+
+ /**
+ * Test mapping a sequence group including a sequence which maps to more than
+ * one other sequence
+ *
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapSequenceGroup_oneToMany() throws IOException
+ {
+ /*
+ * Uniprot:FER2_ARATH has cross-refs to 10 EMBLCDS sequences;
+ * we'll just mimic 3 of them here (abbreviated)
+ * From EMBLCDS|BAE98526 [ [1, 444] ] 3:1 to [ [1, 148] ] FER2_ARATH
+ * From EMBLCDS|AAM91336 same
+ * From EMBLCDS|AAM13033 same
+ */
+ String coding = "atggcttccactgctctctca";
+ AlignmentI cds = loadAlignment(">BAE98526\n" + coding + "\n>AAM91336\n"
+ + coding + "\n>AAM13033\n" + coding + "\n",
+ FileFormat.Fasta);
+ cds.setDataset(null);
+ AlignmentI protein = loadAlignment(">FER2_ARATH\nMASTALS\n",
+ FileFormat.Fasta);
+ protein.setDataset(null);
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ MapList map = new MapList(new int[] { 1, 21 }, new int[] { 1, 7 }, 3, 1);
+ for (int seq = 0; seq < 3; seq++)
+ {
+ acf.addMap(cds.getSequenceAt(seq).getDatasetSequence(),
+ protein.getSequenceAt(0).getDatasetSequence(), map);
+ }
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+
+ AlignViewportI theDnaView = new AlignViewport(cds);
+ AlignViewportI theProteinView = new AlignViewport(protein);
+ protein.setCodonFrames(acfList);
+
+ /*
+ * Select FER2_ARATH in the protein
+ */
+ SequenceGroup sg = new SequenceGroup();
+ sg.setColourText(true);
+ sg.setIdColour(Color.GREEN);
+ sg.setOutlineColour(Color.LIGHT_GRAY);
+ sg.addSequence(protein.getSequenceAt(0), false);
+ sg.setEndRes(protein.getWidth() - 1);
+
+ /*
+ * Verify the mapped sequence group in dna
+ */
+ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+ theProteinView, theDnaView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(3, mappedGroup.getSequences().size());
+ assertSame(cds.getSequenceAt(0), mappedGroup.getSequences().get(0));
+ assertSame(cds.getSequenceAt(1), mappedGroup.getSequences().get(1));
+ assertSame(cds.getSequenceAt(2), mappedGroup.getSequences().get(2));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(20, mappedGroup.getEndRes()); // 21 columns (7 codons)
+
+ /*
+ * Select 2 CDS, verify peptide is mapped
+ */
+ sg.clear();
+ sg.addSequence(cds.getSequenceAt(1), false);
+ sg.addSequence(cds.getSequenceAt(0), false);
+ sg.setStartRes(0);
+ sg.setEndRes(20);
+ mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+ theProteinView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(1, mappedGroup.getSequences().size());
+ assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(6, mappedGroup.getEndRes());
+ }