1 package jalview.io.vcf;
3 import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
4 import static org.testng.Assert.assertEquals;
5 import static org.testng.Assert.assertNull;
6 import static org.testng.Assert.assertSame;
8 import jalview.bin.Cache;
9 import jalview.datamodel.AlignmentI;
10 import jalview.datamodel.DBRefEntry;
11 import jalview.datamodel.Mapping;
12 import jalview.datamodel.Sequence;
13 import jalview.datamodel.SequenceFeature;
14 import jalview.datamodel.SequenceI;
15 import jalview.datamodel.features.FeatureAttributes;
16 import jalview.datamodel.features.FeatureAttributes.Datatype;
17 import jalview.datamodel.features.SequenceFeatures;
18 import jalview.gui.AlignFrame;
19 import jalview.io.DataSourceType;
20 import jalview.io.FileLoader;
21 import jalview.io.gff.Gff3Helper;
22 import jalview.io.gff.SequenceOntologyI;
23 import jalview.util.MapList;
26 import java.io.IOException;
27 import java.io.PrintWriter;
28 import java.util.List;
31 import org.testng.annotations.BeforeClass;
32 import org.testng.annotations.BeforeTest;
33 import org.testng.annotations.Test;
35 public class VCFLoaderTest
37 private static final float DELTA = 0.00001f;
39 // columns 9717- of gene P30419 from Ensembl (much modified)
40 private static final String FASTA = ""
43 * forward strand 'gene' and 'transcript' with two exons
45 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
46 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
47 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
50 * reverse strand gene and transcript (reverse complement alleles!)
52 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
53 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
54 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
57 * 'gene' on chromosome 5 with two transcripts
59 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
60 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
61 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
62 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
64 private static final String[] VCF = { "##fileformat=VCFv4.2",
65 // fields other than AF are ignored when parsing as they have no INFO definition
66 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
67 "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
68 "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
69 "##reference=Homo_sapiens/GRCh38",
70 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
71 // A/T,C variants in position 2 of gene sequence (precedes transcript)
72 // should create 2 variant features with respective AF values
73 // malformed values for AC_Female and AF_AFR should be ignored
74 "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03;AC_Female=12,3d;AF_AFR=low,2.3e-4",
75 // SNP G/C in position 4 of gene sequence, position 2 of transcript
76 // insertion G/GA is transferred to nucleotide but not to peptide
77 "17\t45051613\t.\tG\tGA,C\t1666.65\tRF\tAC=15;AF=3.0e-03,2.0e-03",
78 // '.' in INFO field should be ignored
79 "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
81 @BeforeClass(alwaysRun = true)
85 * configure to capture all available VCF and VEP (CSQ) fields
87 Cache.loadProperties("test/jalview/io/testProps.jvprops");
88 Cache.setProperty("VCF_FIELDS", ".*");
89 Cache.setProperty("VEP_FIELDS", ".*");
90 Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
94 @BeforeTest(alwaysRun = true)
95 public void setUpBeforeTest()
98 * clear down feature attributes metadata
100 FeatureAttributes.getInstance().clear();
103 @Test(groups = "Functional")
104 public void testDoLoad() throws IOException
106 AlignmentI al = buildAlignment();
108 File f = makeVcfFile();
109 VCFLoader loader = new VCFLoader(f.getPath());
111 loader.doLoad(al.getSequencesArray(), null);
114 * verify variant feature(s) added to gene
115 * NB alleles at a locus may not be processed, and features added,
116 * in the order in which they appear in the VCF record as method
117 * VariantContext.getAlternateAlleles() does not guarantee order
118 * - order of assertions here matches what we find (is not important)
120 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
121 .getSequenceFeatures();
122 SequenceFeatures.sortFeatures(geneFeatures, true);
123 assertEquals(geneFeatures.size(), 5);
124 SequenceFeature sf = geneFeatures.get(0);
125 assertEquals(sf.getFeatureGroup(), "VCF");
126 assertEquals(sf.getBegin(), 2);
127 assertEquals(sf.getEnd(), 2);
128 assertEquals(sf.getScore(), 0f);
129 assertEquals(sf.getValue("AF"), "4.0e-03");
130 assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
131 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
132 assertEquals(sf.getType(), SEQUENCE_VARIANT);
133 // malformed integer for AC_Female is ignored (JAL-3375)
134 assertNull(sf.getValue("AC_Female"));
136 sf = geneFeatures.get(1);
137 assertEquals(sf.getFeatureGroup(), "VCF");
138 assertEquals(sf.getBegin(), 2);
139 assertEquals(sf.getEnd(), 2);
140 assertEquals(sf.getType(), SEQUENCE_VARIANT);
141 assertEquals(sf.getScore(), 0f);
142 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
144 assertEquals(sf.getValue("AC_Female"), "12");
145 // malformed float for AF_AFR is ignored (JAL-3375)
146 assertNull(sf.getValue("AC_AFR"));
147 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
149 sf = geneFeatures.get(2);
150 assertEquals(sf.getFeatureGroup(), "VCF");
151 assertEquals(sf.getBegin(), 4);
152 assertEquals(sf.getEnd(), 4);
153 assertEquals(sf.getType(), SEQUENCE_VARIANT);
154 assertEquals(sf.getScore(), 0f);
155 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
157 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
159 sf = geneFeatures.get(3);
160 assertEquals(sf.getFeatureGroup(), "VCF");
161 assertEquals(sf.getBegin(), 4);
162 assertEquals(sf.getEnd(), 4);
163 assertEquals(sf.getType(), SEQUENCE_VARIANT);
164 assertEquals(sf.getScore(), 0f);
165 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
167 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
169 sf = geneFeatures.get(4);
170 assertEquals(sf.getFeatureGroup(), "VCF");
171 assertEquals(sf.getBegin(), 6);
172 assertEquals(sf.getEnd(), 6);
173 assertEquals(sf.getType(), SEQUENCE_VARIANT);
174 assertEquals(sf.getScore(), 0f);
175 // AF=. should not have been captured
176 assertNull(sf.getValue("AF"));
177 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
180 * verify variant feature(s) added to transcript
182 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
183 .getSequenceFeatures();
184 assertEquals(transcriptFeatures.size(), 3);
185 sf = transcriptFeatures.get(0);
186 assertEquals(sf.getFeatureGroup(), "VCF");
187 assertEquals(sf.getBegin(), 2);
188 assertEquals(sf.getEnd(), 2);
189 assertEquals(sf.getType(), SEQUENCE_VARIANT);
190 assertEquals(sf.getScore(), 0f);
191 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
193 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
194 sf = transcriptFeatures.get(1);
195 assertEquals(sf.getFeatureGroup(), "VCF");
196 assertEquals(sf.getBegin(), 2);
197 assertEquals(sf.getEnd(), 2);
198 assertEquals(sf.getType(), SEQUENCE_VARIANT);
199 assertEquals(sf.getScore(), 0f);
200 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
202 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
205 * verify SNP variant feature(s) computed and added to protein
206 * first codon AGC varies to ACC giving S/T
208 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
209 SequenceI peptide = null;
210 for (DBRefEntry dbref : dbRefs)
212 if (dbref.getMap().getMap().getFromRatio() == 3)
214 peptide = dbref.getMap().getTo();
217 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
218 assertEquals(proteinFeatures.size(), 3);
219 sf = proteinFeatures.get(0);
220 assertEquals(sf.getFeatureGroup(), "VCF");
221 assertEquals(sf.getBegin(), 1);
222 assertEquals(sf.getEnd(), 1);
223 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
224 assertEquals(sf.getDescription(), "p.Ser1Thr");
227 * check that sequence_variant attribute AF has been clocked as
228 * numeric with correct min and max values
229 * (i.e. invalid values have been ignored - JAL-3375)
231 FeatureAttributes fa = FeatureAttributes.getInstance();
232 assertSame(fa.getDatatype(SEQUENCE_VARIANT, "AF"), Datatype.Number);
233 float[] minmax = fa.getMinMax(SEQUENCE_VARIANT, "AF");
234 assertEquals(minmax[0], 0.002f);
235 assertEquals(minmax[1], 0.005f);
238 private File makeVcfFile() throws IOException
240 File f = File.createTempFile("Test", ".vcf");
242 PrintWriter pw = new PrintWriter(f);
243 for (String vcfLine : VCF)
252 * Make a simple alignment with one 'gene' and one 'transcript'
256 private AlignmentI buildAlignment()
258 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
259 DataSourceType.PASTE);
262 * map gene1 sequence to chromosome (normally done when the sequence is fetched
263 * from Ensembl and transcripts computed)
265 AlignmentI alignment = af.getViewport().getAlignment();
266 SequenceI gene1 = alignment.findName("gene1");
267 int[] to = new int[] { 45051610, 45051634 };
268 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
269 gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
273 * map 'transcript1' to chromosome via 'gene1'
274 * transcript1/1-18 is gene1/3-10,15-24
275 * which is chromosome 45051612-45051619,45051624-45051633
277 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
278 SequenceI transcript1 = alignment.findName("transcript1");
279 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
280 transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
285 * map gene2 to chromosome reverse strand
287 SequenceI gene2 = alignment.findName("gene2");
288 to = new int[] { 45051634, 45051610 };
289 from = new int[] { gene2.getStart(), gene2.getEnd() };
290 gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
294 * map 'transcript2' to chromosome via 'gene2'
295 * transcript2/1-18 is gene2/2-11,16-23
296 * which is chromosome 45051633-45051624,45051619-45051612
298 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
299 SequenceI transcript2 = alignment.findName("transcript2");
300 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
301 transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
306 * add a protein product as a DBRef on transcript1
308 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
309 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
311 Mapping map = new Mapping(peptide1, mapList);
312 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
313 transcript1.addDBRef(product);
316 * add a protein product as a DBRef on transcript2
318 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
319 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
320 map = new Mapping(peptide2, mapList);
321 product = new DBRefEntry("", "", "ENSP002", map);
322 transcript2.addDBRef(product);
325 * map gene3 to chromosome
327 SequenceI gene3 = alignment.findName("gene3");
328 to = new int[] { 45051610, 45051634 };
329 from = new int[] { gene3.getStart(), gene3.getEnd() };
330 gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
334 * map 'transcript3' to chromosome
336 SequenceI transcript3 = alignment.findName("transcript3");
337 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
338 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
339 transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
344 * map 'transcript4' to chromosome
346 SequenceI transcript4 = alignment.findName("transcript4");
347 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
349 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
350 transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
355 * add a protein product as a DBRef on transcript3
357 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
358 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
359 map = new Mapping(peptide3, mapList);
360 product = new DBRefEntry("", "", "ENSP003", map);
361 transcript3.addDBRef(product);
367 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
368 * chromosome. The VCF variant positions (in forward coordinates) should get
369 * correctly located on sequence positions.
371 * @throws IOException
373 @Test(groups = "Functional")
374 public void testDoLoad_reverseStrand() throws IOException
376 AlignmentI al = buildAlignment();
378 File f = makeVcfFile();
380 VCFLoader loader = new VCFLoader(f.getPath());
382 loader.doLoad(al.getSequencesArray(), null);
385 * verify variant feature(s) added to gene2
386 * gene2/1-25 maps to chromosome 45051634- reverse strand
388 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
389 .getSequenceFeatures();
390 SequenceFeatures.sortFeatures(geneFeatures, true);
391 assertEquals(geneFeatures.size(), 5);
395 * insertion G/GA at 45051613 maps to an insertion at
396 * the preceding position (21) on reverse strand gene
397 * reference: CAAGC -> GCTTG/21-25
398 * genomic variant: CAAGAC (G/GA)
399 * gene variant: GTCTTG (G/GT at 21)
401 sf = geneFeatures.get(1);
402 assertEquals(sf.getFeatureGroup(), "VCF");
403 assertEquals(sf.getBegin(), 21);
404 assertEquals(sf.getEnd(), 21);
405 assertEquals(sf.getType(), SEQUENCE_VARIANT);
406 assertEquals(sf.getScore(), 0f);
407 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
408 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
412 * variant G/C at 45051613 maps to C/G at gene position 22
414 sf = geneFeatures.get(2);
415 assertEquals(sf.getFeatureGroup(), "VCF");
416 assertEquals(sf.getBegin(), 22);
417 assertEquals(sf.getEnd(), 22);
418 assertEquals(sf.getType(), SEQUENCE_VARIANT);
419 assertEquals(sf.getScore(), 0f);
420 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
421 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
425 * variant A/C at 45051611 maps to T/G at gene position 24
427 sf = geneFeatures.get(3);
428 assertEquals(sf.getFeatureGroup(), "VCF");
429 assertEquals(sf.getBegin(), 24);
430 assertEquals(sf.getEnd(), 24);
431 assertEquals(sf.getType(), SEQUENCE_VARIANT);
432 assertEquals(sf.getScore(), 0f);
433 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
434 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
438 * variant A/T at 45051611 maps to T/A at gene position 24
440 sf = geneFeatures.get(4);
441 assertEquals(sf.getFeatureGroup(), "VCF");
442 assertEquals(sf.getBegin(), 24);
443 assertEquals(sf.getEnd(), 24);
444 assertEquals(sf.getType(), SEQUENCE_VARIANT);
445 assertEquals(sf.getScore(), 0f);
446 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
447 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
451 * verify 3 variant features added to transcript2
453 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
454 .getSequenceFeatures();
455 assertEquals(transcriptFeatures.size(), 3);
458 * insertion G/GT at position 21 of gene maps to position 16 of transcript
460 sf = transcriptFeatures.get(1);
461 assertEquals(sf.getFeatureGroup(), "VCF");
462 assertEquals(sf.getBegin(), 16);
463 assertEquals(sf.getEnd(), 16);
464 assertEquals(sf.getType(), SEQUENCE_VARIANT);
465 assertEquals(sf.getScore(), 0f);
466 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
467 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
471 * SNP C/G at position 22 of gene maps to position 17 of transcript
473 sf = transcriptFeatures.get(2);
474 assertEquals(sf.getFeatureGroup(), "VCF");
475 assertEquals(sf.getBegin(), 17);
476 assertEquals(sf.getEnd(), 17);
477 assertEquals(sf.getType(), SEQUENCE_VARIANT);
478 assertEquals(sf.getScore(), 0f);
479 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
480 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
484 * verify variant feature(s) computed and added to protein
485 * last codon GCT varies to GGT giving A/G in the last peptide position
487 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
488 SequenceI peptide = null;
489 for (DBRefEntry dbref : dbRefs)
491 if (dbref.getMap().getMap().getFromRatio() == 3)
493 peptide = dbref.getMap().getTo();
496 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
497 assertEquals(proteinFeatures.size(), 3);
498 sf = proteinFeatures.get(0);
499 assertEquals(sf.getFeatureGroup(), "VCF");
500 assertEquals(sf.getBegin(), 6);
501 assertEquals(sf.getEnd(), 6);
502 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
503 assertEquals(sf.getDescription(), "p.Ala6Gly");
507 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
508 * it is added to the variant feature, but restricted where possible to the
509 * consequences for a specific transcript
511 * @throws IOException
513 @Test(groups = "Functional")
514 public void testDoLoad_vepCsq() throws IOException
516 AlignmentI al = buildAlignment();
518 VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
521 * VCF data file with variants at gene3 positions
526 * 17 A/AC (insertion), A/G
528 loader.doLoad(al.getSequencesArray(), null);
531 * verify variant feature(s) added to gene3
533 List<SequenceFeature> geneFeatures = al.findName("gene3")
534 .getSequenceFeatures();
535 SequenceFeatures.sortFeatures(geneFeatures, true);
536 assertEquals(geneFeatures.size(), 7);
537 SequenceFeature sf = geneFeatures.get(0);
538 assertEquals(sf.getBegin(), 1);
539 assertEquals(sf.getEnd(), 1);
540 assertEquals(sf.getScore(), 0f);
541 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
542 assertEquals(sf.getValue("alleles"), "C,A");
543 // gene features include Consequence for all transcripts
544 Map map = (Map) sf.getValue("CSQ");
545 assertEquals(map.size(), 9);
547 sf = geneFeatures.get(1);
548 assertEquals(sf.getBegin(), 5);
549 assertEquals(sf.getEnd(), 5);
550 assertEquals(sf.getScore(), 0f);
551 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
552 assertEquals(sf.getValue("alleles"), "C,T");
553 map = (Map) sf.getValue("CSQ");
554 assertEquals(map.size(), 9);
556 sf = geneFeatures.get(2);
557 assertEquals(sf.getBegin(), 9);
558 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
559 assertEquals(sf.getScore(), 0f);
560 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
561 assertEquals(sf.getValue("alleles"), "CGG,C");
562 map = (Map) sf.getValue("CSQ");
563 assertEquals(map.size(), 9);
565 sf = geneFeatures.get(3);
566 assertEquals(sf.getBegin(), 13);
567 assertEquals(sf.getEnd(), 13);
568 assertEquals(sf.getScore(), 0f);
569 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
570 assertEquals(sf.getValue("alleles"), "C,T");
571 map = (Map) sf.getValue("CSQ");
572 assertEquals(map.size(), 9);
574 sf = geneFeatures.get(4);
575 assertEquals(sf.getBegin(), 13);
576 assertEquals(sf.getEnd(), 13);
577 assertEquals(sf.getScore(), 0f);
578 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
579 assertEquals(sf.getValue("alleles"), "C,G");
580 map = (Map) sf.getValue("CSQ");
581 assertEquals(map.size(), 9);
583 sf = geneFeatures.get(5);
584 assertEquals(sf.getBegin(), 17);
585 assertEquals(sf.getEnd(), 17);
586 assertEquals(sf.getScore(), 0f);
587 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
588 assertEquals(sf.getValue("alleles"), "A,G");
589 map = (Map) sf.getValue("CSQ");
590 assertEquals(map.size(), 9);
592 sf = geneFeatures.get(6);
593 assertEquals(sf.getBegin(), 17);
594 assertEquals(sf.getEnd(), 17); // insertion
595 assertEquals(sf.getScore(), 0f);
596 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
597 assertEquals(sf.getValue("alleles"), "A,AC");
598 map = (Map) sf.getValue("CSQ");
599 assertEquals(map.size(), 9);
602 * verify variant feature(s) added to transcript3
603 * at columns 5 (1), 17 (2), positions 3, 11
604 * note the deletion at columns 9-11 is not transferred since col 11
605 * has no mapping to transcript 3
607 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
608 .getSequenceFeatures();
609 SequenceFeatures.sortFeatures(transcriptFeatures, true);
610 assertEquals(transcriptFeatures.size(), 3);
611 sf = transcriptFeatures.get(0);
612 assertEquals(sf.getBegin(), 3);
613 assertEquals(sf.getEnd(), 3);
614 assertEquals(sf.getScore(), 0f);
615 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
616 assertEquals(sf.getValue("alleles"), "C,T");
617 // transcript features only have Consequence for that transcripts
618 map = (Map) sf.getValue("CSQ");
619 assertEquals(map.size(), 9);
620 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
622 sf = transcriptFeatures.get(1);
623 assertEquals(sf.getBegin(), 11);
624 assertEquals(sf.getEnd(), 11);
625 assertEquals(sf.getScore(), 0f);
626 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
627 assertEquals(sf.getValue("alleles"), "A,G");
628 assertEquals(map.size(), 9);
629 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
631 sf = transcriptFeatures.get(2);
632 assertEquals(sf.getBegin(), 11);
633 assertEquals(sf.getEnd(), 11);
634 assertEquals(sf.getScore(), 0f);
635 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
636 assertEquals(sf.getValue("alleles"), "A,AC");
637 assertEquals(map.size(), 9);
638 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
641 * verify variants computed on protein product for transcript3
643 * codon variants are AGC/AGT position 1 which is synonymous
644 * and GAG/GGG which is E/G in position 4
645 * the insertion variant is not transferred to the peptide
647 DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
648 SequenceI peptide = null;
649 for (DBRefEntry dbref : dbRefs)
651 if (dbref.getMap().getMap().getFromRatio() == 3)
653 peptide = dbref.getMap().getTo();
656 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
657 SequenceFeatures.sortFeatures(proteinFeatures, true);
658 assertEquals(proteinFeatures.size(), 2);
659 sf = proteinFeatures.get(0);
660 assertEquals(sf.getFeatureGroup(), "VCF");
661 assertEquals(sf.getBegin(), 1);
662 assertEquals(sf.getEnd(), 1);
663 assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
664 assertEquals(sf.getDescription(), "agC/agT");
665 sf = proteinFeatures.get(1);
666 assertEquals(sf.getFeatureGroup(), "VCF");
667 assertEquals(sf.getBegin(), 4);
668 assertEquals(sf.getEnd(), 4);
669 assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
670 assertEquals(sf.getDescription(), "p.Glu4Gly");
673 * verify variant feature(s) added to transcript4
674 * at columns 13 (2) and 17 (2), positions 7 and 11
676 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
677 SequenceFeatures.sortFeatures(transcriptFeatures, true);
678 assertEquals(transcriptFeatures.size(), 4);
679 sf = transcriptFeatures.get(0);
680 assertEquals(sf.getBegin(), 7);
681 assertEquals(sf.getEnd(), 7);
682 assertEquals(sf.getScore(), 0f);
683 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
684 assertEquals(sf.getValue("alleles"), "C,T");
685 assertEquals(map.size(), 9);
686 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
688 sf = transcriptFeatures.get(1);
689 assertEquals(sf.getBegin(), 7);
690 assertEquals(sf.getEnd(), 7);
691 assertEquals(sf.getScore(), 0f);
692 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
693 assertEquals(sf.getValue("alleles"), "C,G");
694 assertEquals(map.size(), 9);
695 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
697 sf = transcriptFeatures.get(2);
698 assertEquals(sf.getBegin(), 11);
699 assertEquals(sf.getEnd(), 11);
700 assertEquals(sf.getScore(), 0f);
701 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
702 assertEquals(sf.getValue("alleles"), "A,G");
703 assertEquals(map.size(), 9);
704 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
706 sf = transcriptFeatures.get(3);
707 assertEquals(sf.getBegin(), 11);
708 assertEquals(sf.getEnd(), 11);
709 assertEquals(sf.getScore(), 0f);
710 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
711 assertEquals(sf.getValue("alleles"), "A,AC");
712 assertEquals(map.size(), 9);
713 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
717 * A test that demonstrates loading a contig sequence from an indexed sequence
718 * database which is the reference for a VCF file
720 * @throws IOException
722 @Test(groups = "Functional")
723 public void testLoadVCFContig() throws IOException
725 VCFLoader loader = new VCFLoader(
726 "test/jalview/io/vcf/testVcf2.vcf");
728 SequenceI seq = loader.loadVCFContig("contig123");
729 assertEquals(seq.getLength(), 15);
730 assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
731 List<SequenceFeature> features = seq.getSequenceFeatures();
732 SequenceFeatures.sortFeatures(features, true);
733 assertEquals(features.size(), 2);
734 SequenceFeature sf = features.get(0);
735 assertEquals(sf.getBegin(), 8);
736 assertEquals(sf.getEnd(), 8);
737 assertEquals(sf.getDescription(), "C,A");
738 sf = features.get(1);
739 assertEquals(sf.getBegin(), 12);
740 assertEquals(sf.getEnd(), 12);
741 assertEquals(sf.getDescription(), "G,T");
743 seq = loader.loadVCFContig("contig789");
744 assertEquals(seq.getLength(), 25);
745 assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
746 features = seq.getSequenceFeatures();
747 SequenceFeatures.sortFeatures(features, true);
748 assertEquals(features.size(), 2);
749 sf = features.get(0);
750 assertEquals(sf.getBegin(), 2);
751 assertEquals(sf.getEnd(), 2);
752 assertEquals(sf.getDescription(), "G,T");
753 sf = features.get(1);
754 assertEquals(sf.getBegin(), 21);
755 assertEquals(sf.getEnd(), 21);
756 assertEquals(sf.getDescription(), "G,A");
758 seq = loader.loadVCFContig("contig456");
759 assertEquals(seq.getLength(), 20);
760 assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
761 features = seq.getSequenceFeatures();
762 SequenceFeatures.sortFeatures(features, true);
763 assertEquals(features.size(), 1);
764 sf = features.get(0);
765 assertEquals(sf.getBegin(), 15);
766 assertEquals(sf.getEnd(), 15);
767 assertEquals(sf.getDescription(), "T,C");