--- /dev/null
+# Copyright 2004-2008 by Sebastian Bassi.
+# All rights reserved.
+# This code is part of the Biopython distribution and governed by its
+# license. Please see the LICENSE file that should have been included
+# as part of this package.
+
+"""Calculate the thermodynamic melting temperatures of nucleotide sequences."""
+
+import math
+def Tm_staluc(s,dnac=50,saltc=50,rna=0):
+ """Returns DNA/DNA tm using nearest neighbor thermodynamics.
+
+ dnac is DNA concentration [nM]
+ saltc is salt concentration [mM].
+ rna=0 is for DNA/DNA (default), for RNA, rna should be 1.
+
+ Sebastian Bassi <sbassi@genesdigitales.com>"""
+
+ #Credits:
+ #Main author: Sebastian Bassi <sbassi@genesdigitales.com>
+ #Overcount function: Greg Singer <singerg@tcd.ie>
+ #Based on the work of Nicolas Le Novere <lenov@ebi.ac.uk> Bioinformatics.
+ #17:1226-1227(2001)
+
+ #This function returns better results than EMBOSS DAN because it uses
+ #updated thermodynamics values and takes into account inicialization
+ #parameters from the work of SantaLucia (1998).
+
+ #Things to do:
+ #+Detect complementary sequences. Change K according to result.
+ #+Add support for heteroduplex (see Sugimoto et al. 1995).
+ #+Correction for Mg2+. Now supports only monovalent ions.
+ #+Put thermodinamics table in a external file for users to change at will
+ #+Add support for danglings ends (see Le Novele. 2001) and mismatches.
+
+ dh = 0 #DeltaH. Enthalpy
+ ds = 0 #deltaS Entropy
+
+ def tercorr(stri):
+ deltah = 0
+ deltas = 0
+ if rna==0:
+ #DNA/DNA
+ #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
+ if stri.startswith('G') or stri.startswith('C'):
+ deltah -= 0.1
+ deltas += 2.8
+ elif stri.startswith('A') or stri.startswith('T'):
+ deltah -= 2.3
+ deltas -= 4.1
+ if stri.endswith('G') or stri.endswith('C'):
+ deltah -= 0.1
+ deltas += 2.8
+ elif stri.endswith('A') or stri.endswith('T'):
+ deltah -= 2.3
+ deltas -= 4.1
+ dhL = dh + deltah
+ dsL = ds + deltas
+ return dsL,dhL
+ elif rna==1:
+ #RNA
+ if stri.startswith('G') or stri.startswith('C'):
+ deltah -= 3.61
+ deltas -= 1.5
+ elif stri.startswith('A') or stri.startswith('T') or \
+ stri.startswith('U'):
+ deltah -= 3.72
+ deltas += 10.5
+ if stri.endswith('G') or stri.endswith('C'):
+ deltah -= 3.61
+ deltas -= 1.5
+ elif stri.endswith('A') or stri.endswith('T') or \
+ stri.endswith('U'):
+ deltah -= 3.72
+ deltas += 10.5
+ dhL = dh + deltah
+ dsL = ds + deltas
+ # print "delta h=",dhL
+ return dsL,dhL
+
+ def overcount(st,p):
+ """Returns how many p are on st, works even for overlapping"""
+ ocu = 0
+ x = 0
+ while 1:
+ try:
+ i = st.index(p,x)
+ except ValueError:
+ break
+ ocu += 1
+ x = i + 1
+ return ocu
+
+ R = 1.987 # universal gas constant in Cal/degrees C*Mol
+ sup = s.upper()
+ vsTC,vh = tercorr(sup)
+ vs = vsTC
+
+ k = (dnac/4.0)*1e-9
+ #With complementary check on, the 4.0 should be changed to a variable.
+
+ if rna==0:
+ #DNA/DNA
+ #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594
+ vh = vh + (overcount(sup,"AA"))*7.9 + (overcount(sup,"TT"))*\
+ 7.9 + (overcount(sup,"AT"))*7.2 + (overcount(sup,"TA"))*7.2 \
+ + (overcount(sup,"CA"))*8.5 + (overcount(sup,"TG"))*8.5 + \
+ (overcount(sup,"GT"))*8.4 + (overcount(sup,"AC"))*8.4
+ vh = vh + (overcount(sup,"CT"))*7.8+(overcount(sup,"AG"))*\
+ 7.8 + (overcount(sup,"GA"))*8.2 + (overcount(sup,"TC"))*8.2
+ vh = vh + (overcount(sup,"CG"))*10.6+(overcount(sup,"GC"))*\
+ 9.8 + (overcount(sup,"GG"))*8 + (overcount(sup,"CC"))*8
+ vs = vs + (overcount(sup,"AA"))*22.2+(overcount(sup,"TT"))*\
+ 22.2 + (overcount(sup,"AT"))*20.4 + (overcount(sup,"TA"))*21.3
+ vs = vs + (overcount(sup,"CA"))*22.7+(overcount(sup,"TG"))*\
+ 22.7 + (overcount(sup,"GT"))*22.4 + (overcount(sup,"AC"))*22.4
+ vs = vs + (overcount(sup,"CT"))*21.0+(overcount(sup,"AG"))*\
+ 21.0 + (overcount(sup,"GA"))*22.2 + (overcount(sup,"TC"))*22.2
+ vs = vs + (overcount(sup,"CG"))*27.2+(overcount(sup,"GC"))*\
+ 24.4 + (overcount(sup,"GG"))*19.9 + (overcount(sup,"CC"))*19.9
+ ds = vs
+ dh = vh
+
+ else:
+ #RNA/RNA hybridisation of Xia et al (1998)
+ #Biochemistry 37: 14719-14735
+ vh = vh+(overcount(sup,"AA"))*6.82+(overcount(sup,"TT"))*6.6+\
+ (overcount(sup,"AT"))*9.38 + (overcount(sup,"TA"))*7.69+\
+ (overcount(sup,"CA"))*10.44 + (overcount(sup,"TG"))*10.5+\
+ (overcount(sup,"GT"))*11.4 + (overcount(sup,"AC"))*10.2
+ vh = vh + (overcount(sup,"CT"))*10.48 + (overcount(sup,"AG"))\
+ *7.6+(overcount(sup,"GA"))*12.44+(overcount(sup,"TC"))*13.3
+ vh = vh + (overcount(sup,"CG"))*10.64 + (overcount(sup,"GC"))\
+ *14.88+(overcount(sup,"GG"))*13.39+(overcount(sup,"CC"))*12.2
+ vs = vs + (overcount(sup,"AA"))*19.0 + (overcount(sup,"TT"))*\
+ 18.4+(overcount(sup,"AT"))*26.7+(overcount(sup,"TA"))*20.5
+ vs = vs + (overcount(sup,"CA"))*26.9 + (overcount(sup,"TG"))*\
+ 27.8 + (overcount(sup,"GT"))*29.5 + (overcount(sup,"AC"))*26.2
+ vs = vs + (overcount(sup,"CT"))*27.1 + (overcount(sup,"AG"))*\
+ 19.2 + (overcount(sup,"GA"))*32.5 + (overcount(sup,"TC"))*35.5
+ vs = vs + (overcount(sup,"CG"))*26.7 + (overcount(sup,"GC"))\
+ *36.9 + (overcount(sup,"GG"))*32.7 + (overcount(sup,"CC"))*29.7
+ ds = vs
+ dh = vh
+
+ ds = ds-0.368*(len(s)-1)*math.log(saltc/1e3)
+ tm = ((1000* (-dh))/(-ds+(R * (math.log(k)))))-273.15
+ # print "ds="+str(ds)
+ # print "dh="+str(dh)
+ return tm
+
+if __name__ == "__main__" :
+ print "Quick self test"
+ assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA') == 59.865612727457972
+ assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA',rna=1) == 68.141611264576682
+ print "Done"
git://source.jalview.org / jabaws.git / blobdiff