JAL-2189 format tests

[jalview.git] / test / jalview / io / gff / Gff3HelperTest.java

diff --git a/test/jalview/io/gff/Gff3HelperTest.java b/test/jalview/io/gff/Gff3HelperTest.java
index 420b032..3b6930f 100644 (file)
--- a/test/jalview/io/gff/Gff3HelperTest.java
+++ b/test/jalview/io/gff/Gff3HelperTest.java
@@ -161,7 +161,7 @@ public class Gff3HelperTest
             "GAATTCGTTCATGTAGGTTGATTTTTATT");
     seq.createDatasetSequence();
     AlignmentI align = new Alignment(new SequenceI[] {});
-  
+
     // mapping from gi|68711 12923-13060 to gi|N37351 1-138
     String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
             .split("\\t");
@@ -179,7 +179,7 @@ public class Gff3HelperTest
     // (this is important for 'align cdna to genome' to work correctly)
     assertEquals(1, align.getCodonFrames().size());
     AlignedCodonFrame mapping = align.getCodonFrames().get(0);
-  
+
     /*
      * 'dnaseqs' (map from) is here [gi|68711]
      * 'aaseqs' (map to) is here [gi|N37351]
@@ -192,8 +192,7 @@ public class Gff3HelperTest
     assertEquals(1, mapping.getdnaToProt().length);
     assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
     // the two spliced dna ranges are combined in one MapList
-    assertArrayEquals(new int[] { 12923, 13060 },
-            mapping.getdnaToProt()[0]
+    assertArrayEquals(new int[] { 12923, 13060 }, mapping.getdnaToProt()[0]
             .getFromRanges().get(0));
     assertArrayEquals(new int[] { 13411, 13550 }, mapping.getdnaToProt()[0]
             .getFromRanges().get(1));