Mac binaries

[jabaws.git] / website / archive / binaries / mac / src / disembl / biopython-1.50 / Bio / Search.py

diff --git a/website/archive/binaries/mac/src/disembl/biopython-1.50/Bio/Search.py b/website/archive/binaries/mac/src/disembl/biopython-1.50/Bio/Search.py
new file mode 100644 (file)
index 0000000..181f0ba
--- /dev/null
+++ b/website/archive/binaries/mac/src/disembl/biopython-1.50/Bio/Search.py
@@ -0,0 +1,153 @@
+# BLASTN 2.0a19MP-WashU [05-Feb-1998] [Build decunix3.2 01:53:29 05-Feb-1998]
+# BLASTP 2.0.4 [Feb-24-1998]
+class Algorithm:
+    def __init__(self, name, version, description = ""):
+        self.name = name                 # 'blastx', 'blastn', etc.
+        self.version = version           # '2.1.2' or '2.0a19MP-WashU'
+        self.description = description   # '[05-Feb-1998] [Build dec ...1998]'
+
+# Query=  YAL001C YAL001C, Chr I from 147596 to 147665, and 147756 to 151168,
+#     reverse complement
+#         (3483 letters)
+class Query:
+    def __init__(self, name, accession, description, length):
+        self.name = name                # 'YAL001C'
+        self.accession = accession      # or None if missing
+        self.description = description  # 'YAL001C, Chr I from 147596 to ... '
+        self.length = length            # 3483
+
+# Database:  ArabidopsisN
+#            66,211 sequences; 69,074,155 total letters.
+class Database:
+    def __init__(self, name, letters, entries):
+        self.name = name            # ArabidopsisN
+        self.letters = letters      # 69074155
+        self.entries = entries      # 66211
+
+class TableInfo:
+    def __init__(self, full_description, info):
+        self.__dict__.update(info)
+        self.full_description = full_description
+
+
+class Search:
+    def __init__(self, algorithm, query, database, table, hits,
+                 parameters, statistics):
+        self.algorithm = algorithm
+        self.query = query
+        self.database = database
+        self.table = table
+        self.hits = hits
+        self.parameters = parameters
+        self.statistics = statistics
+
+class Hit:
+    def __init__(self, name, description, accession, length,
+                 algorithm, hsps = None):
+        self.name = name
+        self.description = description
+        self.accession = accession
+        self.length = length
+        self.algorithm = algorithm
+        if hsps is None:
+            hsps = []
+        self.hsps = hsps
+
+    def __len__(self):
+        return self.length
+
+
+
+# >GB_PL:ATF18F4 AL021637 Arabidopsis thaliana DNA chromosome 4, BAC clone 
+#           F18F4 (ESSAII project). 2/98
+#             Length = 93,646
+#  
+#   Minus Strand HSPs:
+#  
+#  Score = 226 (33.9 bits), Expect = 0.80, P = 0.55
+#  Identities = 98/142 (69%), Positives = 98/142 (69%), Strand = Minus / Plus
+#    [...lines deleted...]
+# Query:  2486 ATATCAAGCAATTTGATAAGATCTAG 2461
+#              A AT  A C ATT GA AAGATC AG
+# Sbjct: 85387 AGATTTACCTATT-GAGAAGATCAAG 85411
+
+# computed from the strings
+class _SeqLength:
+    def __init__(self, length, identical, positives, gaps):
+        self.length = length
+        self.identical = identical
+        self.positives = positives
+        self.gaps = gaps
+    def __len__(self):
+        return self.length
+    def __getattr__(self, name):
+        if name == "frac_identical":
+            return float(self.identical) / self.length
+        elif name == "frac_positives":
+            return float(self.positives) / self.length
+        raise AttributeError(name)
+
+
+class HomologySeq(_SeqLength):
+    def __init__(self, seq, identical, positives, gaps):
+        _SeqLength.__init__(self, len(seq), identical, positives, gaps)
+        self.seq = seq
+
+class HSPSeq(_SeqLength):
+    def __init__(self, name, seq, location, identical, positives, gaps):
+        _SeqLength.__init__(self, len(seq), identical, positives, gaps)
+        self.name = name
+        self.seq = seq
+        self.location = location
+        
+
+class HSP(_SeqLength):
+    def __init__(self,
+                 query_seq,    # ATATCAAGCAATTTGATAAGATCTAG
+                 homology_seq, # A AT  A C ATT GA AAGATC AG
+                 subject_seq,  # AGATTTACCTATT-GAGAAGATCAAG
+
+                 query_location,   # (2486, 2461, negative strand)
+                 subject_location, # (85387, 85411)
+
+                 query_name,     # Query (or None)
+                 subject_name,   # Sbjct (or None)
+
+                 algorithm,  # an Algorithm
+                 info,       # contains Key/value pairs
+                 homology_gaps = None,  # Is this needed?
+                 ):
+        assert len(query_seq) == len(homology_seq) == len(subject_seq), \
+               (query_seq, homology_seq, subject_seq)
+        self.algorithm = algorithm
+
+        query_gaps = query_seq.count("-")
+        subject_gaps = subject_seq.count("-")
+        if homology_gaps is None:
+            homology_gaps = query_gaps + subject_gaps
+        self.info = info
+
+        identical = info["identical"]
+        # bioperl calls this 'conserved'
+        positives = info.get("positives", identical)
+        
+        _SeqLength.__init__(self, len(query_seq), identical,
+                            positives, homology_gaps)
+
+        self.query = HSPSeq(name = query_name,
+                            seq = query_seq,
+                            location = query_location,
+                            identical = identical,
+                            positives = positives,
+                            gaps = query_gaps)
+
+        self.subject = HSPSeq(name = subject_name,
+                              seq = subject_seq,
+                              location = subject_location,
+                              identical = identical,
+                              positives = positives,
+                              gaps = subject_gaps)
+        self.homology = HomologySeq(seq = homology_seq,
+                                    identical = identical,
+                                    positives = positives,
+                                    gaps = homology_gaps)