Delete unneeded directory

[jabaws.git] / website / archive / binaries / mac / src / globplot / biopython-1.50 / Bio / Search.py

diff --git a/website/archive/binaries/mac/src/globplot/biopython-1.50/Bio/Search.py b/website/archive/binaries/mac/src/globplot/biopython-1.50/Bio/Search.py
deleted file mode 100644 (file)
index 181f0ba..0000000
--- a/website/archive/binaries/mac/src/globplot/biopython-1.50/Bio/Search.py
+++ /dev/null
@@ -1,153 +0,0 @@
-# BLASTN 2.0a19MP-WashU [05-Feb-1998] [Build decunix3.2 01:53:29 05-Feb-1998]
-# BLASTP 2.0.4 [Feb-24-1998]
-class Algorithm:
-    def __init__(self, name, version, description = ""):
-        self.name = name                 # 'blastx', 'blastn', etc.
-        self.version = version           # '2.1.2' or '2.0a19MP-WashU'
-        self.description = description   # '[05-Feb-1998] [Build dec ...1998]'
-
-# Query=  YAL001C YAL001C, Chr I from 147596 to 147665, and 147756 to 151168,
-#     reverse complement
-#         (3483 letters)
-class Query:
-    def __init__(self, name, accession, description, length):
-        self.name = name                # 'YAL001C'
-        self.accession = accession      # or None if missing
-        self.description = description  # 'YAL001C, Chr I from 147596 to ... '
-        self.length = length            # 3483
-
-# Database:  ArabidopsisN
-#            66,211 sequences; 69,074,155 total letters.
-class Database:
-    def __init__(self, name, letters, entries):
-        self.name = name            # ArabidopsisN
-        self.letters = letters      # 69074155
-        self.entries = entries      # 66211
-
-class TableInfo:
-    def __init__(self, full_description, info):
-        self.__dict__.update(info)
-        self.full_description = full_description
-
-
-class Search:
-    def __init__(self, algorithm, query, database, table, hits,
-                 parameters, statistics):
-        self.algorithm = algorithm
-        self.query = query
-        self.database = database
-        self.table = table
-        self.hits = hits
-        self.parameters = parameters
-        self.statistics = statistics
-
-class Hit:
-    def __init__(self, name, description, accession, length,
-                 algorithm, hsps = None):
-        self.name = name
-        self.description = description
-        self.accession = accession
-        self.length = length
-        self.algorithm = algorithm
-        if hsps is None:
-            hsps = []
-        self.hsps = hsps
-
-    def __len__(self):
-        return self.length
-
-
-
-# >GB_PL:ATF18F4 AL021637 Arabidopsis thaliana DNA chromosome 4, BAC clone 
-#           F18F4 (ESSAII project). 2/98
-#             Length = 93,646
-#  
-#   Minus Strand HSPs:
-#  
-#  Score = 226 (33.9 bits), Expect = 0.80, P = 0.55
-#  Identities = 98/142 (69%), Positives = 98/142 (69%), Strand = Minus / Plus
-#    [...lines deleted...]
-# Query:  2486 ATATCAAGCAATTTGATAAGATCTAG 2461
-#              A AT  A C ATT GA AAGATC AG
-# Sbjct: 85387 AGATTTACCTATT-GAGAAGATCAAG 85411
-
-# computed from the strings
-class _SeqLength:
-    def __init__(self, length, identical, positives, gaps):
-        self.length = length
-        self.identical = identical
-        self.positives = positives
-        self.gaps = gaps
-    def __len__(self):
-        return self.length
-    def __getattr__(self, name):
-        if name == "frac_identical":
-            return float(self.identical) / self.length
-        elif name == "frac_positives":
-            return float(self.positives) / self.length
-        raise AttributeError(name)
-
-
-class HomologySeq(_SeqLength):
-    def __init__(self, seq, identical, positives, gaps):
-        _SeqLength.__init__(self, len(seq), identical, positives, gaps)
-        self.seq = seq
-
-class HSPSeq(_SeqLength):
-    def __init__(self, name, seq, location, identical, positives, gaps):
-        _SeqLength.__init__(self, len(seq), identical, positives, gaps)
-        self.name = name
-        self.seq = seq
-        self.location = location
-        
-
-class HSP(_SeqLength):
-    def __init__(self,
-                 query_seq,    # ATATCAAGCAATTTGATAAGATCTAG
-                 homology_seq, # A AT  A C ATT GA AAGATC AG
-                 subject_seq,  # AGATTTACCTATT-GAGAAGATCAAG
-
-                 query_location,   # (2486, 2461, negative strand)
-                 subject_location, # (85387, 85411)
-
-                 query_name,     # Query (or None)
-                 subject_name,   # Sbjct (or None)
-
-                 algorithm,  # an Algorithm
-                 info,       # contains Key/value pairs
-                 homology_gaps = None,  # Is this needed?
-                 ):
-        assert len(query_seq) == len(homology_seq) == len(subject_seq), \
-               (query_seq, homology_seq, subject_seq)
-        self.algorithm = algorithm
-
-        query_gaps = query_seq.count("-")
-        subject_gaps = subject_seq.count("-")
-        if homology_gaps is None:
-            homology_gaps = query_gaps + subject_gaps
-        self.info = info
-
-        identical = info["identical"]
-        # bioperl calls this 'conserved'
-        positives = info.get("positives", identical)
-        
-        _SeqLength.__init__(self, len(query_seq), identical,
-                            positives, homology_gaps)
-
-        self.query = HSPSeq(name = query_name,
-                            seq = query_seq,
-                            location = query_location,
-                            identical = identical,
-                            positives = positives,
-                            gaps = query_gaps)
-
-        self.subject = HSPSeq(name = subject_name,
-                              seq = subject_seq,
-                              location = subject_location,
-                              identical = identical,
-                              positives = positives,
-                              gaps = subject_gaps)
-        self.homology = HomologySeq(seq = homology_seq,
-                                    identical = identical,
-                                    positives = positives,
-                                    gaps = homology_gaps)