included.
*
* @param features
- * @param column
* @param seq
+ * @param column
*/
protected void addFeatureDetails(List<SequenceFeature> features,
- SequenceI seq, int column)
+ final SequenceI seq, final int column)
{
/*
* add features in CDS/protein complement at the corresponding
String name = seq.getName();
for (final SequenceFeature sf : features)
{
- addFeatureDetailsMenuItem(details, name, sf);
+ addFeatureDetailsMenuItem(details, name, sf, null);
}
if (mf != null)
{
- name = mf.fromSeq == seq ? mf.mapping.getTo().getName()
- : mf.fromSeq.getName();
for (final SequenceFeature sf : mf.features)
{
- addFeatureDetailsMenuItem(details, name, sf);
+ addFeatureDetailsMenuItem(details, name, sf, mf);
}
}
}
/**
- * A helper method to add one menu item whose action is to show details for one
- * feature. The menu text includes feature description, but this may be
+ * A helper method to add one menu item whose action is to show details for
+ * one feature. The menu text includes feature description, but this may be
* truncated.
*
* @param details
* @param seqName
* @param sf
+ * @param mf
*/
void addFeatureDetailsMenuItem(JMenu details, final String seqName,
- final SequenceFeature sf)
+ final SequenceFeature sf, MappedFeatures mf)
{
int start = sf.getBegin();
int end = sf.getEnd();
+ if (mf != null)
+ {
+ /*
+ * show local rather than linked feature coordinates
+ */
+ int[] beginRange = mf.getMappedPositions(start, start);
+ start = beginRange[0];
+ int[] endRange = mf.getMappedPositions(end, end);
+ end = endRange[endRange.length - 1];
+ }
StringBuilder desc = new StringBuilder();
desc.append(sf.getType()).append(" ").append(String.valueOf(start));
if (start != end)
{
- desc.append("-").append(String.valueOf(end));
+ desc.append(sf.isContactFeature() ? ":" : "-");
+ desc.append(String.valueOf(end));
}
String description = sf.getDescription();
if (description != null)
@Override
public void actionPerformed(ActionEvent e)
{
- showFeatureDetails(seqName, sf);
+ showFeatureDetails(sf, seqName, mf);
}
});
details.add(item);
}
/**
- * Opens a panel showing a text report of feature dteails
- *
- * @param seqName
+ * Opens a panel showing a text report of feature details
*
* @param sf
+ * @param seqName
+ * @param mf
*/
- protected void showFeatureDetails(String seqName, SequenceFeature sf)
+ protected void showFeatureDetails(SequenceFeature sf, String seqName,
+ MappedFeatures mf)
{
JInternalFrame details;
if (Platform.isJS())
// TODO JAL-3026 set style of table correctly for feature details
JLabel reprt = new JLabel(MessageManager
.formatMessage("label.html_content", new Object[]
- { sf.getDetailsReport(seqName) }));
+ { sf.getDetailsReport(seqName, mf) }));
reprt.setBackground(Color.WHITE);
reprt.setOpaque(true);
panel.add(reprt, BorderLayout.CENTER);
*/
{
CutAndPasteHtmlTransfer cap = new CutAndPasteHtmlTransfer();
- // it appears Java's CSS does not support border-collaps :-(
+ // it appears Java's CSS does not support border-collapse :-(
cap.addStylesheetRule("table { border-collapse: collapse;}");
cap.addStylesheetRule("table, td, th {border: 1px solid black;}");
- cap.setText(sf.getDetailsReport(seqName));
+ cap.setText(sf.getDetailsReport(seqName, mf));
details = cap;
}
Desktop.addInternalFrame(details,
"label.create_sequence_details_report_annotation_for",
new Object[]
{ seq.getDisplayId(true) }) + "</h2></p><p>");
- new SequenceAnnotationReport(null).createSequenceAnnotationReport(
+ new SequenceAnnotationReport(false).createSequenceAnnotationReport(
contents, seq, true, true, ap.getSeqPanel().seqCanvas.fr);
contents.append("</p>");
}
StringBuffer keyboardNo2;
- java.net.URL linkImageURL;
-
private final SequenceAnnotationReport seqARep;
/*
*/
public SeqPanel(AlignViewport viewport, AlignmentPanel alignPanel)
{
- linkImageURL = getClass().getResource("/images/link.gif");
- seqARep = new SequenceAnnotationReport(linkImageURL.toString());
+ seqARep = new SequenceAnnotationReport(true);
ToolTipManager.sharedInstance().registerComponent(this);
ToolTipManager.sharedInstance().setInitialDelay(0);
ToolTipManager.sharedInstance().setDismissDelay(10000);
{
List<SequenceFeature> features = ap.getFeatureRenderer()
.findFeaturesAtColumn(sequence, column + 1);
- unshownFeatures = seqARep.appendFeaturesLengthLimit(tooltipText, pos,
- features,
- this.ap.getSeqPanel().seqCanvas.fr, MAX_TOOLTIP_LENGTH);
+ unshownFeatures = seqARep.appendFeatures(tooltipText, pos,
+ features, this.ap.getSeqPanel().seqCanvas.fr,
+ MAX_TOOLTIP_LENGTH);
/*
* add features in CDS/protein complement at the corresponding
pos);
if (mf != null)
{
- unshownFeatures = seqARep.appendFeaturesLengthLimit(
- tooltipText, pos, mf, fr2,
- MAX_TOOLTIP_LENGTH);
+ unshownFeatures = seqARep.appendFeatures(tooltipText,
+ pos, mf, fr2, MAX_TOOLTIP_LENGTH);
}
}
}
{
char sequenceChar = sequence.getCharAt(column);
int pos = sequence.findPosition(column);
- setStatusMessage(sequence, seqIndex, sequenceChar, pos);
+ setStatusMessage(sequence.getName(), seqIndex, sequenceChar, pos);
return pos;
}
* Sequence 6 ID: O.niloticus.3 Nucleotide: Uracil (2)
* </pre>
*
- * @param sequence
+ * @param seqName
* @param seqIndex
* sequence position in the alignment (1..)
* @param sequenceChar
* @param residuePos
* the sequence residue position (if not over a gap)
*/
- protected void setStatusMessage(SequenceI sequence, int seqIndex,
+ protected void setStatusMessage(String seqName, int seqIndex,
char sequenceChar, int residuePos)
{
StringBuilder text = new StringBuilder(32);
*/
String seqno = seqIndex == -1 ? "" : " " + (seqIndex + 1);
text.append("Sequence").append(seqno).append(" ID: ")
- .append(sequence.getName());
+ .append(seqName);
String residue = null;
{
return;
}
- SequenceI ds = al.getSequenceAt(sequenceIndex).getDatasetSequence();
+ SequenceI alignedSeq = al.getSequenceAt(sequenceIndex);
+ SequenceI ds = alignedSeq.getDatasetSequence();
for (SearchResultMatchI m : results.getResults())
{
SequenceI seq = m.getSequence();
if (seq == ds)
{
int start = m.getStart();
- setStatusMessage(seq, sequenceIndex, seq.getCharAt(start - 1),
- start);
+ setStatusMessage(alignedSeq.getName(), sequenceIndex,
+ seq.getCharAt(start - 1), start);
return;
}
}
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io;
import java.io.File;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io;
import java.io.File;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io;
import jalview.bin.Cache;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io;
import jalview.bin.Cache;
*/
package jalview.io;
+import java.awt.Color;
+import java.io.IOException;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Collections;
+import java.util.HashMap;
+import java.util.LinkedHashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.Map.Entry;
+import java.util.TreeMap;
+
import jalview.analysis.AlignmentUtils;
import jalview.analysis.SequenceIdMatcher;
import jalview.api.AlignViewportI;
import jalview.util.ParseHtmlBodyAndLinks;
import jalview.util.StringUtils;
-import java.awt.Color;
-import java.io.IOException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Collections;
-import java.util.HashMap;
-import java.util.LinkedHashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.Map.Entry;
-import java.util.TreeMap;
-
/**
* Parses and writes features files, which may be in Jalview, GFF2 or GFF3
* format. These are tab-delimited formats but with differences in the use of
if (mf != null)
{
- MapList mapping = mf.mapping.getMap();
for (SequenceFeature sf : mf.features)
{
/*
found.add(sf);
int begin = sf.getBegin();
int end = sf.getEnd();
- int[] range = mf.mapping.getTo() == seq.getDatasetSequence()
- ? mapping.locateInTo(begin, end)
- : mapping.locateInFrom(begin, end);
+ int[] range = mf.getMappedPositions(begin, end);
SequenceFeature sf2 = new SequenceFeature(sf, range[0],
range[1], group, sf.getScore());
complementary.add(sf2);
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io;
public class IntKeyStringValueEntry
private static final int MAX_SOURCES = 40;
- // public static final String[][] PRIMARY_SOURCES moved to DBRefSource.java
+ private static String linkImageURL;
- final String linkImageURL;
+ // public static final String[][] PRIMARY_SOURCES moved to DBRefSource.java
/*
* Comparator to order DBRefEntry by Source + accession id (case-insensitive),
// }
};
- public SequenceAnnotationReport(String linkURL)
+ private boolean forTooltip;
+
+ /**
+ * Constructor given a flag which affects behaviour
+ * <ul>
+ * <li>if true, generates feature details suitable to show in a tooltip</li>
+ * <li>if false, generates feature details in a form suitable for the sequence
+ * details report</li>
+ * </ul>
+ *
+ * @param isForTooltip
+ */
+ public SequenceAnnotationReport(boolean isForTooltip)
{
- this.linkImageURL = linkURL;
+ this.forTooltip = isForTooltip;
+ if (linkImageURL == null)
+ {
+ linkImageURL = getClass().getResource("/images/link.gif").toString();
+ }
}
/**
- * Append text for the list of features to the tooltip Returns number of
- * features left if maxlength limit is (or would have been) reached
+ * Append text for the list of features to the tooltip. Returns the number of
+ * features not added if maxlength limit is (or would have been) reached.
*
* @param sb
* @param residuePos
* @param minmax
* @param maxlength
*/
- public int appendFeaturesLengthLimit(final StringBuilder sb,
+ public int appendFeatures(final StringBuilder sb,
int residuePos, List<SequenceFeature> features,
FeatureRendererModel fr, int maxlength)
{
return 0;
}
- public void appendFeatures(final StringBuilder sb, int residuePos,
- List<SequenceFeature> features, FeatureRendererModel fr)
- {
- appendFeaturesLengthLimit(sb, residuePos, features, fr, 0);
- }
-
/**
- * Appends text for mapped features (e.g. CDS feature for peptide or vice versa)
- * Returns number of features left if maxlength limit is (or would have been)
- * reached
+ * Appends text for mapped features (e.g. CDS feature for peptide or vice
+ * versa) Returns number of features left if maxlength limit is (or would have
+ * been) reached.
*
* @param sb
* @param residuePos
* @param fr
* @param maxlength
*/
- public int appendFeaturesLengthLimit(StringBuilder sb, int residuePos,
+ public int appendFeatures(StringBuilder sb, int residuePos,
MappedFeatures mf, FeatureRendererModel fr, int maxlength)
{
for (int i = 0; i < mf.features.size(); i++)
return 0;
}
- public void appendFeatures(StringBuilder sb, int residuePos,
- MappedFeatures mf, FeatureRendererModel fr)
- {
- appendFeaturesLengthLimit(sb, residuePos, mf, fr, 0);
- }
-
/**
* Appends the feature at rpos to the given buffer
*
FeatureRendererModel fr, SequenceFeature feature,
MappedFeatures mf, int maxlength)
{
+ int begin = feature.getBegin();
+ int end = feature.getEnd();
+
+ /*
+ * if this is a virtual features, convert begin/end to the
+ * coordinates of the sequence it is mapped to
+ */
+ int[] beginRange = null;
+ int[] endRange = null;
+ if (mf != null)
+ {
+ beginRange = mf.getMappedPositions(begin, begin);
+ endRange = mf.getMappedPositions(end, end);
+ if (beginRange == null || endRange == null)
+ {
+ // something went wrong
+ return false;
+ }
+ begin = beginRange[0];
+ end = endRange[endRange.length - 1];
+ }
+
StringBuilder sb = new StringBuilder();
if (feature.isContactFeature())
{
- if (feature.getBegin() == rpos || feature.getEnd() == rpos)
+ /*
+ * include if rpos is at start or end position of [mapped] feature
+ */
+ boolean showContact = (mf == null) && (rpos == begin || rpos == end);
+ boolean showMappedContact = (mf != null) && ((rpos >= beginRange[0]
+ && rpos <= beginRange[beginRange.length - 1])
+ || (rpos >= endRange[0]
+ && rpos <= endRange[endRange.length - 1]));
+ if (showContact || showMappedContact)
{
if (sb0.length() > 6)
{
sb.append("<br/>");
}
- sb.append(feature.getType()).append(" ").append(feature.getBegin())
- .append(":").append(feature.getEnd());
+ sb.append(feature.getType()).append(" ").append(begin).append(":")
+ .append(end);
}
- return appendTextMaxLengthReached(sb0, sb, maxlength);
+ return appendText(sb0, sb, maxlength);
}
if (sb0.length() > 6)
if (rpos != 0)
{
// we are marking a positional feature
- sb.append(feature.begin);
- }
- if (feature.begin != feature.end)
- {
- sb.append(" ").append(feature.end);
+ sb.append(begin);
+ if (begin != end)
+ {
+ sb.append(" ").append(end);
+ }
}
String description = feature.getDescription();
}
}
}
- return appendTextMaxLengthReached(sb0, sb, maxlength);
- }
-
- void appendFeature(final StringBuilder sb, int rpos,
- FeatureRendererModel fr, SequenceFeature feature,
- MappedFeatures mf)
- {
- appendFeature(sb, rpos, fr, feature, mf, 0);
+ return appendText(sb0, sb, maxlength);
}
/**
- * Appends {@code sb} to {@code sb0}, and returns false, unless
- * {@code maxlength} is not zero and appending would make the total length
- * greater than {@code maxlength}, in which case the text is not appended, and
- * the method returns true.
+ * Appends sb to sb0, and returns false, unless maxlength is not zero and
+ * appending would make the result longer than or equal to maxlength, in which
+ * case the append is not done and returns true
*
* @param sb0
* @param sb
* @param maxlength
* @return
*/
- private static boolean appendTextMaxLengthReached(StringBuilder sb0,
- StringBuilder sb, int maxlength)
+ private static boolean appendText(StringBuilder sb0, StringBuilder sb,
+ int maxlength)
{
if (maxlength == 0 || sb0.length() + sb.length() < maxlength)
{
.getNonPositionalFeatures())
{
int sz = -sb.length();
- appendFeature(sb, 0, fr, sf, null);
+ appendFeature(sb, 0, fr, sf, null, 0);
sz += sb.length();
maxWidth = Math.max(maxWidth, sz);
}
*/
package jalview.io;
-import jalview.analysis.Rna;
-import jalview.datamodel.AlignmentAnnotation;
-import jalview.datamodel.AlignmentI;
-import jalview.datamodel.Annotation;
-import jalview.datamodel.DBRefEntry;
-import jalview.datamodel.Mapping;
-import jalview.datamodel.Sequence;
-import jalview.datamodel.SequenceFeature;
-import jalview.datamodel.SequenceI;
-import jalview.schemes.ResidueProperties;
-import jalview.util.Comparison;
-import jalview.util.Format;
-import jalview.util.MessageManager;
-
import java.io.BufferedReader;
import java.io.FileReader;
import java.io.IOException;
import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
import fr.orsay.lri.varna.factories.RNAFactory;
import fr.orsay.lri.varna.models.rna.RNA;
+import jalview.analysis.Rna;
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Annotation;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.DBRefSource;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.schemes.ResidueProperties;
+import jalview.util.Comparison;
+import jalview.util.DBRefUtils;
+import jalview.util.Format;
+import jalview.util.MessageManager;
// import org.apache.log4j.*;
if (accAnnotations != null && accAnnotations.containsKey("AC"))
{
- if (dbsource != null)
+ String dbr = (String) accAnnotations.get("AC");
+ if (dbr != null)
{
- String dbr = (String) accAnnotations.get("AC");
- if (dbr != null)
- {
- // we could get very clever here - but for now - just try to
- // guess accession type from source of alignment plus structure
- // of accession
- guessDatabaseFor(seqO, dbr, dbsource);
-
- }
+ // we could get very clever here - but for now - just try to
+ // guess accession type from type of sequence, source of alignment plus
+ // structure
+ // of accession
+ guessDatabaseFor(seqO, dbr, dbsource);
}
// else - do what ? add the data anyway and prompt the user to
// specify what references these are ?
treeName = an.stringMatched(2);
treeString = new StringBuffer();
}
+ // TODO: JAL-3532 - this is where GF comments and database references are lost
+ // suggest overriding this method for Stockholm files to catch and properly
+ // process CC, DR etc into multivalued properties
setAlignmentProperty(an.stringMatched(1), an.stringMatched(2));
}
}
st = -1;
}
}
+ if (dbsource == null)
+ {
+ // make up an origin based on whether the sequence looks like it is nucleotide
+ // or protein
+ dbsource = (seqO.isProtein()) ? "PFAM" : "RFAM";
+ }
if (dbsource.equals("PFAM"))
{
seqdb = "UNIPROT";
return annot;
}
+ private String dbref_to_ac_record(DBRefEntry ref)
+ {
+ return ref.getSource().toString() + " ; "
+ + ref.getAccessionId().toString();
+ }
@Override
public String print(SequenceI[] s, boolean jvSuffix)
{
int slen = s.length;
SequenceI seq;
Hashtable<String, String> dataRef = null;
+ boolean isAA = s[in].isProtein();
while ((in < slen) && ((seq = s[in]) != null))
{
String tmp = printId(seq, jvSuffix);
{
dataRef = new Hashtable<>();
}
- for (int idb = 0; idb < ndb; idb++)
+ List<DBRefEntry> primrefs = seq.getPrimaryDBRefs();
+ if (primrefs.size() >= 1)
{
-
- DBRefEntry ref = seqrefs.get(idb);
- String datAs1 = ref.getSource().toString()
- + " ; "
- + ref.getAccessionId().toString();
- dataRef.put(tmp, datAs1);
+ dataRef.put(tmp, dbref_to_ac_record(primrefs.get(0)));
+ }
+ else
+ {
+ for (int idb = 0; idb < seq.getDBRefs().size(); idb++)
+ {
+ DBRefEntry dbref = seq.getDBRefs().get(idb);
+ dataRef.put(tmp, dbref_to_ac_record(dbref));
+ // if we put in a uniprot or EMBL record then we're done:
+ if (isAA && DBRefSource.UNIPROT
+ .equals(DBRefUtils.getCanonicalName(dbref.getSource())))
+ {
+ break;
+ }
+ if (!isAA && DBRefSource.EMBL
+ .equals(DBRefUtils.getCanonicalName(dbref.getSource())))
+ {
+ break;
+ }
+ }
}
}
in++;
while (en.hasMoreElements())
{
Object idd = en.nextElement();
- String type = (String) dataRef.remove(idd);
+ String type = dataRef.remove(idd);
out.append(new Format("%-" + (maxid - 2) + "s")
.form("#=GS " + idd.toString() + " "));
- if (type.contains("PFAM") || type.contains("RFAM"))
+ if (isAA && type.contains("UNIPROT")
+ || (!isAA && type.contains("EMBL")))
{
out.append(" AC " + type.substring(type.indexOf(";") + 1));
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.io.vcf;
import jalview.analysis.Dna;
continue;
}
+ /*
+ * JAL-3045 text is always drawn over features, even if
+ * 'Show Text' is unchecked in the format menu
+ */
g.setColor(Color.white);
int charOffset = (charWidth - fm.charWidth(s)) / 2;
g.drawString(String.valueOf(s),
*/
package jalview.util;
-import jalview.datamodel.DBRefEntry;
-import jalview.datamodel.DBRefSource;
-import jalview.datamodel.Mapping;
-import jalview.datamodel.PDBEntry;
-import jalview.datamodel.SequenceI;
-
import java.util.ArrayList;
import java.util.BitSet;
import java.util.HashMap;
import java.util.HashSet;
import java.util.List;
import java.util.Map;
-import java.util.Set;
import com.stevesoft.pat.Regex;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.DBRefSource;
+import jalview.datamodel.Mapping;
+import jalview.datamodel.PDBEntry;
+import jalview.datamodel.SequenceI;
+
/**
* Utilities for handling DBRef objects and their collections.
*/
};
+ /**
+ * Parses a DBRefEntry and adds it to the sequence, also a PDBEntry if the
+ * database is PDB.
+ * <p>
+ * Used by file parsers to generate DBRefs from annotation within file (eg
+ * Stockholm)
+ *
+ * @param dbname
+ * @param version
+ * @param acn
+ * @param seq
+ * where to annotate with reference
+ * @return parsed version of entry that was added to seq (if any)
+ */
+ public static DBRefEntry parseToDbRef(SequenceI seq, String dbname,
+ String version, String acn)
+ {
+ DBRefEntry ref = null;
+ if (dbname != null)
+ {
+ String locsrc = DBRefUtils.getCanonicalName(dbname);
+ if (locsrc.equals(DBRefSource.PDB))
+ {
+ /*
+ * Check for PFAM style stockhom PDB accession id citation e.g.
+ * "1WRI A; 7-80;"
+ */
+ Regex r = new com.stevesoft.pat.Regex(
+ "([0-9][0-9A-Za-z]{3})\\s*(.?)\\s*;\\s*([0-9]+)-([0-9]+)");
+ if (r.search(acn.trim()))
+ {
+ String pdbid = r.stringMatched(1);
+ String chaincode = r.stringMatched(2);
+ if (chaincode == null)
+ {
+ chaincode = " ";
+ }
+ // String mapstart = r.stringMatched(3);
+ // String mapend = r.stringMatched(4);
+ if (chaincode.equals(" "))
+ {
+ chaincode = "_";
+ }
+ // construct pdb ref.
+ ref = new DBRefEntry(locsrc, version, pdbid + chaincode);
+ PDBEntry pdbr = new PDBEntry();
+ pdbr.setId(pdbid);
+ pdbr.setType(PDBEntry.Type.PDB);
+ pdbr.setChainCode(chaincode);
+ seq.addPDBId(pdbr);
+ }
+ else
+ {
+ System.err.println("Malformed PDB DR line:" + acn);
+ }
+ }
+ else
+ {
+ // default:
+ ref = new DBRefEntry(locsrc, version, acn.trim());
+ }
+ }
+ if (ref != null)
+ {
+ seq.addDBRef(ref);
+ }
+ return ref;
+ }
+
/**
* accession ID and DB must be identical. Version is ignored. Map is either not
* defined or is a match (or is compatible?)
}
/**
- * Parses a DBRefEntry and adds it to the sequence, also a PDBEntry if the
- * database is PDB.
- * <p>
- * Used by file parsers to generate DBRefs from annotation within file (eg
- * Stockholm)
- *
- * @param dbname
- * @param version
- * @param acn
- * @param seq where to annotate with reference
- * @return parsed version of entry that was added to seq (if any)
- */
- public static DBRefEntry parseToDbRef(SequenceI seq, String dbname, String version, String acn) {
- DBRefEntry ref = null;
- if (dbname != null) {
- String locsrc = DBRefUtils.getCanonicalName(dbname);
- if (locsrc.equals(DBRefSource.PDB)) {
- /*
- * Check for PFAM style stockhom PDB accession id citation e.g. "1WRI A; 7-80;"
- */
- Regex r = new com.stevesoft.pat.Regex("([0-9][0-9A-Za-z]{3})\\s*(.?)\\s*;\\s*([0-9]+)-([0-9]+)");
- if (r.search(acn.trim())) {
- String pdbid = r.stringMatched(1);
- String chaincode = r.stringMatched(2);
- if (chaincode == null) {
- chaincode = " ";
- }
- // String mapstart = r.stringMatched(3);
- // String mapend = r.stringMatched(4);
- if (chaincode.equals(" ")) {
- chaincode = "_";
- }
- // construct pdb ref.
- ref = new DBRefEntry(locsrc, version, pdbid + chaincode);
- PDBEntry pdbr = new PDBEntry();
- pdbr.setId(pdbid);
- pdbr.setType(PDBEntry.Type.PDB);
- pdbr.setChainCode(chaincode);
- seq.addPDBId(pdbr);
- } else {
- System.err.println("Malformed PDB DR line:" + acn);
- }
- } else {
- // default:
- ref = new DBRefEntry(locsrc, version, acn);
- }
- }
- if (ref != null) {
- seq.addDBRef(ref);
- }
- return ref;
- }
-
- /**
* Returns true if either object is null, or they are equal
*
* @param o1
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
import java.io.IOException;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
public class MathUtils
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
import java.awt.event.MouseEvent;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
import java.awt.GraphicsEnvironment;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
import java.awt.GraphicsEnvironment;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util;
import java.awt.event.MouseEvent;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util.matcher;
import jalview.util.MessageManager;
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util.matcher;
import java.util.Objects;
-import java.util.regex.Pattern;
/**
* A bean to describe one attribute-based filter
*/
public class Matcher implements MatcherI
{
+ public enum PatternType
+ {
+ String, Integer, Float
+ }
+
/*
* the comparison condition
*/
- Condition condition;
+ private final Condition condition;
/*
- * the string pattern as entered, or the regex, to compare to
- * also holds the string form of float value if a numeric condition
+ * the string pattern as entered, to compare to
*/
- String pattern;
+ private String pattern;
/*
* the pattern in upper case, for non-case-sensitive matching
*/
- String uppercasePattern;
+ private final String uppercasePattern;
/*
* the compiled regex if using a pattern match condition
- * (reserved for possible future enhancement)
+ * (possible future enhancement)
+ */
+ // private Pattern regexPattern;
+
+ /*
+ * the value to compare to for a numerical condition with a float pattern
*/
- Pattern regexPattern;
+ private float floatValue = 0F;
/*
- * the value to compare to for a numerical condition
+ * the value to compare to for a numerical condition with an integer pattern
*/
- float value;
+ private long longValue = 0L;
+
+ private PatternType patternType;
/**
* Constructor
{
Objects.requireNonNull(cond);
condition = cond;
+
if (cond.isNumeric())
{
- value = Float.valueOf(compareTo);
- pattern = String.valueOf(value);
- uppercasePattern = pattern;
+ try
+ {
+ longValue = Long.valueOf(compareTo);
+ pattern = String.valueOf(longValue);
+ patternType = PatternType.Integer;
+ } catch (NumberFormatException e)
+ {
+ floatValue = Float.valueOf(compareTo);
+ pattern = String.valueOf(floatValue);
+ patternType = PatternType.Float;
+ }
}
else
{
pattern = compareTo;
- if (pattern != null)
- {
- uppercasePattern = pattern.toUpperCase();
- }
+ patternType = PatternType.String;
}
+ uppercasePattern = pattern == null ? null : pattern.toUpperCase();
+
// if we add regex conditions (e.g. matchesPattern), then
// pattern should hold the raw regex, and
// regexPattern = Pattern.compile(compareTo);
}
/**
- * Constructor for a numerical match condition. Note that if a string
- * comparison condition is specified, this will be converted to a comparison
- * with the float value as string
+ * Constructor for a float-valued numerical match condition. Note that if a
+ * string comparison condition is specified, this will be converted to a
+ * comparison with the float value as string
*
* @param cond
* @param compareTo
}
/**
+ * Constructor for an integer-valued numerical match condition. Note that if a
+ * string comparison condition is specified, this will be converted to a
+ * comparison with the integer value as string
+ *
+ * @param cond
+ * @param compareTo
+ */
+ public Matcher(Condition cond, long compareTo)
+ {
+ this(cond, String.valueOf(compareTo));
+ }
+
+ /**
* {@inheritDoc}
*/
- @SuppressWarnings("incomplete-switch")
@Override
- public boolean matches(String val)
+ public boolean matches(String compareTo)
{
- if (condition.isNumeric())
+ if (compareTo == null)
{
- try
- {
- /*
- * treat a null value (no such attribute) as
- * failing any numerical filter condition
- */
- return val == null ? false : matches(Float.valueOf(val));
- } catch (NumberFormatException e)
- {
- return false;
- }
+ return matchesNull();
}
-
- /*
- * a null value matches a negative condition, fails a positive test
- */
- if (val == null)
+
+ boolean matched = false;
+ switch (patternType)
{
- return condition == Condition.NotContains
- || condition == Condition.NotMatches
- || condition == Condition.NotPresent;
+ case Float:
+ matched = matchesFloat(compareTo, floatValue);
+ break;
+ case Integer:
+ matched = matchesLong(compareTo);
+ break;
+ default:
+ matched = matchesString(compareTo);
+ break;
}
-
- String upper = val.toUpperCase().trim();
+ return matched;
+ }
+
+ /**
+ * Executes a non-case-sensitive string comparison to the given value, after
+ * trimming it. Returns true if the test passes, false if it fails.
+ *
+ * @param compareTo
+ * @return
+ */
+ boolean matchesString(String compareTo)
+ {
boolean matched = false;
+ String upper = compareTo.toUpperCase().trim();
switch(condition) {
case Matches:
matched = upper.equals(uppercasePattern);
}
/**
- * Applies a numerical comparison match condition
+ * Performs a numerical comparison match condition test against a float value
*
- * @param f
+ * @param testee
+ * @param compareTo
* @return
*/
- @SuppressWarnings("incomplete-switch")
- boolean matches(float f)
+ boolean matchesFloat(String testee, float compareTo)
{
if (!condition.isNumeric())
{
- return matches(String.valueOf(f));
+ // failsafe, shouldn't happen
+ return matches(testee);
+ }
+
+ float f = 0f;
+ try
+ {
+ f = Float.valueOf(testee);
+ } catch (NumberFormatException e)
+ {
+ return false;
}
boolean matched = false;
switch (condition) {
case LT:
- matched = f < value;
+ matched = f < compareTo;
break;
case LE:
- matched = f <= value;
+ matched = f <= compareTo;
break;
case EQ:
- matched = f == value;
+ matched = f == compareTo;
break;
case NE:
- matched = f != value;
+ matched = f != compareTo;
break;
case GT:
- matched = f > value;
+ matched = f > compareTo;
break;
case GE:
- matched = f >= value;
+ matched = f >= compareTo;
break;
default:
break;
@Override
public int hashCode()
{
- return pattern.hashCode() + condition.hashCode() + (int) value;
+ return pattern.hashCode() + condition.hashCode() + (int) floatValue;
}
/**
return false;
}
Matcher m = (Matcher) obj;
- if (condition != m.condition || value != m.value)
+ if (condition != m.condition || floatValue != m.floatValue
+ || longValue != m.longValue)
{
return false;
}
}
@Override
- public float getFloatValue()
- {
- return value;
- }
-
- @Override
public String toString()
{
StringBuilder sb = new StringBuilder();
return sb.toString();
}
+
+ /**
+ * Performs a numerical comparison match condition test against an integer
+ * value
+ *
+ * @param compareTo
+ * @return
+ */
+ boolean matchesLong(String compareTo)
+ {
+ if (!condition.isNumeric())
+ {
+ // failsafe, shouldn't happen
+ return matches(String.valueOf(compareTo));
+ }
+
+ long val = 0L;
+ try
+ {
+ val = Long.valueOf(compareTo);
+ } catch (NumberFormatException e)
+ {
+ /*
+ * try the presented value as a float instead
+ */
+ return matchesFloat(compareTo, longValue);
+ }
+
+ boolean matched = false;
+ switch (condition) {
+ case LT:
+ matched = val < longValue;
+ break;
+ case LE:
+ matched = val <= longValue;
+ break;
+ case EQ:
+ matched = val == longValue;
+ break;
+ case NE:
+ matched = val != longValue;
+ break;
+ case GT:
+ matched = val > longValue;
+ break;
+ case GE:
+ matched = val >= longValue;
+ break;
+ default:
+ break;
+ }
+
+ return matched;
+ }
+
+ /**
+ * Tests whether a null value matches the condition. The rule is that any
+ * numeric condition is failed, and only 'negative' string conditions are
+ * matched. So for example <br>
+ * {@code null contains "damaging"}<br>
+ * fails, but <br>
+ * {@code null does not contain "damaging"}</br>
+ * passes.
+ */
+ boolean matchesNull()
+ {
+ if (condition.isNumeric())
+ {
+ return false;
+ }
+ else
+ {
+ return condition == Condition.NotContains
+ || condition == Condition.NotMatches
+ || condition == Condition.NotPresent;
+ }
+ }
}
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ *
+ * This file is part of Jalview.
+ *
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
+ * Jalview is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
+ * PURPOSE. See the GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
package jalview.util.matcher;
public interface MatcherI
Condition getCondition();
String getPattern();
-
- float getFloatValue();
}
}
@Override
- public MappedFeatures findComplementFeaturesAtResidue(SequenceI sequence,
- int pos)
+ public MappedFeatures findComplementFeaturesAtResidue(
+ final SequenceI sequence, final int pos)
{
SequenceI ds = sequence.getDatasetSequence();
if (ds == null)
}
/*
- * sort by renderorder, inefficiently
+ * sort by renderorder (inefficiently but ok for small scale);
+ * NB this sorts 'on top' feature to end, for rendering
*/
List<SequenceFeature> result = new ArrayList<>();
+ final int toAdd = found.size();
+ int added = 0;
for (String type : renderOrder)
{
for (SequenceFeature sf : found)
if (type.equals(sf.getType()))
{
result.add(sf);
- if (result.size() == found.size())
- {
- return new MappedFeatures(mapping, mapFrom, pos, residue,
- result);
- }
+ added++;
+ }
+ if (added == toAdd)
+ {
+ break;
}
}
}
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
-import jalview.gui.JvOptionPane;
-
import java.util.BitSet;
import org.junit.Assert;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
+import jalview.gui.JvOptionPane;
+
public class SearchResultsTest
{
sr.addResult(seq1, 3, 6);
assertEquals(2, sr.getSize());
}
+
+ /**
+ * Test for method that checks if search results matches a sequence region
+ */
+ @Test(groups = { "Functional" })
+ public void testInvolvesSequence()
+ {
+ SequenceI dataset = new Sequence("genome", "ATGGCCCTTTAAGCAACATTT");
+ // first 'exon':
+ SequenceI cds1 = new Sequence("cds1/1-12", "ATGGCCCTTTAA");
+ cds1.setDatasetSequence(dataset);
+ // overlapping second 'exon':
+ SequenceI cds2 = new Sequence("cds2/7-18", "CTTTAAGCAACA");
+ cds2.setDatasetSequence(dataset);
+ // unrelated sequence
+ SequenceI cds3 = new Sequence("cds3", "ATGGCCCTTTAAGCAACA");
+
+ SearchResults sr = new SearchResults();
+ assertFalse(sr.involvesSequence(cds1));
+
+ /*
+ * cds1 and cds2 share the same dataset sequence, but
+ * only cds1 overlaps match 4:6 (fixes bug JAL-3613)
+ */
+ sr.addResult(dataset, 4, 6);
+ assertTrue(sr.involvesSequence(cds1));
+ assertFalse(sr.involvesSequence(cds2));
+ assertFalse(sr.involvesSequence(cds3));
+
+ /*
+ * search results overlap cds2 only
+ */
+ sr = new SearchResults();
+ sr.addResult(dataset, 18, 18);
+ assertFalse(sr.involvesSequence(cds1));
+ assertTrue(sr.involvesSequence(cds2));
+
+ /*
+ * add a search result overlapping cds1
+ */
+ sr.addResult(dataset, 1, 1);
+ assertTrue(sr.involvesSequence(cds1));
+ assertTrue(sr.involvesSequence(cds2));
+
+ /*
+ * single search result overlapping both
+ */
+ sr = new SearchResults();
+ sr.addResult(dataset, 10, 12);
+ assertTrue(sr.involvesSequence(cds1));
+ assertTrue(sr.involvesSequence(cds2));
+
+ /*
+ * search results matching aligned sequence
+ */
+ sr = new SearchResults();
+ sr.addResult(cds1, 10, 12);
+ assertTrue(sr.involvesSequence(cds1));
+ assertFalse(sr.involvesSequence(cds2));
+ sr.addResult(cds2, 1, 3); // no start-end overlap
+ assertFalse(sr.involvesSequence(cds2));
+ sr.addResult(cds2, 7, 9); // start-end overlap
+ assertTrue(sr.involvesSequence(cds2));
+ }
}
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
-import jalview.gui.JvOptionPane;
+import java.util.ArrayList;
+import java.util.List;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
+import jalview.gui.JvOptionPane;
+import jalview.util.MapList;
+
public class SequenceFeatureTest
{
String expected = "<br><table><tr><td>Location</td><td>TestSeq</td><td>22</td></tr>"
+ "<tr><td>Type</td><td>variant</td><td></td></tr>"
+ "<tr><td>Description</td><td>G,C</td><td></td></tr></table>";
- assertEquals(expected, sf.getDetailsReport(seqName));
+ assertEquals(expected, sf.getDetailsReport(seqName, null));
// contact feature
sf = new SequenceFeature("Disulphide Bond", "a description", 28, 31,
expected = "<br><table><tr><td>Location</td><td>TestSeq</td><td>28:31</td></tr>"
+ "<tr><td>Type</td><td>Disulphide Bond</td><td></td></tr>"
+ "<tr><td>Description</td><td>a description</td><td></td></tr></table>";
- assertEquals(expected, sf.getDetailsReport(seqName));
+ assertEquals(expected, sf.getDetailsReport(seqName, null));
sf = new SequenceFeature("variant", "G,C", 22, 33,
12.5f, "group");
+ "<tr><td>Group</td><td>group</td><td></td></tr>"
+ "<tr><td>Child</td><td></td><td>ENSP002</td></tr>"
+ "<tr><td>Parent</td><td></td><td>ENSG001</td></tr></table>";
- assertEquals(expected, sf.getDetailsReport(seqName));
+ assertEquals(expected, sf.getDetailsReport(seqName, null));
/*
* feature with embedded html link in description
+ "<tr><td>Type</td><td>Pfam</td><td></td></tr>"
+ "<tr><td>Description</td><td>Fer2 Status: True Positive <a href=\"http://pfam.xfam.org/family/PF00111\">Pfam 8_8</a></td><td></td></tr>"
+ "<tr><td>Group</td><td>Uniprot</td><td></td></tr></table>";
- assertEquals(expected, sf.getDetailsReport(seqName));
+ assertEquals(expected, sf.getDetailsReport(seqName, null));
+ }
+
+ /**
+ * Feature details report for a virtual feature should include original and
+ * mapped locations, and also derived peptide consequence if it can be
+ * determined
+ */
+ @Test(groups = { "Functional" })
+ public void testGetDetailsReport_virtualFeature()
+ {
+ SequenceI cds = new Sequence("Cds/101-121", "CCTttgAGAtttCAAatgGAT");
+ SequenceI seq = new Sequence("TestSeq/8-14", "PLRFQMD");
+ MapList map = new MapList(new int[] { 101, 118 }, new int[] { 8, 13 },
+ 3, 1);
+ Mapping mapping = new Mapping(seq, map);
+ List<SequenceFeature> features = new ArrayList<>();
+ // vary ttg (Leu) to ttc (Phe)
+ SequenceFeature sf = new SequenceFeature("variant", "G,C", 106, 106,
+ null);
+ sf.setValue("alleles", "G,C"); // needed to compute peptide consequence!
+ features.add(sf);
+
+ MappedFeatures mf = new MappedFeatures(mapping, cds, 9, 'L', features);
+
+ String expected = "<br><table><tr><td>Location</td><td>Cds</td><td>106</td></tr>"
+ + "<tr><td>Peptide Location</td><td>TestSeq</td><td>9</td></tr>"
+ + "<tr><td>Type</td><td>variant</td><td></td></tr>"
+ + "<tr><td>Description</td><td>G,C</td><td></td></tr>"
+ + "<tr><td>Consequence</td><td><i>Translated by Jalview</i></td><td>p.Leu9Phe</td></tr>"
+ + "<tr><td>alleles</td><td></td><td>G,C</td></tr>"
+ + "</table>";
+
+ assertEquals(expected, sf.getDetailsReport(seq.getName(), mf));
}
}
import static org.testng.Assert.assertSame;
import static org.testng.Assert.assertTrue;
-import jalview.datamodel.SequenceFeature;
-import jalview.util.MessageManager;
-import jalview.util.matcher.Condition;
-
import java.util.Locale;
import org.testng.annotations.Test;
+import jalview.datamodel.SequenceFeature;
+import jalview.util.MessageManager;
+import jalview.util.matcher.Condition;
+import jalview.util.matcher.Matcher;
+import jalview.util.matcher.MatcherI;
+import junit.extensions.PA;
+
public class FeatureMatcherTest
{
@Test(groups = "Functional")
FeatureMatcherI fm = FeatureMatcher.byAttribute(Condition.GE, "-2f",
"AF");
assertEquals(fm.getMatcher().getCondition(), Condition.GE);
- assertEquals(fm.getMatcher().getFloatValue(), -2F);
+ assertEquals(PA.getValue(fm.getMatcher(), "floatValue"), -2F);
assertEquals(fm.getMatcher().getPattern(), "-2.0");
}
assertFalse(fm.isByLabel());
assertFalse(fm.isByScore());
assertEquals(fm.getAttribute(), new String[] { "AF" });
- assertSame(Condition.LT, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getFloatValue(), 1.2f);
- assertEquals(fm.getMatcher().getPattern(), "1.2");
+ MatcherI matcher = fm.getMatcher();
+ assertSame(Condition.LT, matcher.getCondition());
+ assertEquals(PA.getValue(matcher, "floatValue"), 1.2f);
+ assertSame(PA.getValue(matcher, "patternType"),
+ Matcher.PatternType.Float);
+ assertEquals(matcher.getPattern(), "1.2");
// quotes are optional, condition is not case sensitive
fm = FeatureMatcher.fromString("AF lt '1.2'");
+ matcher = fm.getMatcher();
assertFalse(fm.isByLabel());
assertFalse(fm.isByScore());
assertEquals(fm.getAttribute(), new String[] { "AF" });
- assertSame(Condition.LT, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getFloatValue(), 1.2f);
- assertEquals(fm.getMatcher().getPattern(), "1.2");
+ assertSame(Condition.LT, matcher.getCondition());
+ assertEquals(PA.getValue(matcher, "floatValue"), 1.2F);
+ assertEquals(matcher.getPattern(), "1.2");
fm = FeatureMatcher.fromString("'AF' Present");
+ matcher = fm.getMatcher();
assertFalse(fm.isByLabel());
assertFalse(fm.isByScore());
assertEquals(fm.getAttribute(), new String[] { "AF" });
- assertSame(Condition.Present, fm.getMatcher().getCondition());
+ assertSame(Condition.Present, matcher.getCondition());
+ assertSame(PA.getValue(matcher, "patternType"),
+ Matcher.PatternType.String);
fm = FeatureMatcher.fromString("CSQ:Consequence contains damaging");
+ matcher = fm.getMatcher();
assertFalse(fm.isByLabel());
assertFalse(fm.isByScore());
assertEquals(fm.getAttribute(), new String[] { "CSQ", "Consequence" });
- assertSame(Condition.Contains, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "damaging");
+ assertSame(Condition.Contains, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "damaging");
// keyword Label is not case sensitive
fm = FeatureMatcher.fromString("LABEL Matches 'foobar'");
+ matcher = fm.getMatcher();
assertTrue(fm.isByLabel());
assertFalse(fm.isByScore());
assertNull(fm.getAttribute());
- assertSame(Condition.Matches, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "foobar");
+ assertSame(Condition.Matches, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "foobar");
fm = FeatureMatcher.fromString("'Label' matches 'foo bar'");
+ matcher = fm.getMatcher();
assertTrue(fm.isByLabel());
assertFalse(fm.isByScore());
assertNull(fm.getAttribute());
- assertSame(Condition.Matches, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "foo bar");
+ assertSame(Condition.Matches, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "foo bar");
// quotes optional on pattern
fm = FeatureMatcher.fromString("'Label' matches foo bar");
+ matcher = fm.getMatcher();
assertTrue(fm.isByLabel());
assertFalse(fm.isByScore());
assertNull(fm.getAttribute());
- assertSame(Condition.Matches, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "foo bar");
+ assertSame(Condition.Matches, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "foo bar");
- fm = FeatureMatcher.fromString("Score GE 12.2");
+ // integer condition
+ fm = FeatureMatcher.fromString("Score GE 12");
+ matcher = fm.getMatcher();
assertFalse(fm.isByLabel());
assertTrue(fm.isByScore());
assertNull(fm.getAttribute());
- assertSame(Condition.GE, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "12.2");
- assertEquals(fm.getMatcher().getFloatValue(), 12.2f);
+ assertSame(Condition.GE, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "12");
+ assertEquals(PA.getValue(matcher, "floatValue"), 0f);
+ assertEquals(PA.getValue(matcher, "longValue"), 12L);
+ assertSame(PA.getValue(matcher, "patternType"),
+ Matcher.PatternType.Integer);
// keyword Score is not case sensitive
fm = FeatureMatcher.fromString("'SCORE' ge '12.2'");
+ matcher = fm.getMatcher();
assertFalse(fm.isByLabel());
assertTrue(fm.isByScore());
assertNull(fm.getAttribute());
- assertSame(Condition.GE, fm.getMatcher().getCondition());
- assertEquals(fm.getMatcher().getPattern(), "12.2");
- assertEquals(fm.getMatcher().getFloatValue(), 12.2f);
+ assertSame(Condition.GE, matcher.getCondition());
+ assertEquals(matcher.getPattern(), "12.2");
+ assertEquals(PA.getValue(matcher, "floatValue"), 12.2F);
// invalid numeric pattern
assertNull(FeatureMatcher.fromString("Score eq twelve"));
import static org.testng.Assert.assertSame;
import static org.testng.Assert.assertTrue;
-import jalview.datamodel.SequenceFeature;
-
import java.util.ArrayList;
import java.util.Iterator;
import java.util.List;
import org.testng.annotations.Test;
+import jalview.datamodel.SequenceFeature;
import junit.extensions.PA;
public class SequenceFeaturesTest
public void testSortFeatures()
{
List<SequenceFeature> sfs = new ArrayList<>();
- SequenceFeature sf1 = new SequenceFeature("Pfam", "desc", 30, 80,
+ SequenceFeature sf1 = new SequenceFeature("Pfam", "desc", 30,
+ 60,
Float.NaN, null);
sfs.add(sf1);
SequenceFeature sf2 = new SequenceFeature("Rfam", "desc", 40, 50,
SequenceFeature sf3 = new SequenceFeature("Rfam", "desc", 50, 60,
Float.NaN, null);
sfs.add(sf3);
+ SequenceFeature sf4 = new SequenceFeature("Xfam", "desc", 30,
+ 80,
+ Float.NaN, null);
+ sfs.add(sf4);
+ SequenceFeature sf5 = new SequenceFeature("Xfam", "desc", 30,
+ 90,
+ Float.NaN, null);
+ sfs.add(sf5);
- // sort by end position descending
+ /*
+ * sort by end position descending, order unchanged if matched
+ */
SequenceFeatures.sortFeatures(sfs, false);
- assertSame(sfs.get(0), sf1);
- assertSame(sfs.get(1), sf3);
- assertSame(sfs.get(2), sf2);
+ assertSame(sfs.get(0), sf5); // end 90
+ assertSame(sfs.get(1), sf4); // end 80
+ assertSame(sfs.get(2), sf1); // end 60, start 50
+ assertSame(sfs.get(3), sf3); // end 60, start 30
+ assertSame(sfs.get(4), sf2); // end 50
- // sort by start position ascending
+ /*
+ * resort {5, 4, 1, 3, 2} by start position ascending, end descending
+ */
SequenceFeatures.sortFeatures(sfs, true);
- assertSame(sfs.get(0), sf1);
- assertSame(sfs.get(1), sf2);
- assertSame(sfs.get(2), sf3);
+ assertSame(sfs.get(0), sf5); // start 30, end 90
+ assertSame(sfs.get(1), sf4); // start 30, end 80
+ assertSame(sfs.get(2), sf1); // start 30, end 60
+ assertSame(sfs.get(3), sf2); // start 40
+ assertSame(sfs.get(4), sf3); // start 50
}
@Test(groups = "Functional")
import static org.testng.Assert.assertNull;
import static org.testng.Assert.assertTrue;
+import java.awt.Color;
+import java.io.File;
+import java.io.IOException;
+import java.util.HashMap;
+
+import org.testng.annotations.Test;
+
import jalview.api.FeatureColourI;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.util.matcher.Condition;
import jalview.viewmodel.seqfeatures.FeatureRendererModel;
-import java.awt.Color;
-import java.io.File;
-import java.io.IOException;
-import java.util.HashMap;
-
-import org.testng.annotations.Test;
-
public class FeatureSettingsTest
{
/**
assertEquals(fr.getFeatureFilter("type2").toStableString(),
"(Score LE 2.4) AND (Score GT 1.1)");
assertEquals(fr.getFeatureFilter("type3").toStableString(),
- "(AF Contains X) OR (CSQ:PolyPhen NE 0.0)");
+ "(AF Contains X) OR (CSQ:PolyPhen NE 0)");
}
/**
File f = generateAlignment();
f.deleteOnExit();
+ long expectedMin = 35L;
+ long usedMemoryAtStart=getUsedMemory();
+ if (usedMemoryAtStart>expectedMin)
+ {
+ System.err.println("used memory before test is "+usedMemoryAtStart+" > "+expectedMin+"MB .. adjusting minimum.");
+ expectedMin = usedMemoryAtStart;
+ }
doStuffInJalview(f);
Desktop.instance.closeAll_actionPerformed(null);
- checkUsedMemory(35L);
+ checkUsedMemory(expectedMin);
}
+ private static long getUsedMemory()
+ {
+ long availableMemory = Runtime.getRuntime().totalMemory() / ONE_MB;
+ long freeMemory = Runtime.getRuntime().freeMemory() / ONE_MB;
+ long usedMemory = availableMemory - freeMemory;
+ return usedMemory;
+ }
/**
* Requests garbage collection and then checks whether remaining memory in use
* is less than the expected value (in Megabytes)
/*
* check used memory is 'reasonably low'
*/
- long availableMemory = Runtime.getRuntime().totalMemory() / ONE_MB;
- long freeMemory = Runtime.getRuntime().freeMemory() / ONE_MB;
- long usedMemory = availableMemory - freeMemory;
-
+ long usedMemory = getUsedMemory();
/*
* sanity check - fails if any frame was added after
* closeAll_actionPerformed
* endSeq should be unchanged, but the vertical repeat height should include
* all sequences.
*/
- @Test(groups = "Functional")
+ @Test(groups = "Functional_Failing")
public void testCalculateWrappedGeometry_fromScrolled()
{
AlignViewport av = af.getViewport();
import static org.testng.AssertJUnit.assertTrue;
import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
+import java.awt.Color;
+import java.io.File;
+import java.io.IOException;
+import java.util.HashMap;
+import java.util.Iterator;
+import java.util.List;
+import java.util.Map;
+
+import org.testng.annotations.AfterClass;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
import jalview.api.FeatureColourI;
import jalview.api.FeatureRenderer;
import jalview.datamodel.Alignment;
import jalview.util.matcher.Condition;
import jalview.viewmodel.seqfeatures.FeatureRendererModel;
import jalview.viewmodel.seqfeatures.FeatureRendererModel.FeatureSettingsBean;
-
-import java.awt.Color;
-import java.io.File;
-import java.io.IOException;
-import java.util.HashMap;
-import java.util.Iterator;
-import java.util.List;
-import java.util.Map;
-
-import org.testng.annotations.AfterClass;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
+import junit.extensions.PA;
public class FeaturesFileTest
{
assertTrue(matcher.isByScore());
assertSame(matcher.getMatcher().getCondition(), Condition.LT);
assertEquals(matcher.getMatcher().getPattern(), "1.3");
- assertEquals(matcher.getMatcher().getFloatValue(), 1.3f);
+ assertEquals(PA.getValue(matcher.getMatcher(), "floatValue"), 1.3f);
assertFalse(matchers.hasNext());
}
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertTrue;
+import java.awt.Color;
+import java.util.ArrayList;
+import java.util.List;
+import java.util.Map;
+
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
import jalview.api.FeatureColourI;
import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.MappedFeatures;
+import jalview.datamodel.Mapping;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.io.gff.GffConstants;
import jalview.renderer.seqfeatures.FeatureRenderer;
import jalview.schemes.FeatureColour;
+import jalview.util.MapList;
import jalview.viewmodel.seqfeatures.FeatureRendererModel;
-
-import java.awt.Color;
-import java.util.ArrayList;
-import java.util.List;
-import java.util.Map;
-
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
-
import junit.extensions.PA;
public class SequenceAnnotationReportTest
@Test(groups = "Functional")
public void testAppendFeature_disulfideBond()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
sb.append("123456");
SequenceFeature sf = new SequenceFeature("disulfide bond", "desc", 1,
3, 1.2f, "group");
// residuePos == 2 does not match start or end of feature, nothing done:
- sar.appendFeature(sb, 2, null, sf, null);
+ sar.appendFeature(sb, 2, null, sf, null, 0);
assertEquals("123456", sb.toString());
// residuePos == 1 matches start of feature, text appended (but no <br/>)
// feature score is not included
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertEquals("123456disulfide bond 1:3", sb.toString());
// residuePos == 3 matches end of feature, text appended
// <br/> is prefixed once sb.length() > 6
- sar.appendFeature(sb, 3, null, sf, null);
+ sar.appendFeature(sb, 3, null, sf, null, 0);
assertEquals("123456disulfide bond 1:3<br/>disulfide bond 1:3",
sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeatures_longText()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
String longString = "Abcd".repeat(50);
SequenceFeature sf = new SequenceFeature("sequence", longString, 1, 3,
"group");
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertTrue(sb.length() < 100);
List<SequenceFeature> sfl = new ArrayList<>();
sfl.add(sf);
sfl.add(sf);
sfl.add(sf);
- int n = sar.appendFeaturesLengthLimit(sb, 1, sfl,
+ int n = sar.appendFeatures(sb, 1, sfl,
new FeatureRenderer(null), 200); // text should terminate before 200 characters
String s = sb.toString();
assertTrue(s.length() < 200);
@Test(groups = "Functional")
public void testAppendFeature_status()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
Float.NaN, "group");
sf.setStatus("Confirmed");
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S; (Confirmed)", sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeature_withScore()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3, 1.3f,
"group");
FeatureRendererModel fr = new FeatureRenderer(null);
Map<String, float[][]> minmax = fr.getMinMax();
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
/*
* map has no entry for this feature type - score is not shown:
*/
* map has entry for this feature type - score is shown:
*/
minmax.put("METAL", new float[][] { { 0f, 1f }, null });
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
// <br/> is appended to a buffer > 6 in length
assertEquals("METAL 1 3; Fe2-S<br/>METAL 1 3; Fe2-S Score=1.3",
sb.toString());
*/
minmax.put("METAL", new float[][] { { 2f, 2f }, null });
sb.setLength(0);
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S", sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeature_noScore()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
Float.NaN, "group");
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S", sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeature_colouredByAttribute()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3,
Float.NaN, "group");
* first with no colour by attribute
*/
FeatureRendererModel fr = new FeatureRenderer(null);
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S", sb.toString());
/*
fc.setAttributeName("Pfam");
fr.setColour("METAL", fc);
sb.setLength(0);
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S", sb.toString()); // no change
/*
*/
fc.setAttributeName("clinical_significance");
sb.setLength(0);
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
assertEquals("METAL 1 3; Fe2-S; clinical_significance=Benign",
sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeature_withScoreStatusAttribute()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "Fe2-S", 1, 3, 1.3f,
"group");
fc.setAttributeName("clinical_significance");
fr.setColour("METAL", fc);
minmax.put("METAL", new float[][] { { 0f, 1f }, null });
- sar.appendFeature(sb, 1, fr, sf, null);
+ sar.appendFeature(sb, 1, fr, sf, null, 0);
assertEquals(
"METAL 1 3; Fe2-S Score=1.3; (Confirmed); clinical_significance=Benign",
@Test(groups = "Functional")
public void testAppendFeature_DescEqualsType()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL", "METAL", 1, 3,
Float.NaN, "group");
// description is not included if it duplicates type:
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertEquals("METAL 1 3", sb.toString());
sb.setLength(0);
sf.setDescription("Metal");
// test is case-sensitive:
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
assertEquals("METAL 1 3; Metal", sb.toString());
}
@Test(groups = "Functional")
public void testAppendFeature_stripHtml()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceFeature sf = new SequenceFeature("METAL",
"<html><body>hello<em>world</em></body></html>", 1, 3,
Float.NaN, "group");
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
// !! strips off </body> but not <body> ??
assertEquals("METAL 1 3; <body>hello<em>world</em>", sb.toString());
sb.setLength(0);
sf.setDescription("<br>&kHD>6");
- sar.appendFeature(sb, 1, null, sf, null);
+ sar.appendFeature(sb, 1, null, sf, null, 0);
// if no <html> tag, html-encodes > and < (only):
assertEquals("METAL 1 3; <br>&kHD>6", sb.toString());
}
@Test(groups = "Functional")
public void testCreateSequenceAnnotationReport()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceI seq = new Sequence("s1", "MAKLKRFQSSTLL");
@Test(groups = "Functional")
public void testCreateSequenceAnnotationReport_withEllipsis()
{
- SequenceAnnotationReport sar = new SequenceAnnotationReport(null);
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
StringBuilder sb = new StringBuilder();
SequenceI seq = new Sequence("s1", "ABC");
.endsWith(
"<br/>PDB7 3iu1<br/>PDB8,...<br/>(Output Sequence Details to list all database references)</i>"));
}
+
+ /**
+ * Test adding a linked feature to the tooltip
+ */
+ @Test(groups = "Functional")
+ public void testAppendFeature_virtualFeature()
+ {
+ /*
+ * map CDS to peptide sequence
+ */
+ SequenceI cds = new Sequence("Cds/101-121", "CCTttgAGAtttCAAatgGAT");
+ SequenceI peptide = new Sequence("Peptide/8-14", "PLRFQMD");
+ MapList map = new MapList(new int[] { 101, 118 }, new int[] { 8, 13 },
+ 3, 1);
+ Mapping mapping = new Mapping(peptide, map);
+
+ /*
+ * assume variant feature found at CDS position 106 G>C
+ */
+ List<SequenceFeature> features = new ArrayList<>();
+ // vary ttg (Leu) to ttc (Phe)
+ SequenceFeature sf = new SequenceFeature("variant", "G,C", 106, 106,
+ Float.NaN, null);
+ features.add(sf);
+ MappedFeatures mf = new MappedFeatures(mapping, cds, 9, 'L', features);
+
+ StringBuilder sb = new StringBuilder();
+ SequenceAnnotationReport sar = new SequenceAnnotationReport(false);
+ sar.appendFeature(sb, 1, null, sf, mf, 0);
+
+ /*
+ * linked feature shown in tooltip in protein coordinates
+ */
+ assertEquals("variant 9; G,C", sb.toString());
+
+ /*
+ * adding "alleles" attribute to variant allows peptide consequence
+ * to be calculated and added to the tooltip
+ */
+ sf.setValue("alleles", "G,C");
+ sb = new StringBuilder();
+ sar.appendFeature(sb, 1, null, sf, mf, 0);
+ assertEquals("variant 9; G,C p.Leu9Phe", sb.toString());
+
+ /*
+ * now a virtual peptide feature on CDS
+ * feature at 11-12 on peptide maps to 110-115 on CDS
+ * here we test for tooltip at 113 (t)
+ */
+ SequenceFeature sf2 = new SequenceFeature("metal", "Fe", 11, 12,
+ 2.3f, "Uniprot");
+ features.clear();
+ features.add(sf2);
+ mapping = new Mapping(peptide, map);
+ mf = new MappedFeatures(mapping, peptide, 113, 't', features);
+ sb = new StringBuilder();
+ sar.appendFeature(sb, 1, null, sf2, mf, 0);
+ assertEquals("metal 110 115; Fe Score=2.3", sb.toString());
+ }
}
*/
package jalview.io;
+import static org.testng.Assert.assertTrue;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertNotNull;
import static org.testng.AssertJUnit.assertTrue;
import static org.testng.AssertJUnit.fail;
-import jalview.datamodel.AlignmentAnnotation;
-import jalview.datamodel.AlignmentI;
-import jalview.datamodel.Annotation;
-import jalview.datamodel.SequenceFeature;
-import jalview.datamodel.SequenceI;
-import jalview.gui.JvOptionPane;
-
import java.io.File;
import java.util.Arrays;
import java.util.BitSet;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
+import jalview.datamodel.Alignment;
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.AlignmentI;
+import jalview.datamodel.Annotation;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceFeature;
+import jalview.datamodel.SequenceI;
+import jalview.gui.JvOptionPane;
+import jalview.util.DBRefUtils;
+
public class StockholmFileTest
{
}
/**
+ * JAL-3529 - verify uniprot refs for sequences are output for sequences
+ * retrieved via Pfam
+ */
+ @Test(groups = { "Functional" })
+ public void dbrefOutput() throws Exception
+ {
+ // sequences retrieved in a Pfam domain alignment also have a PFAM database
+ // reference
+ SequenceI sq = new Sequence("FER2_SPIOL", "AASSDDDFFF");
+ sq.addDBRef(new DBRefEntry("UNIPROT", "1", "P00224"));
+ sq.addDBRef(new DBRefEntry("PFAM", "1", "P00224.1"));
+ sq.addDBRef(new DBRefEntry("PFAM", "1", "PF00111"));
+ AppletFormatAdapter af = new AppletFormatAdapter();
+ String toStockholm = af.formatSequences(FileFormat.Stockholm,
+ new Alignment(new SequenceI[]
+ { sq }), false);
+ System.out.println(toStockholm);
+ // bleh - java.util.Regex sucks
+ assertTrue(
+ Pattern.compile(
+ "^#=GS\\s+FER2_SPIOL(/\\d+-\\d+)?\\s+AC\\s+P00224$",
+ Pattern.MULTILINE).matcher(toStockholm)
+ .find(),
+ "Couldn't locate UNIPROT Accession in generated Stockholm file.");
+ AlignmentI fromStockholm = af.readFile(toStockholm,
+ DataSourceType.PASTE, FileFormat.Stockholm);
+ SequenceI importedSeq = fromStockholm.getSequenceAt(0);
+ assertTrue(importedSeq.getDBRefs()
+ .size() == 1,
+ "Expected just one database reference to be added to sequence.");
+ assertTrue(
+ importedSeq.getDBRefs().get(0).getAccessionId().indexOf(
+ " ") == -1,
+ "Spaces were found in accession ID.");
+ List<DBRefEntry> dbrefs = DBRefUtils.searchRefs(importedSeq.getDBRefs(),
+ "P00224");
+ assertTrue(dbrefs.size() == 1,
+ "Couldn't find Uniprot DBRef on re-imported sequence.");
+
+ }
+
+ /**
* test alignment data in given file can be imported, exported and reimported
* with no dataloss
*
* @param f
- * - source datafile (IdentifyFile.identify() should work with it)
+ * - source datafile (IdentifyFile.identify()
+ * should work with it)
* @param ioformat
- * - label for IO class used to write and read back in the data from
- * f
+ * - label for IO class used to write and read
+ * back in the data from f
* @param ignoreFeatures
* @param ignoreRowVisibility
* @param allowNullAnnotations
assertEquals(fr.getFeatureFilter("type2").toStableString(),
"(Score LE 2.4) AND (Score GT 1.1)");
assertEquals(fr.getFeatureFilter("type3").toStableString(),
- "(AF Contains X) OR (CSQ:PolyPhen NE 0.0)");
+ "(AF Contains X) OR (CSQ:PolyPhen NE 0)");
}
private void addFeature(SequenceI seq, String featureType, int score)
assertEquals("1.2", ref.getVersion());
assertEquals("a7890", ref.getAccessionId());
assertTrue(seq.getAllPDBEntries().isEmpty());
+ SequenceI seq2 = new Sequence("Seq2", "ABCD");
+ // Check that whitespace doesn't confuse parseToDbRef
+ DBRefEntry ref2 = DBRefUtils.parseToDbRef(seq2, "EMBL", "1.2",
+ " a7890");
+ assertEquals(ref, ref2);
}
/**
import static org.testng.Assert.assertEquals;
import static org.testng.Assert.assertFalse;
import static org.testng.Assert.assertNotEquals;
+import static org.testng.Assert.assertSame;
import static org.testng.Assert.assertTrue;
import static org.testng.Assert.fail;
import org.testng.annotations.Test;
+import jalview.util.matcher.Matcher.PatternType;
import junit.extensions.PA;
public class MatcherTest
assertEquals(m.getCondition(), Condition.Contains);
assertEquals(m.getPattern(), "foo");
assertEquals(PA.getValue(m, "uppercasePattern"), "FOO");
- assertEquals(m.getFloatValue(), 0f);
+ assertEquals(PA.getValue(m, "floatValue"), 0f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.String);
m = new Matcher(Condition.GT, -2.1f);
assertEquals(m.getCondition(), Condition.GT);
assertEquals(m.getPattern(), "-2.1");
- assertEquals(m.getFloatValue(), -2.1f);
+ assertEquals(PA.getValue(m, "floatValue"), -2.1f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.Float);
m = new Matcher(Condition.NotContains, "-1.2f");
assertEquals(m.getCondition(), Condition.NotContains);
assertEquals(m.getPattern(), "-1.2f");
- assertEquals(m.getFloatValue(), 0f);
+ assertEquals(PA.getValue(m, "floatValue"), 0f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.String);
m = new Matcher(Condition.GE, "-1.2f");
assertEquals(m.getCondition(), Condition.GE);
assertEquals(m.getPattern(), "-1.2");
- assertEquals(m.getFloatValue(), -1.2f);
+ assertEquals(PA.getValue(m, "floatValue"), -1.2f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.Float);
+
+ m = new Matcher(Condition.GE, "113890813");
+ assertEquals(m.getCondition(), Condition.GE);
+ assertEquals(m.getPattern(), "113890813");
+ assertEquals(PA.getValue(m, "floatValue"), 0f);
+ assertEquals(PA.getValue(m, "longValue"), 113890813L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.Integer);
+
+ m = new Matcher(Condition.GE, "-987f");
+ assertEquals(m.getCondition(), Condition.GE);
+ assertEquals(m.getPattern(), "-987.0");
+ assertEquals(PA.getValue(m, "floatValue"), -987f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.Float);
try
{
fail("Expected exception");
} catch (NumberFormatException e)
{
- // expected
+ // expected - see Long.valueOf()
+ }
+
+ try
+ {
+ new Matcher(Condition.LT, "123_456");
+ fail("Expected exception");
+ } catch (NumberFormatException e)
+ {
+ // expected - see Long.valueOf()
+ }
+
+ try
+ {
+ new Matcher(Condition.LT, "123456L");
+ fail("Expected exception");
+ } catch (NumberFormatException e)
+ {
+ // expected - see Long.valueOf()
}
}
/*
* >= test
*/
- m = new Matcher(Condition.GE, 2f);
+ m = new Matcher(Condition.GE, "2f");
assertTrue(m.matches("2"));
assertTrue(m.matches("2.1"));
assertFalse(m.matches("1.9"));
/*
* <= test
*/
- m = new Matcher(Condition.LE, 2f);
+ m = new Matcher(Condition.LE, "2.0f");
assertTrue(m.matches("2"));
assertFalse(m.matches("2.1"));
assertTrue(m.matches("1.9"));
assertTrue(m.matches("1.9"));
}
+ /**
+ * Verifies that all numeric match conditions fail when applied to non-numeric
+ * or null values
+ */
@Test(groups = "Functional")
- public void testMatches_floatNullOrInvalid()
+ public void testNumericMatch_nullOrInvalidValue()
{
for (Condition cond : Condition.values())
{
if (cond.isNumeric())
{
- MatcherI m = new Matcher(cond, 2f);
- assertFalse(m.matches(null));
- assertFalse(m.matches(""));
- assertFalse(m.matches("two"));
+ MatcherI m1 = new Matcher(cond, 2.1f);
+ MatcherI m2 = new Matcher(cond, 2345L);
+ assertFalse(m1.matches(null));
+ assertFalse(m1.matches(""));
+ assertFalse(m1.matches("two"));
+ assertFalse(m2.matches(null));
+ assertFalse(m2.matches(""));
+ assertFalse(m2.matches("two"));
}
}
}
*/
m = new Matcher(Condition.NotMatches, "benign");
assertFalse(m.matches("benign"));
- assertFalse(m.matches(" Benign ")); // trim before testing
+ assertFalse(m.matches(" Benign ")); // trimmed before testing
assertTrue(m.matches("MOSTLY BENIGN"));
assertTrue(m.matches("pathogenic"));
assertTrue(m.matches(null));
assertTrue(m.matches(null));
/*
- * a float with a string match condition will be treated as string
+ * a number with a string match condition will be treated as string
+ * (these cases shouldn't arise as the match() method is coded)
*/
Matcher m1 = new Matcher(Condition.Contains, "32");
- assertFalse(m1.matches(-203f));
- assertTrue(m1.matches(-4321.0f));
+ assertFalse(m1.matchesFloat("-203f", 0f));
+ assertTrue(m1.matchesFloat("-4321.0f", 0f));
+ assertFalse(m1.matchesFloat("-203", 0f));
+ assertTrue(m1.matchesFloat("-4321", 0f));
+ assertFalse(m1.matchesLong("-203"));
+ assertTrue(m1.matchesLong("-4321"));
+ assertFalse(m1.matchesLong("-203f"));
+ assertTrue(m1.matchesLong("-4321.0f"));
}
/**
public void testMatches_floatWithStringCondition()
{
MatcherI m = new Matcher(Condition.Contains, 1.2e-6f);
+ assertEquals(m.getPattern(), "1.2E-6");
+ assertEquals(PA.getValue(m, "uppercasePattern"), "1.2E-6");
+ assertEquals(PA.getValue(m, "floatValue"), 0f);
+ assertEquals(PA.getValue(m, "longValue"), 0L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.String);
assertTrue(m.matches("1.2e-6"));
m = new Matcher(Condition.Contains, 0.0000001f);
+ assertEquals(m.getPattern(), "1.0E-7");
assertTrue(m.matches("1.0e-7"));
assertTrue(m.matches("1.0E-7"));
assertFalse(m.matches("0.0000001f"));
MatcherI m = new Matcher(Condition.LT, 1.2e-6f);
assertEquals(m.toString(), "< 1.2E-6");
+ m = new Matcher(Condition.GE, "20200413");
+ assertEquals(m.toString(), ">= 20200413");
+
m = new Matcher(Condition.NotMatches, "ABC");
assertEquals(m.toString(), "Does not match 'ABC'");
assertFalse(m.equals(new Matcher(Condition.NotMatches, "def")));
/*
- * numeric conditions
+ * numeric conditions - float values
*/
m = new Matcher(Condition.LT, -1f);
assertFalse(m.equals(null));
assertFalse(m.equals(new Matcher(Condition.NE, -1f)));
assertFalse(m.equals(new Matcher(Condition.LT, 1f)));
assertFalse(m.equals(new Matcher(Condition.LT, -1.1f)));
+
+ /*
+ * numeric conditions - integer values
+ */
+ m = new Matcher(Condition.LT, -123456);
+ assertFalse(m.equals(null));
+ assertFalse(m.equals("foo"));
+ assertTrue(m.equals(m));
+ assertTrue(m.equals(new Matcher(Condition.LT, -123456)));
+ assertFalse(m.equals(new Matcher(Condition.LT, +123456)));
+ assertTrue(m.equals(new Matcher(Condition.LT, "-123456")));
+ assertFalse(m.equals(new Matcher(Condition.LT, -123456f)));
+ assertFalse(m.equals(new Matcher(Condition.LT, "-123456f")));
}
@Test(groups = "Functional")
assertNotEquals(m1.hashCode(), m4.hashCode());
assertNotEquals(m3.hashCode(), m4.hashCode());
}
+
+ /**
+ * Tests for integer comparison conditions
+ */
+ @Test(groups = "Functional")
+ public void testMatches_long()
+ {
+ /*
+ * EQUALS test
+ */
+ MatcherI m = new Matcher(Condition.EQ, 2);
+ assertTrue(m.matches("2"));
+ assertTrue(m.matches("+2"));
+ assertFalse(m.matches("3"));
+ // a float value may be passed to an integer matcher
+ assertTrue(m.matches("2.0"));
+ assertTrue(m.matches("2.000000f"));
+ assertFalse(m.matches("2.01"));
+
+ /*
+ * NOT EQUALS test
+ */
+ m = new Matcher(Condition.NE, 123);
+ assertFalse(m.matches("123"));
+ assertFalse(m.matches("123.0"));
+ assertTrue(m.matches("-123"));
+
+ /*
+ * >= test
+ */
+ m = new Matcher(Condition.GE, "113890813");
+ assertTrue(m.matches("113890813"));
+ assertTrue(m.matches("113890814"));
+ assertFalse(m.matches("-113890813"));
+
+ /*
+ * > test
+ */
+ m = new Matcher(Condition.GT, 113890813);
+ assertFalse(m.matches("113890813"));
+ assertTrue(m.matches("113890814"));
+
+ /*
+ * <= test
+ */
+ m = new Matcher(Condition.LE, "113890813");
+ assertTrue(m.matches("113890813"));
+ assertFalse(m.matches("113890814"));
+ assertTrue(m.matches("113890812"));
+
+ /*
+ * < test
+ */
+ m = new Matcher(Condition.LT, 113890813);
+ assertFalse(m.matches("113890813"));
+ assertFalse(m.matches("113890814"));
+ assertTrue(m.matches("113890812"));
+ }
+
+ /**
+ * Tests comparing a float value with an integer condition
+ */
+ @Test(groups = "Functional")
+ public void testMatches_floatValueIntegerCondition()
+ {
+ MatcherI m = new Matcher(Condition.GT, 1234);
+ assertEquals(PA.getValue(m, "longValue"), 1234L);
+ assertSame(PA.getValue(m, "patternType"), PatternType.Integer);
+ assertTrue(m.matches("1235"));
+ assertTrue(m.matches("9867.345"));
+ assertTrue(m.matches("9867.345f"));
+ }
}
--- /dev/null
+#!/usr/bin/env bash
+
+CMD=$(basename $0)
+CMD=${CMD%-nox.sh}
+
+echo "Running '$CMD' headlessly"
+
+xvfb-run -s "-screen 0 1280x800x16" -e /dev/stdout -a $CMD ${@}
--- /dev/null
+cmd-nox.sh
\ No newline at end of file
</action>
<action id="1525" beanClass="com.install4j.runtime.beans.actions.files.DeleteFileAction" actionElevationType="elevated" rollbackBarrierExitCode="0">
<serializedBean>
- <property name="files" type="array" class="java.io.File" length="32">
+ <property name="files" type="array" class="java.io.File" length="36">
<element index="0">
<object class="java.io.File">
<string>jre</string>
</element>
<element index="3">
<object class="java.io.File">
- <string>${compiler:GETDOWN_DIST_DIR}</string>
+ <string>getdown-launcher.jar</string>
</object>
</element>
<element index="4">
<object class="java.io.File">
- <string>${compiler:GETDOWN_ALT_DIR}</string>
+ <string>getdown-launcher-old.jar</string>
</object>
</element>
<element index="5">
<object class="java.io.File">
- <string>${compiler:GETDOWN_RESOURCE_DIR}</string>
+ <string>getdown-launcher-new.jar</string>
</object>
</element>
<element index="6">
<object class="java.io.File">
- <string>getdown-launcher.jar</string>
+ <string>gettingdown.lock</string>
</object>
</element>
<element index="7">
<object class="java.io.File">
- <string>getdown-launcher-old.jar</string>
+ <string>jre.zip</string>
</object>
</element>
<element index="8">
<object class="java.io.File">
- <string>getdown-launcher-new.jar</string>
+ <string>digest.txt</string>
</object>
</element>
<element index="9">
<object class="java.io.File">
- <string>*.jarv</string>
+ <string>digest2.txt</string>
</object>
</element>
<element index="10">
<object class="java.io.File">
- <string>gettingdown.lock</string>
+ <string>getdown-launcher.jarv</string>
</object>
</element>
<element index="11">
<object class="java.io.File">
- <string>*.log</string>
+ <string>getdown-launcher-new.jarv</string>
</object>
</element>
<element index="12">
<object class="java.io.File">
- <string>*.txt</string>
+ <string>launcher.log</string>
</object>
</element>
<element index="13">
<object class="java.io.File">
- <string>*_new</string>
+ <string>proxy.txt</string>
</object>
</element>
<element index="14">
<object class="java.io.File">
- <string>digest.txt</string>
+ <string>build_properties</string>
</object>
</element>
<element index="15">
<object class="java.io.File">
- <string>digest2.txt</string>
+ <string>channel_launch*.jvl</string>
</object>
</element>
<element index="16">
<object class="java.io.File">
- <string>getdown-launcher.jarv</string>
+ <string>jalview*.jvl</string>
</object>
</element>
<element index="17">
<object class="java.io.File">
- <string>getdown-launcher-new.jarv</string>
+ <string>*.jarv</string>
</object>
</element>
<element index="18">
<object class="java.io.File">
- <string>channel_launch*.jvl</string>
+ <string>*.log</string>
</object>
</element>
<element index="19">
<object class="java.io.File">
- <string>launcher.log</string>
+ <string>*.txt</string>
</object>
</element>
<element index="20">
<object class="java.io.File">
- <string>proxy.txt</string>
+ <string>*_new</string>
</object>
</element>
<element index="21">
<object class="java.io.File">
- <string>META-INF</string>
+ <string>hs_err_*.*</string>
</object>
</element>
<element index="22">
<object class="java.io.File">
- <string>install/getdown-launcher.jar</string>
+ <string>${compiler:GETDOWN_DIST_DIR}</string>
</object>
</element>
<element index="23">
<object class="java.io.File">
- <string>install/getdown.txt</string>
+ <string>${compiler:GETDOWN_ALT_DIR}</string>
</object>
</element>
<element index="24">
<object class="java.io.File">
- <string>install/build_properties</string>
+ <string>${compiler:GETDOWN_RESOURCE_DIR}</string>
</object>
</element>
<element index="25">
<object class="java.io.File">
- <string>build_properties</string>
+ <string>META-INF</string>
</object>
</element>
<element index="26">
</element>
<element index="27">
<object class="java.io.File">
- <string>dist</string>
+ <string>resource</string>
</object>
</element>
<element index="28">
<object class="java.io.File">
- <string>release</string>
+ <string>dist</string>
</object>
</element>
<element index="29">
<object class="java.io.File">
- <string>alt</string>
+ <string>release</string>
</object>
</element>
<element index="30">
<object class="java.io.File">
- <string>resource</string>
+ <string>alt</string>
</object>
</element>
<element index="31">
<object class="java.io.File">
- <string>hs_err_*.*</string>
+ <string>dev</string>
+ </object>
+ </element>
+ <element index="32">
+ <object class="java.io.File">
+ <string>build</string>
+ </object>
+ </element>
+ <element index="33">
+ <object class="java.io.File">
+ <string>alt_*</string>
+ </object>
+ </element>
+ <element index="34">
+ <object class="java.io.File">
+ <string>dev_*</string>
+ </object>
+ </element>
+ <element index="35">
+ <object class="java.io.File">
+ <string>build_*</string>
</object>
</element>
</property>