--- /dev/null
+package jalview.datamodel;
+
+
+/**
+ * A data bean class to hold properties of an RNA viewer
+ */
+public class RnaViewerModel
+{
+ public final String viewId;
+
+ public final String title;
+
+ public final int x;
+
+ public final int y;
+
+ public final int width;
+
+ public final int height;
+
+ public final int dividerLocation;
+
+ /**
+ * Constructor
+ *
+ * @param viewId
+ * @param title
+ * @param xpos
+ * @param ypos
+ * @param width
+ * @param height
+ * @param dividerLocation
+ */
+ public RnaViewerModel(String viewId, String title, int xpos, int ypos,
+ int width,
+ int height, int dividerLocation)
+ {
+ this.viewId = viewId;
+ this.title = title;
+ this.x = xpos;
+ this.y = ypos;
+ this.width = width;
+ this.height = height;
+ this.dividerLocation = dividerLocation;
+ }
+}
--- /dev/null
+package jalview.ext.varna;
+
+import fr.orsay.lri.varna.models.rna.RNA;
+
+import jalview.datamodel.AlignmentAnnotation;
+import jalview.datamodel.SequenceI;
+
+/**
+ * Data bean wrapping the data items that define one RNA view
+ */
+public class RnaModel
+{
+ public final String title;
+
+ public final AlignmentAnnotation ann;
+
+ public final SequenceI seq;
+
+ public final boolean gapped;
+
+ public final RNA rna;
+
+ // path to a file holding VARNA session state XML
+ public final String varnaSession;
+
+ public RnaModel(String t, AlignmentAnnotation aa, SequenceI s, RNA r,
+ boolean g,
+ String sessionFile)
+ {
+ title = t;
+ ann = aa;
+ seq = s;
+ gapped = g;
+ rna = r;
+ varnaSession = sessionFile;
+ }
+}
\ No newline at end of file
import java.awt.BorderLayout;
import java.awt.Color;
-import java.util.ArrayList;
+import java.util.Collection;
import java.util.Hashtable;
+import java.util.LinkedHashMap;
+import java.util.List;
import java.util.Map;
import java.util.regex.Matcher;
import java.util.regex.Pattern;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
import fr.orsay.lri.varna.interfaces.InterfaceVARNASelectionListener;
import fr.orsay.lri.varna.models.BaseList;
-import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.FullBackup;
import fr.orsay.lri.varna.models.annotations.HighlightRegionAnnotation;
import fr.orsay.lri.varna.models.rna.ModeleBase;
import fr.orsay.lri.varna.models.rna.RNA;
-import jalview.bin.Cache;
+import jalview.analysis.AlignSeq;
+import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.ColumnSelection;
+import jalview.datamodel.RnaViewerModel;
import jalview.datamodel.SequenceGroup;
import jalview.datamodel.SequenceI;
+import jalview.ext.varna.RnaModel;
import jalview.structure.SecondaryStructureListener;
import jalview.structure.SelectionListener;
import jalview.structure.SelectionSource;
import jalview.structure.StructureSelectionManager;
import jalview.structure.VamsasSource;
+import jalview.util.Comparison;
import jalview.util.MessageManager;
import jalview.util.ShiftList;
-public class AppVarna extends JInternalFrame implements
- InterfaceVARNAListener, SelectionListener,
- SecondaryStructureListener// implements
- // Runnable,SequenceStructureBinding,
- // ViewSetProvider
- , InterfaceVARNASelectionListener, VamsasSource
-
+public class AppVarna extends JInternalFrame implements SelectionListener,
+ SecondaryStructureListener, InterfaceVARNASelectionListener,
+ VamsasSource
{
- AppVarnaBinding vab;
+ private static final Pattern PAIRS_PATTERN = Pattern
+ .compile("[^([{<>}])]");
+
+ private AppVarnaBinding vab;
- VARNAPanel varnaPanel;
+ private AlignmentPanel ap;
- public String name;
+ private String viewId;
- public StructureSelectionManager ssm;
+ private StructureSelectionManager ssm;
/*
- * public AppVarna(){ vab = new AppVarnaBinding(); initVarna(); }
+ * Lookup for sequence and annotation mapped to each RNA in the viewer. Using
+ * a linked hashmap means that order is preserved when saved to the project.
*/
+ private Map<RNA, RnaModel> models = new LinkedHashMap<RNA, RnaModel>();
+
+ private Map<RNA, ShiftList> offsets = new Hashtable<RNA, ShiftList>();
+
+ private Map<RNA, ShiftList> offsetsInv = new Hashtable<RNA, ShiftList>();
+
+ private JSplitPane split;
- AlignmentPanel ap;
+ private VarnaHighlighter mouseOverHighlighter = new VarnaHighlighter();
- public AppVarna(String sname, SequenceI seq, String strucseq,
- String struc, String name, AlignmentPanel ap)
+ private VarnaHighlighter selectionHighlighter = new VarnaHighlighter();
+
+ private class VarnaHighlighter
{
+ private HighlightRegionAnnotation _lastHighlight;
- // System.out.println("1:"+sname);
- // System.out.println("2:"+seq);
- // System.out.println("3:"+strucseq);
- // System.out.println("4:"+struc);
- // System.out.println("5:"+name);
- // System.out.println("6:"+ap);
- this.ap = ap;
- ArrayList<RNA> rnaList = new ArrayList<RNA>();
- RNA rna1 = new RNA(name);
- try
+ private RNA _lastRNAhighlighted = null;
+
+ public VarnaHighlighter()
{
- rna1.setRNA(strucseq, replaceOddGaps(struc));
- // System.out.println("The sequence is :"+rna1.getSeq());
- // System.out.println("The sequence is:"+struc);
- // System.out.println("The sequence is:"+replaceOddGaps(struc).toString());
- } catch (ExceptionUnmatchedClosingParentheses e2)
+ }
+
+ /**
+ * Constructor when restoring from Varna session, including any highlight
+ * state
+ *
+ * @param rna
+ */
+ public VarnaHighlighter(RNA rna)
{
- e2.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e3)
+ // TODO nice try but doesn't work; do we need a highlighter per model?
+ _lastRNAhighlighted = rna;
+ List<HighlightRegionAnnotation> highlights = rna.getHighlightRegion();
+ if (highlights != null && !highlights.isEmpty())
+ {
+ _lastHighlight = highlights.get(0);
+ }
+ }
+
+ public void highlightRegion(RNA rna, int start, int end)
{
- e3.printStackTrace();
+ clearLastSelection();
+ HighlightRegionAnnotation highlight = new HighlightRegionAnnotation(
+ rna.getBasesBetween(start, end));
+ rna.addHighlightRegion(highlight);
+ _lastHighlight = highlight;
+ _lastRNAhighlighted = rna;
}
- RNA trim = trimRNA(rna1, "trimmed " + sname);
- rnaList.add(trim);
- rnaList.add(rna1);
- rnas.put(seq, rna1);
- rnas.put(seq, trim);
- rna1.setName(sname + " (with gaps)");
+ public HighlightRegionAnnotation getLastHighlight()
+ {
+ return _lastHighlight;
+ }
+ /**
+ * Clears all structure selection and refreshes the display
+ */
+ public void clearSelection()
{
- seqs.put(trim, seq);
- seqs.put(rna1, seq);
+ if (_lastRNAhighlighted != null)
+ {
+ _lastRNAhighlighted.getHighlightRegion().clear();
+ vab.updateSelectedRNA(_lastRNAhighlighted);
+ _lastRNAhighlighted = null;
+ _lastHighlight = null;
+ }
+ }
- /**
- * if (false || seq.getStart()!=1) { for (RNA rshift:rnaList) { ShiftList
- * shift=offsets.get(rshift); if (shift==null) { offsets.put(rshift,
- * shift=new ShiftList());} shift.addShift(1, seq.getStart()-1);
- * offsetsInv.put(rshift, shift.getInverse()); } }
- **/
+ /**
+ * Clear the last structure selection
+ */
+ public void clearLastSelection()
+ {
+ if (_lastRNAhighlighted != null)
+ {
+ _lastRNAhighlighted.removeHighlightRegion(_lastHighlight);
+ _lastRNAhighlighted = null;
+ _lastHighlight = null;
+ }
}
- vab = new AppVarnaBinding(rnaList);
- // vab = new AppVarnaBinding(seq,struc);
- this.name = sname + " trimmed to " + name;
+ }
+
+ /**
+ * Constructor
+ *
+ * @param sname
+ * a descriptive name
+ * @param seq
+ * the RNA sequence
+ * @param aa
+ * the annotation with the secondary structure string
+ * @param ap
+ * the AlignmentPanel creating this object
+ */
+ public AppVarna(String sname, SequenceI seq, AlignmentAnnotation aa,
+ AlignmentPanel ap)
+ {
+ this(ap);
+
+ String name = sname + " trimmed to " + seq.getName();
+ String fullName = MessageManager.formatMessage("label.varna_params",
+ new String[]
+ { name });
+ setTitle(fullName);
+
+ /*
+ * if (!aa.isValidStruc()) { throw new
+ * IllegalArgumentException("Invalid RNA structure annotation"); } final
+ * String struc = aa.getRNAStruc();
+ *
+ * String strucseq = seq.getSequenceAsString();
+ *
+ * String gappedTitle = sname + " (with gaps)"; String rnaTitle =
+ * gappedTitle; RNA gapped = new RNA(rnaTitle); try {
+ * gapped.setRNA(strucseq, replaceOddGaps(struc)); } catch
+ * (ExceptionUnmatchedClosingParentheses e2) { e2.printStackTrace(); } catch
+ * (ExceptionFileFormatOrSyntax e3) { e3.printStackTrace(); }
+ * models.put(gapped, new RnaModel(rnaTitle, aa, seq, gapped, true, null));
+ *
+ * String trimmedTitle = "trimmed " + sname; rnaTitle = trimmedTitle; RNA
+ * trimmed = trimRNA(gapped, rnaTitle); models.put(trimmed, new
+ * RnaModel(rnaTitle, aa, seq, trimmed, false, null));
+ */
+ // vab = new AppVarnaBinding(Arrays.asList(new RNA[]
+ // { trimmed, gapped }));
+ // vab = new AppVarnaBinding();
+ // // String seqName = seq.getName();
+ // // String name = sname + " trimmed to " + seqName;
+ // initVarna(name);
+
+ String gappedTitle = sname + " (with gaps)";
+ RnaModel gappedModel = new RnaModel(gappedTitle, aa, seq, null, true,
+ null);
+ addModel(gappedModel, gappedTitle);
+
+ String trimmedTitle = "trimmed " + sname;
+ RnaModel trimmedModel = new RnaModel(trimmedTitle, aa, seq, null,
+ false, null);
+ addModel(trimmedModel, trimmedTitle);
+ vab.setSelectedIndex(0);
+ }
+
+ /**
+ * Constructor that links the viewer to a parent panel (but has no structures
+ * yet - use addModel to add them)
+ *
+ * @param ap
+ */
+ protected AppVarna(AlignmentPanel ap)
+ {
+ this.ap = ap;
+ this.viewId = System.currentTimeMillis() + "." + this.hashCode();
+ vab = new AppVarnaBinding();
initVarna();
- ssm = ap.getStructureSelectionManager();
- // System.out.println(ssm.toString());
+ this.ssm = ap.getStructureSelectionManager();
ssm.addStructureViewerListener(this);
ssm.addSelectionListener(this);
addInternalFrameListener(new InternalFrameAdapter()
close();
}
});
+ }
+ /**
+ * Constructor given viewer data read from a saved project file
+ *
+ * @param model
+ * @param ap
+ * the (or a) parent alignment panel
+ */
+ public AppVarna(RnaViewerModel model, AlignmentPanel ap)
+ {
+ this(ap);
+ setTitle(model.title);
+ this.viewId = model.viewId;
+ setBounds(model.x, model.y, model.width, model.height);
+ this.split.setDividerLocation(model.dividerLocation);
}
+ /**
+ * Constructs a split pane with an empty selection list and display panel, and
+ * adds it to the desktop
+ */
public void initVarna()
{
-
- // vab.setFinishedInit(false);
- varnaPanel = vab.get_varnaPanel();
+ VARNAPanel varnaPanel = vab.get_varnaPanel();
setBackground(Color.white);
- JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, true,
+ split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT, true,
vab.getListPanel(), varnaPanel);
getContentPane().setLayout(new BorderLayout());
getContentPane().add(split, BorderLayout.CENTER);
- // getContentPane().add(vab.getTools(), BorderLayout.NORTH);
- varnaPanel.addVARNAListener(this);
+
varnaPanel.addSelectionListener(this);
- jalview.gui.Desktop.addInternalFrame(this,
- MessageManager.formatMessage("label.varna_params", new String[]
- { name }), getBounds().width, getBounds().height);
+ jalview.gui.Desktop.addInternalFrame(this, "", getBounds().width,
+ getBounds().height);
this.pack();
showPanel(true);
-
}
public String replaceOddGaps(String oldStr)
{
- String patternStr = "[^([{<>}])]";
- String replacementStr = ".";
- Pattern pattern = Pattern.compile(patternStr);
- Matcher matcher = pattern.matcher(oldStr);
- String newStr = matcher.replaceAll(replacementStr);
+ Matcher matcher = PAIRS_PATTERN.matcher(oldStr);
+ String newStr = matcher.replaceAll(".");
return newStr;
}
+ /**
+ * Constructs a new RNA model from the given one, without gaps. Also
+ * calculates and saves a 'shift list'
+ *
+ * @param rna
+ * @param name
+ * @return
+ */
public RNA trimRNA(RNA rna, String name)
{
ShiftList offset = new ShiftList();
e3.printStackTrace();
}
- StringBuffer seq = new StringBuffer(rnaTrim.getSeq());
- StringBuffer struc = new StringBuffer(rnaTrim.getStructDBN());
- int ofstart = -1, sleng = rnaTrim.getSeq().length();
+ String seq = rnaTrim.getSeq();
+ StringBuilder struc = new StringBuilder(256);
+ struc.append(rnaTrim.getStructDBN());
+ int ofstart = -1;
+ int sleng = seq.length();
+
for (int i = 0; i < sleng; i++)
{
- // TODO: Jalview utility for gap detection java.utils.isGap()
- // TODO: Switch to jalview rna datamodel
- if (jalview.util.Comparison.isGap(seq.charAt(i)))
+ if (Comparison.isGap(seq.charAt(i)))
{
if (ofstart == -1)
{
ofstart = i;
}
+ /*
+ * mark base or base pair in the structure with *
+ */
if (!rnaTrim.findPair(i).isEmpty())
{
int m = rnaTrim.findPair(i).get(1);
offset.addShift(offset.shift(ofstart), ofstart - sleng);
ofstart = -1;
}
- String newSeq = rnaTrim.getSeq().replace("-", "");
- rnaTrim.getSeq().replace(".", "");
+
+ /*
+ * remove the marked gaps from the structure
+ */
String newStruc = struc.toString().replace("*", "");
+ /*
+ * remove gaps from the sequence
+ */
+ String newSeq = AlignSeq.extractGaps(Comparison.GapChars, seq);
+
try
{
rnaTrim.setRNA(newSeq, newStruc);
registerOffset(rnaTrim, offset);
} catch (ExceptionUnmatchedClosingParentheses e)
{
- // TODO Auto-generated catch block
e.printStackTrace();
} catch (ExceptionFileFormatOrSyntax e)
{
- // TODO Auto-generated catch block
e.printStackTrace();
}
return rnaTrim;
}
- // needs to be many-many
- Map<RNA, SequenceI> seqs = new Hashtable<RNA, SequenceI>();
-
- Map<SequenceI, RNA> rnas = new Hashtable<SequenceI, RNA>();
-
- Map<RNA, ShiftList> offsets = new Hashtable<RNA, ShiftList>();
-
- Map<RNA, ShiftList> offsetsInv = new Hashtable<RNA, ShiftList>();
-
+ /**
+ * Save the sequence to structure mapping, and also its inverse.
+ *
+ * @param rnaTrim
+ * @param offset
+ */
private void registerOffset(RNA rnaTrim, ShiftList offset)
{
offsets.put(rnaTrim, offset);
this.setVisible(show);
}
- private boolean _started = false;
-
- public void run()
- {
- _started = true;
-
- try
- {
- initVarna();
- } catch (OutOfMemoryError oomerror)
- {
- new OOMWarning("When trying to open the Varna viewer!", oomerror);
- } catch (Exception ex)
- {
- Cache.log.error("Couldn't open Varna viewer!", ex);
- }
- }
-
- @Override
- public void onUINewStructure(VARNAConfig v, RNA r)
- {
-
- }
-
- @Override
- public void onWarningEmitted(String s)
- {
- // TODO Auto-generated method stub
-
- }
-
- private class VarnaHighlighter
- {
- private HighlightRegionAnnotation _lastHighlight;
-
- private RNA _lastRNAhighlighted = null;
-
- public void highlightRegion(RNA rna, int start, int end)
- {
- clearSelection(null);
- HighlightRegionAnnotation highlight = new HighlightRegionAnnotation(
- rna.getBasesBetween(start, end));
- rna.addHighlightRegion(highlight);
- _lastHighlight = highlight;
- _lastRNAhighlighted = rna;
-
- }
-
- public HighlightRegionAnnotation getLastHighlight()
- {
- return _lastHighlight;
- }
-
- public RNA getLastRNA()
- {
- return _lastRNAhighlighted;
- }
-
- public void clearSelection(AppVarnaBinding vab)
- {
- if (_lastRNAhighlighted != null)
- {
- _lastRNAhighlighted.removeHighlightRegion(_lastHighlight);
- if (vab != null)
- {
- vab.updateSelectedRNA(_lastRNAhighlighted);
- }
- _lastRNAhighlighted = null;
- _lastHighlight = null;
-
- }
- }
- }
-
- VarnaHighlighter mouseOverHighlighter = new VarnaHighlighter(),
- selectionHighlighter = new VarnaHighlighter();
-
/**
* If a mouseOver event from the AlignmentPanel is noticed the currently
* selected RNA in the VARNA window is highlighted at the specific position.
public void mouseOverSequence(SequenceI sequence, int index)
{
RNA rna = vab.getSelectedRNA();
- if (seqs.get(rna) == sequence)
+ if (rna == null)
+ {
+ return;
+ }
+ if (models.get(rna).seq == sequence)
{
ShiftList shift = offsets.get(rna);
if (shift != null)
}
@Override
- public void onStructureRedrawn()
- {
- // TODO Auto-generated method stub
-
- }
-
- @Override
public void selection(SequenceGroup seqsel, ColumnSelection colsel,
SelectionSource source)
{
// TODO - reuse many-one panel-view system in jmol viewer
return;
}
+ RNA rna = vab.getSelectedRNA();
+ if (rna == null)
+ {
+ return;
+ }
if (seqsel != null && seqsel.getSize() > 0)
{
int start = seqsel.getStartRes(), end = seqsel.getEndRes();
- RNA rna = vab.getSelectedRNA();
ShiftList shift = offsets.get(rna);
if (shift != null)
{
}
else
{
- selectionHighlighter.clearSelection(vab);
+ selectionHighlighter.clearSelection();
}
}
+ /**
+ * Respond to a change of the base hovered over in the Varna viewer
+ */
@Override
- public void onHoverChanged(ModeleBase arg0, ModeleBase arg1)
+ public void onHoverChanged(ModeleBase previousBase, ModeleBase newBase)
{
RNA rna = vab.getSelectedRNA();
ShiftList shift = offsetsInv.get(rna);
- SequenceI seq = seqs.get(rna);
- if (arg1 != null && seq != null)
+ SequenceI seq = models.get(rna).seq;
+ if (newBase != null && seq != null)
{
if (shift != null)
{
- int i = shift.shift(arg1.getIndex());
+ int i = shift.shift(newBase.getIndex());
// System.err.println("shifted "+(arg1.getIndex())+" to "+i);
ssm.mouseOverVamsasSequence(seq, i, this);
}
else
{
- ssm.mouseOverVamsasSequence(seq, arg1.getIndex(), this);
+ ssm.mouseOverVamsasSequence(seq, newBase.getIndex(), this);
}
}
}
}
- @Override
- public void onTranslationChanged()
+ /**
+ * Returns the path to a temporary file containing a representation of the
+ * state of one Varna display
+ *
+ * @param rna
+ *
+ * @return
+ */
+ public String getStateInfo(RNA rna)
+ {
+ return vab.getStateInfo(rna);
+ }
+
+ public AlignmentPanel getAlignmentPanel()
{
- // TODO Auto-generated method stub
+ return ap;
+ }
+ public String getViewId()
+ {
+ return viewId;
}
- @Override
- public void onZoomLevelChanged()
+ /**
+ * Returns true if any of the viewer's models (not necessarily the one
+ * currently displayed) is for the given sequence
+ *
+ * @param seq
+ * @return
+ */
+ public boolean isListeningFor(SequenceI seq)
{
- // TODO Auto-generated method stub
+ for (RnaModel model : models.values())
+ {
+ if (model.seq == seq)
+ {
+ return true;
+ }
+ }
+ return false;
+ }
+ /**
+ * Returns a value representing the horizontal split divider location
+ *
+ * @return
+ */
+ public int getDividerLocation()
+ {
+ return split == null ? 0 : split.getDividerLocation();
}
/**
protected void close()
{
/*
- * Deregister as a listener, to free references to this object
+ * Deregister as a listener, to release references to this object
*/
if (ssm != null)
{
}
}
+ /**
+ * Returns the secondary structure annotation that this viewer displays for
+ * the given sequence
+ *
+ * @return
+ */
+ public AlignmentAnnotation getAnnotation(SequenceI seq)
+ {
+ for (RnaModel model : models.values())
+ {
+ if (model.seq == seq)
+ {
+ return model.ann;
+ }
+ }
+ return null;
+ }
+
+ public int getSelectedIndex()
+ {
+ return this.vab.getSelectedIndex();
+ }
+
+ /**
+ * Returns the set of models shown by the viewer
+ *
+ * @return
+ */
+ public Collection<RnaModel> getModels()
+ {
+ return models.values();
+ }
+
+ /**
+ * Add a model (e.g. loaded from project file)
+ *
+ * @param rna
+ * @param modelName
+ */
+ public RNA addModel(RnaModel model, String modelName)
+ {
+ if (!model.ann.isValidStruc())
+ {
+ throw new IllegalArgumentException("Invalid RNA structure annotation");
+ }
+
+ /*
+ * loaded from project file with Varna session data
+ */
+ if (model.varnaSession != null)
+ {
+ try
+ {
+ FullBackup fromSession = vab.vp.loadSession(model.varnaSession);
+ vab.addStructure(fromSession.rna, fromSession.config);
+ RNA rna = fromSession.rna;
+ // copy the model, but now including the RNA object
+ RnaModel newModel = new RnaModel(model.title, model.ann, model.seq,
+ rna, model.gapped, model.varnaSession);
+ if (!model.gapped)
+ {
+ registerOffset(rna, buildOffset(model.seq));
+ }
+ // TODO and add mapping (offsets)
+ models.put(rna, newModel);
+ // capture rna selection state when saved
+ selectionHighlighter = new VarnaHighlighter(rna);
+ return fromSession.rna;
+ } catch (ExceptionLoadingFailed e)
+ {
+ e.printStackTrace();
+ return null;
+ }
+ }
+
+ /*
+ * opened on request in Jalview session
+ */
+ RNA rna = new RNA(modelName);
+ String struc = model.ann.getRNAStruc();
+ struc = replaceOddGaps(struc);
+
+ String strucseq = model.seq.getSequenceAsString();
+ try
+ {
+ rna.setRNA(strucseq, struc);
+ } catch (ExceptionUnmatchedClosingParentheses e2)
+ {
+ e2.printStackTrace();
+ } catch (ExceptionFileFormatOrSyntax e3)
+ {
+ e3.printStackTrace();
+ }
+
+ if (!model.gapped)
+ {
+ rna = trimRNA(rna, modelName);
+ }
+ models.put(rna, new RnaModel(modelName, model.ann, model.seq, rna,
+ model.gapped, null));
+ vab.addStructure(rna);
+ return rna;
+ }
+
+ /**
+ * Constructs a shift list that describes the gaps in the sequence
+ *
+ * @param seq
+ * @return
+ */
+ protected ShiftList buildOffset(SequenceI seq)
+ {
+ // TODO refactor to avoid duplication with trimRNA()
+ ShiftList offset = new ShiftList();
+ int ofstart = -1;
+ int sleng = seq.getLength();
+ char[] seqChars = seq.getSequence();
+
+ for (int i = 0; i < sleng; i++)
+ {
+ if (Comparison.isGap(seqChars[i]))
+ {
+ if (ofstart == -1)
+ {
+ ofstart = i;
+ }
+ }
+ else
+ {
+ if (ofstart > -1)
+ {
+ offset.addShift(offset.shift(ofstart), ofstart - i);
+ ofstart = -1;
+ }
+ }
+ }
+ // final gap
+ if (ofstart > -1)
+ {
+ offset.addShift(offset.shift(ofstart), ofstart - sleng);
+ ofstart = -1;
+ }
+ return offset;
+ }
+
+ /**
+ * Set the selected index in the model selection list
+ *
+ * @param selectedRna
+ */
+ public void setSelectedIndex(int selectedRna)
+ {
+ vab.setSelectedIndex(selectedRna);
+ }
}
import java.awt.Component;
import java.awt.Dimension;
import java.awt.Font;
-import java.awt.GridLayout;
import java.awt.datatransfer.DataFlavor;
import java.awt.datatransfer.Transferable;
import java.awt.dnd.DnDConstants;
import java.awt.dnd.DropTarget;
-import java.awt.dnd.DropTargetDragEvent;
+import java.awt.dnd.DropTargetAdapter;
import java.awt.dnd.DropTargetDropEvent;
-import java.awt.dnd.DropTargetEvent;
-import java.awt.dnd.DropTargetListener;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
import java.awt.event.ComponentEvent;
+import java.awt.event.MouseAdapter;
import java.awt.event.MouseEvent;
-import java.awt.event.MouseListener;
import java.io.File;
+import java.io.IOException;
import java.util.ArrayList;
import java.util.Collection;
import java.util.List;
import javax.swing.DefaultListModel;
import javax.swing.DefaultListSelectionModel;
-import javax.swing.JButton;
import javax.swing.JLabel;
import javax.swing.JList;
import javax.swing.JPanel;
import javax.swing.JScrollPane;
-import javax.swing.JTextField;
import javax.swing.ListModel;
import javax.swing.ListSelectionModel;
import javax.swing.event.ListSelectionEvent;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.components.ReorderableJList;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
import fr.orsay.lri.varna.models.FullBackup;
import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.rna.Mapping;
import fr.orsay.lri.varna.models.rna.RNA;
import jalview.datamodel.SequenceI;
+import jalview.ext.varna.JalviewVarnaBinding;
import jalview.structure.AtomSpec;
import jalview.util.MessageManager;
-public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding
- implements DropTargetListener, InterfaceVARNAListener,
- MouseListener
+public class AppVarnaBinding extends JalviewVarnaBinding
{
-
- /**
- *
- */
- // private static final long serialVersionUID = -790155708306987257L;
-
- private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
- private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
-
- private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
-
public VARNAPanel vp;
- protected JPanel _tools = new JPanel();
-
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
-
- private JPanel _strPanel = new JPanel();
-
- private JLabel _info = new JLabel();
-
- private JTextField _str = new JTextField();
-
- private JTextField _seq = new JTextField();
-
- private JLabel _strLabel = new JLabel(
- MessageManager.getString("label.str"));
-
- private JLabel _seqLabel = new JLabel(
- MessageManager.getString("label.seq"));
-
- private JButton _createButton = new JButton(
- MessageManager.getString("action.create"));
-
- private JButton _updateButton = new JButton(
- MessageManager.getString("action.update"));
-
- private JButton _deleteButton = new JButton(
- MessageManager.getString("action.delete"));
-
- private JButton _duplicateButton = new JButton(
- MessageManager.getString("action.snapshot"));
-
+ // remove unused (commented out) fields?
+ // protected JPanel _tools = new JPanel();
+ //
+ // private JPanel _input = new JPanel();
+ //
+ // private JPanel _strPanel = new JPanel();
+ //
+ // private JTextField _str = new JTextField();
+ //
+ // private JTextField _seq = new JTextField();
+ //
+ // private JLabel _strLabel = new JLabel(
+ // MessageManager.getString("label.str"));
+ //
+ // private JButton _updateButton = new JButton(
+ // MessageManager.getString("action.update"));
+ //
+ // private JButton _deleteButton = new JButton(
+ // MessageManager.getString("action.delete"));
+ //
+ // private JButton _duplicateButton = new JButton(
+ // MessageManager.getString("action.snapshot"));
+ //
protected JPanel _listPanel = new JPanel();
private ReorderableJList _sideList = null;
private BackupHolder _rnaList;
- /*
- * public AppVarnaBinding() { //super("VARNA in Jalview");
- * //this.set_seq("ATGC"); //this.set_str(".()."); //RNAPanelDemoInit();
- *
- * //initVarna("ATGCATGATATATATATAT","....((((...))))....");
- * initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1); }
+ /**
+ * Constructor
*/
-
- public AppVarnaBinding(String seq, String struc)
- {
- // super("VARNA in Jalview");
- initVarna(seq, struc);
-
- }
-
- public AppVarnaBinding(ArrayList<RNA> rnaList)
+ public AppVarnaBinding()
{
-
- // super("VARNA in Jalview");
- initVarnaEdit(rnaList);
+ init();
}
- private void initVarna(String seq, String str)
+ /**
+ * Constructs the VARNAPanel and an (empty) selection list of structures to
+ * show in it
+ */
+ private void init()
{
+ DefaultListModel<FullBackup> dlm = new DefaultListModel<FullBackup>();
- DefaultListModel dlm = new DefaultListModel();
+ int marginTools = 40;
DefaultListSelectionModel m = new DefaultListSelectionModel();
m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
_sideList = new ReorderableJList();
_sideList.setModel(dlm);
- _sideList.addMouseListener(this);
- _sideList.setSelectionModel(m);
- _sideList.setPreferredSize(new Dimension(100, 0));
- _sideList.addListSelectionListener(new ListSelectionListener()
+ _sideList.addMouseListener(new MouseAdapter()
{
- public void valueChanged(ListSelectionEvent arg0)
- {
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA()
- .getSize(), sel.rna.getSize());
- vp.showRNAInterpolated(sel.rna, sel.config, map);
- _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN());
- }
+ @Override
+ public void mouseClicked(MouseEvent e) {
+ AppVarnaBinding.this.mouseClicked(e);
}
});
-
- _rnaList = new BackupHolder(dlm, _sideList);
- RNA _RNA1 = new RNA("User defined 1");
-
- try
- {
-
- vp = new VARNAPanel("0", ".");
- _RNA1.setRNA(seq, str);
- _RNA1.drawRNARadiate(vp.getConfig());
- } catch (ExceptionNonEqualLength e)
- {
- vp.errorDialog(e);
- } catch (ExceptionUnmatchedClosingParentheses e2)
- {
- e2.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e3)
- {
- e3.printStackTrace();
- }
- vp.setPreferredSize(new Dimension(400, 400));
- _rnaList.add(vp.getConfig().clone(), _RNA1, generateDefaultName(), true);
-
- // TODO setBackground(_backgroundColor);
- vp.setBackground(_backgroundColor);
-
- // TODO getContentPane().setLayout(new BorderLayout());
- // TODO getContentPane().add(vp, BorderLayout.CENTER);
-
- // setVisible(true);
- vp.addVARNAListener(this);
- }
-
- private void initVarnaEdit(ArrayList<RNA> rnaInList)
- {
-
- DefaultListModel dlm = new DefaultListModel();
-
- int marginTools = 40;
-
- DefaultListSelectionModel m = new DefaultListSelectionModel();
- m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- m.setLeadAnchorNotificationEnabled(false);
-
- _sideList = new ReorderableJList();
- _sideList.setModel(dlm);
- _sideList.addMouseListener(this);
_sideList.setSelectionModel(m);
_sideList.setPreferredSize(new Dimension(100, 0));
_sideList.addListSelectionListener(new ListSelectionListener()
{
- public void valueChanged(ListSelectionEvent arg0)
+ public void valueChanged(ListSelectionEvent evt)
{
- // System.out.println(arg0);
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA()
- .getSize(), sel.rna.getSize());
- // vp.showRNAInterpolated(sel.rna, sel.config, map);
- vp.showRNA(sel.rna, sel.config);
- // _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN());
- }
+ changeSelectedStructure_actionPerformed(evt);
}
});
_rnaList = new BackupHolder(dlm, _sideList);
try
{
-
vp = new VARNAPanel("0", ".");
- for (int i = 0; i < rnaInList.size(); i++)
- {
- rnaInList.get(i).drawRNARadiate(vp.getConfig());
-
- }
} catch (ExceptionNonEqualLength e)
{
vp.errorDialog(e);
}
vp.setPreferredSize(new Dimension(400, 400));
- for (int i = 0; i < rnaInList.size(); i++)
- {
- if (i < rnaInList.size() - 1)
- {
- _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList
- .get(i).getName());
- }
- else
- {
- _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList
- .get(i).getName(), true);
- }
- }
-
- /*
- * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
- * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
- */
JScrollPane listScroller = new JScrollPane(_sideList);
listScroller.setPreferredSize(new Dimension(150, 0));
Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
- // _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- // _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- _seq.setFont(textFieldsFont);
- _seq.setText(rnaInList.get(0).getSeq());
-
- _updateButton.addActionListener(new ActionListener()
- {
- public void actionPerformed(ActionEvent e)
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- sel.rna.setSequence("A");
- }
- });
-
- // _seqPanel.setLayout(new BorderLayout());
- // _seqPanel.add(_seqLabel, BorderLayout.WEST);
- // _seqPanel.add(_seq, BorderLayout.CENTER);
-
- _strLabel.setPreferredSize(new Dimension(marginTools, 15));
- _strLabel.setHorizontalTextPosition(JLabel.LEFT);
- _str.setFont(textFieldsFont);
- _strPanel.setLayout(new BorderLayout());
- _strPanel.add(_strLabel, BorderLayout.WEST);
- _strPanel.add(_str, BorderLayout.CENTER);
-
- _input.setLayout(new GridLayout(1, 0));
- // _input.add(_seqPanel);
- _input.add(_strPanel);
-
- JPanel goPanel = new JPanel();
- goPanel.setLayout(new BorderLayout());
-
- _tools.setLayout(new BorderLayout());
- _tools.add(_input, BorderLayout.CENTER);
- // _tools.add(_info, BorderLayout.SOUTH);
- _tools.add(goPanel, BorderLayout.EAST);
-
- /*
- * _deleteButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } });
- * _duplicateButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) {
- * _rnaList.add((VARNAConfig)vp.getConfig().
- * clone(),vp.getRNA().clone(),vp.getRNA
- * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new
- * Date()),true); }});
- */
- goPanel.add(_updateButton, BorderLayout.CENTER);
-
- JPanel ops = new JPanel();
- ops.setLayout(new GridLayout(1, 2));
- ops.add(_deleteButton);
- ops.add(_duplicateButton);
+ // MC commented out stuff not added to panel - remove?
+ // _seq.setFont(textFieldsFont);
+ // if (!rnaList.isEmpty())
+ // {
+ // _seq.setText(rnaList.get(0).getSeq());
+ // }
+
+ // _updateButton.addActionListener(new ActionListener()
+ // {
+ // public void actionPerformed(ActionEvent e)
+ // {
+ // FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ // sel.rna.setSequence("A");
+ // }
+ // });
+ //
+ // _strLabel.setPreferredSize(new Dimension(marginTools, 15));
+ // _strLabel.setHorizontalTextPosition(JLabel.LEFT);
+ // _str.setFont(textFieldsFont);
+ // _strPanel.setLayout(new BorderLayout());
+ // _strPanel.add(_strLabel, BorderLayout.WEST);
+ // _strPanel.add(_str, BorderLayout.CENTER);
+ //
+ // _input.setLayout(new GridLayout(1, 0));
+ // _input.add(_strPanel);
+ //
+ // JPanel goPanel = new JPanel();
+ // goPanel.setLayout(new BorderLayout());
+ //
+ // _tools.setLayout(new BorderLayout());
+ // _tools.add(_input, BorderLayout.CENTER);
+ // _tools.add(goPanel, BorderLayout.EAST);
+ //
+ // goPanel.add(_updateButton, BorderLayout.CENTER);
+ //
+ // JPanel ops = new JPanel();
+ // ops.setLayout(new GridLayout(1, 2));
+ // ops.add(_deleteButton);
+ // ops.add(_duplicateButton);
JLabel j = new JLabel(
MessageManager.getString("label.structures_manager"),
JLabel.CENTER);
_listPanel.setLayout(new BorderLayout());
- // _listPanel.add(ops, BorderLayout.SOUTH);
_listPanel.add(j, BorderLayout.NORTH);
_listPanel.add(listScroller, BorderLayout.CENTER);
- // JSplitPane split = new
- // JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
- /**
- * TODO getContentPane().setLayout(new BorderLayout());
- * getContentPane().add(split, BorderLayout.CENTER);
- * getContentPane().add(_tools, BorderLayout.NORTH);
- */
-
- // TODO setVisible(true);
- DropTarget dt = new DropTarget(vp, this);
-
- vp.addVARNAListener(this);
- }
-
- public JPanel getTools()
- {
- return _tools;
+ new DropTarget(vp, new DropTargetAdapter() {
+ @Override
+ public void drop(DropTargetDropEvent dtde)
+ {
+ AppVarnaBinding.this.drop(dtde);
+ }
+ });
}
public JPanel getListPanel()
}
/**
- * TODO: Is it effective to transfer the whole RNA?
+ * Returns the currently selected RNA, or null if none selected
*
- * @return Currently selected RNA
+ * @return
*/
public RNA getSelectedRNA()
{
- return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna;
+ int selectedIndex = _sideList.getSelectedIndex();
+ if (selectedIndex < 0)
+ {
+ return null;
+ }
+ FullBackup selected = _rnaList.getElementAt(selectedIndex);
+ return selected.rna;
}
/**
vp.showRNA(rnaEdit);
}
- /*
- * private void RNAPanelDemoInit() { DefaultListModel dlm = new
- * DefaultListModel();
- *
- *
- * int marginTools = 40;
- *
- * DefaultListSelectionModel m = new DefaultListSelectionModel();
- * m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- * m.setLeadAnchorNotificationEnabled(false);
- *
- *
- * _sideList = new ReorderableJList(); _sideList.setModel(dlm);
- * _sideList.addMouseListener(this); _sideList.setSelectionModel(m);
- * _sideList.setPreferredSize(new Dimension(100, 0));
- * _sideList.addListSelectionListener( new ListSelectionListener(){ public
- * void valueChanged(ListSelectionEvent arg0) { //System.out.println(arg0); if
- * (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup
- * sel = (FullBackup) _sideList.getSelectedValue(); Mapping map =
- * Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
- * vp.showRNAInterpolated(sel.rna,sel.config,map);
- * _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } }
- * });
- *
- * _rnaList = new BackupHolder(dlm,_sideList); RNA _RNA1 = new
- * RNA("User defined 1"); RNA _RNA2 = new RNA("User defined 2"); try { vp =
- * new VARNAPanel("0","."); _RNA1.setRNA(DEFAULT_SEQUENCE,
- * DEFAULT_STRUCTURE1); _RNA1.drawRNARadiate(vp.getConfig());
- * _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
- * _RNA2.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) {
- * vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) {
- * e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) {
- * e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400));
- * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
- * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
- *
- * JScrollPane listScroller = new JScrollPane(_sideList);
- * listScroller.setPreferredSize(new Dimension(150, 0));
- *
- * setBackground(_backgroundColor); vp.setBackground(_backgroundColor);
- *
- *
- * Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
- *
- * _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- * _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- * _seq.setFont(textFieldsFont); _seq.setText(DEFAULT_SEQUENCE);
- *
- * _createButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { try { RNA nRNA = new
- * RNA(generateDefaultName()); nRNA.setRNA(_seq.getText(), _str.getText());
- * nRNA.drawRNARadiate(vp.getConfig()); _rnaList.add(new
- * VARNAConfig(),nRNA,true); } catch (ExceptionUnmatchedClosingParentheses e1)
- * { JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error",
- * JOptionPane.ERROR_MESSAGE); } catch (ExceptionFileFormatOrSyntax e1) {
- * JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error",
- * JOptionPane.ERROR_MESSAGE); } } });
- *
- *
- * _seqPanel.setLayout(new BorderLayout()); _seqPanel.add(_seqLabel,
- * BorderLayout.WEST); _seqPanel.add(_seq, BorderLayout.CENTER);
- *
- * _strLabel.setPreferredSize(new Dimension(marginTools, 15));
- * _strLabel.setHorizontalTextPosition(JLabel.LEFT);
- * _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout());
- * _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str,
- * BorderLayout.CENTER);
- *
- * _input.setLayout(new GridLayout(2, 0)); _input.add(_seqPanel);
- * _input.add(_strPanel);
- *
- * JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout());
- *
- * _tools.setLayout(new BorderLayout()); _tools.add(_input,
- * BorderLayout.CENTER); _tools.add(_info, BorderLayout.SOUTH);
- * _tools.add(goPanel, BorderLayout.EAST);
- *
- * _deleteButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } });
- * _duplicateButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) {
- * _rnaList.add((VARNAConfig)vp.getConfig().clone
- * (),vp.getRNA().clone(),vp.getRNA
- * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new
- * Date()),true); }});
- *
- * JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1,2));
- * ops.add(_deleteButton); ops.add(_duplicateButton);
- *
- * JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
- * _listPanel.setLayout(new BorderLayout());
- *
- * _listPanel.add(ops,BorderLayout.SOUTH);
- * _listPanel.add(j,BorderLayout.NORTH);
- * _listPanel.add(listScroller,BorderLayout.CENTER);
- *
- * goPanel.add(_createButton, BorderLayout.CENTER);
- *
- * JSplitPane split = new
- * JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
- * getContentPane().setLayout(new BorderLayout()); getContentPane().add(split,
- * BorderLayout.CENTER); getContentPane().add(_tools, BorderLayout.NORTH);
- *
- * setVisible(true); DropTarget dt = new DropTarget(vp, this);
- *
- * vp.addVARNAListener(this); }
- */
public static String generateDefaultName()
{
return "User file #" + _nextID++;
}
- public RNA getRNA()
- {
- return (RNA) _sideList.getSelectedValue();
- }
-
public String[][] getParameterInfo()
{
String[][] info =
return info;
}
- public void init()
- {
- vp.setBackground(_backgroundColor);
- _error = true;
- }
-
@SuppressWarnings("unused")
private Color getSafeColor(String col, Color def)
{
vp = surface;
}
- public String get_seq()
- {
- return _seq.getText();
- }
-
- public void set_seq(String _seq)
- {
- this._seq.setText(_seq);
- }
-
- public String get_str()
- {
- return _str.getText();
- }
-
- public void set_str(String _str)
- {
- this._str.setText(_str);
- }
-
- public JLabel get_info()
- {
- return _info;
- }
-
- public void set_info(JLabel _info)
- {
- this._info = _info;
- }
-
- /*
- * public static void main(String[] args) { AppVarnaBinding d = new
- * AppVarnaBinding(); d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- * d.pack(); d.setVisible(true); }
- */
-
- public void dragEnter(DropTargetDragEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
- public void dragExit(DropTargetEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
- public void dragOver(DropTargetDragEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
public void drop(DropTargetDropEvent dtde)
{
try
if (c instanceof VARNAPanel)
{
String path = o.toString();
- VARNAPanel vp = (VARNAPanel) c;
+ VARNAPanel varnaPanel = (VARNAPanel) c;
try
{
FullBackup bck = VARNAPanel.importSession(path);
.loadSecStr(path);
for (RNA r : mdls)
{
- r.drawRNA(vp.getConfig());
+ r.drawRNA(varnaPanel.getConfig());
String name = r.getName();
if (name.equals(""))
{
{
name += " (Model " + mn++ + ")";
}
- _rnaList.add(vp.getConfig().clone(), r, name, true);
+ _rnaList.add(varnaPanel.getConfig().clone(), r, name, true);
}
}
}
}
- public void dropActionChanged(DropTargetDragEvent arg0)
- {
- }
-
private class BackupHolder
{
- private DefaultListModel _rnaList;
+ private DefaultListModel<FullBackup> _rnalist;
- private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+ private List<RNA> _rnas = new ArrayList<RNA>();
JList _l;
- public BackupHolder(DefaultListModel rnaList, JList l)
+ public BackupHolder(DefaultListModel<FullBackup> rnaList, JList l)
{
- _rnaList = rnaList;
+ _rnalist = rnaList;
_l = l;
}
- public void add(VARNAConfig c, RNA r)
- {
- add(c, r, r.getName(), false);
- }
-
- public void add(VARNAConfig c, RNA r, boolean select)
- {
- add(c, r, r.getName(), select);
- }
-
public void add(VARNAConfig c, RNA r, String name)
{
add(c, r, name, false);
}
+ /**
+ * Adds an entry to the end of the selection list and (optionally) sets it
+ * as selected
+ *
+ * @param c
+ * @param r
+ * @param name
+ * @param select
+ */
public void add(VARNAConfig c, RNA r, String name, boolean select)
{
if (select)
{
- _l.removeSelectionInterval(0, _rnaList.size());
+ _l.removeSelectionInterval(0, _rnalist.size());
}
if (name.equals(""))
{
name = generateDefaultName();
}
FullBackup bck = new FullBackup(c, r, name);
- _rnas.add(0, r);
- _rnaList.add(0, bck);
+ _rnas.add(r);
+ _rnalist.addElement(bck);
if (select)
{
_l.setSelectedIndex(0);
}
}
- public void remove(int i)
- {
- _rnas.remove(i);
- _rnaList.remove(i);
-
- }
-
- public DefaultListModel getModel()
- {
- return _rnaList;
- }
-
- public boolean contains(RNA r)
- {
- return _rnas.contains(r);
- }
-
- /*
- * public int getSize() { return _rnaList.getSize(); }
- */
public FullBackup getElementAt(int i)
{
- return (FullBackup) _rnaList.getElementAt(i);
- }
-
- public void removeSelected()
- {
- int i = _l.getSelectedIndex();
- if (i != -1)
- {
- if (_rnaList.getSize() == 1)
- {
- RNA r = new RNA();
- try
- {
- r.setRNA(" ", ".");
- } catch (ExceptionUnmatchedClosingParentheses e1)
- {
- } catch (ExceptionFileFormatOrSyntax e1)
- {
- }
- vp.showRNA(r);
- vp.repaint();
- }
- else
- {
- int newi = i + 1;
- if (newi == _rnaList.getSize())
- {
- newi = _rnaList.getSize() - 2;
- }
- FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
- _l.setSelectedValue(bck, true);
- }
- _rnaList.remove(i);
- }
-
+ return _rnalist.getElementAt(i);
}
}
- public void onLayoutChanged()
- {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r)
- {
- // patch to fix infinite loop
- // The problem is that onUINewStructure is called when user clicks
- // check with Yann about whether Jalview should do anything with this event.
- // e.g. if user has used VARNA's menu to import a structure .. Jalview may
- // need to be told which structure is displayed.
-
- // _rnaList.add(v, r, "", true);
- }
-
- public void onWarningEmitted(String s)
- {
- }
-
public void mouseClicked(MouseEvent e)
{
if (e.getClickCount() == 2)
{
int index = _sideList.locationToIndex(e.getPoint());
- ListModel dlm = _sideList.getModel();
- FullBackup item = (FullBackup) dlm.getElementAt(index);
- ;
+ ListModel<FullBackup> dlm = _sideList.getModel();
+ // FullBackup item = dlm.getElementAt(index);
+
_sideList.ensureIndexIsVisible(index);
/*
* TODO Object newName = JOptionPane.showInputDialog( this,
}
}
- public void mouseEntered(MouseEvent arg0)
- {
- }
-
- public void mouseExited(MouseEvent arg0)
- {
- }
-
- public void mousePressed(MouseEvent arg0)
- {
- }
-
- public void mouseReleased(MouseEvent arg0)
- {
- }
-
@Override
public String[] getPdbFile()
{
}
@Override
- public void onStructureRedrawn()
+ public void highlightAtoms(List<AtomSpec> atoms)
{
}
@Override
- public void onZoomLevelChanged()
+ public boolean isListeningFor(SequenceI seq)
{
+ return true;
}
- @Override
- public void onTranslationChanged()
+ /**
+ * Returns the path to a temporary file containing a representation of the
+ * state of the Varna display, or null on any error
+ *
+ * @param rna
+ * @param jds
+ *
+ * @return
+ */
+ public String getStateInfo(RNA rna)
{
+ if (vp == null)
+ {
+ return null;
+ }
+
+ /*
+ * we have to show the RNA we want to save in the viewer; get the currently
+ * displayed model first so we can restore it
+ */
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+
+ FullBackup model = null;
+ ListModel models = _sideList.getModel();
+ for (int i = 0; i < models.getSize(); i++)
+ {
+ model = (FullBackup) models.getElementAt(i);
+ if (model.rna == rna)
+ {
+ break;
+ }
+ }
+ if (model == null)
+ {
+ return null;
+ }
+
+ /*
+ * switch display if not already shown
+ */
+ if (sel.rna != rna)
+ {
+ vp.showRNA(model.rna, model.config);
+ }
+
+ try
+ {
+ File temp;
+ temp = File.createTempFile("varna", null);
+ temp.deleteOnExit();
+ String filePath = temp.getAbsolutePath();
+ vp.toXML(filePath);
+
+ /*
+ * restore the previous display if needed
+ */
+ if (sel.rna != rna)
+ {
+ vp.showRNA(sel.rna, sel.config);
+ }
+
+ return filePath;
+ } catch (IOException e)
+ {
+ return null;
+ }
}
- @Override
- public void highlightAtoms(List<AtomSpec> atoms)
+ public int getSelectedIndex()
{
+ return _sideList.getSelectedIndex();
}
- @Override
- public boolean isListeningFor(SequenceI seq)
+ /**
+ * Switch the Varna display to the structure selected in the left hand panel
+ *
+ * @param evt
+ */
+ protected void changeSelectedStructure_actionPerformed(ListSelectionEvent evt)
{
- return true;
+ if (!evt.getValueIsAdjusting())
+ {
+ showSelectedStructure();
+ }
+ }
+
+ /**
+ *
+ */
+ protected void showSelectedStructure()
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ if (sel != null)
+ {
+ vp.showRNA(sel.rna, sel.config);
+ }
+ }
+
+ /**
+ * Set and display the selected item in the list of structures
+ *
+ * @param selectedRna
+ */
+ public void setSelectedIndex(int selectedRna)
+ {
+ /*
+ * note this does nothing if, say, selecting item 3 when only 1 has been
+ * added on load
+ */
+ _sideList.setSelectedIndex(selectedRna);
+ // TODO ? need a worker thread to get this to happen properly
+ showSelectedStructure();
+ }
+
+ /**
+ * Add an RNA structure to the selection list
+ *
+ * @param rna
+ */
+ public void addStructure(RNA rna)
+ {
+ VARNAConfig config = vp.getConfig().clone();
+ addStructure(rna, config);
+ }
+
+ /**
+ * @param rna
+ * @param config
+ */
+ protected void addStructure(RNA rna, VARNAConfig config)
+ {
+ rna.drawRNARadiate(config);
+ _rnaList.add(config, rna, rna.getName());
}
}
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.PDBEntry;
+import jalview.datamodel.RnaViewerModel;
+import jalview.datamodel.SequenceGroup;
import jalview.datamodel.SequenceI;
import jalview.datamodel.StructureViewerModel;
import jalview.datamodel.StructureViewerModel.StructureData;
+import jalview.ext.varna.RnaModel;
import jalview.gui.StructureViewer.ViewerType;
import jalview.schemabinding.version2.AlcodMap;
import jalview.schemabinding.version2.AlcodonFrame;
import jalview.schemabinding.version2.PdbentryItem;
import jalview.schemabinding.version2.Pdbids;
import jalview.schemabinding.version2.Property;
+import jalview.schemabinding.version2.RnaViewer;
+import jalview.schemabinding.version2.SecondaryStructure;
import jalview.schemabinding.version2.Sequence;
import jalview.schemabinding.version2.SequenceSet;
import jalview.schemabinding.version2.SequenceSetProperties;
*/
public class Jalview2XML
{
+ private static final String VIEWER_PREFIX = "viewer_";
+
+ private static final String RNA_PREFIX = "rna_";
+
private static final String UTF_8 = "UTF-8";
+ // use this with nextCounter() to make unique names for entities
+ private int counter = 0;
+
/*
* SequenceI reference -> XML ID string in jalview XML. Populated as XML reps
* of sequence objects are created.
*/
private Map<Viewport, AlignFrame> splitFrameCandidates = new HashMap<Viewport, AlignFrame>();
+ /*
+ * Map from displayed rna structure models to their saved session state jar
+ * entry names
+ */
+ private Map<RnaModel, String> rnaSessions = new HashMap<RnaModel, String>();
+
/**
* create/return unique hash string for sq
*
*/
public void saveState(JarOutputStream jout)
{
- AlignFrame[] frames = Desktop.getAlignFrames(); // Desktop.desktop.getAllFrames();
+ AlignFrame[] frames = Desktop.getAlignFrames();
if (frames == null)
{
Hashtable<String, AlignFrame> dsses = new Hashtable<String, AlignFrame>();
+ /*
+ * ensure cached data is clear before starting
+ */
+ // todo tidy up seqRefIds, seqsToIds initialisation / reset
+ rnaSessions.clear();
+ splitFrameCandidates.clear();
+
try
{
// //////////////////////////////////////////////////
List<String> shortNames = new ArrayList<String>();
+ List<String> viewIds = new ArrayList<String>();
// REVERSE ORDER
for (int i = frames.length - 1; i > -1; i--)
fileName = fileName + ".xml";
}
- saveState(apanel, fileName, jout);
+ saveState(apanel, fileName, jout, viewIds);
String dssid = getDatasetIdRef(af.getViewport().getAlignment()
.getDataset());
FileOutputStream fos = new FileOutputStream(jarFile);
JarOutputStream jout = new JarOutputStream(fos);
Hashtable<String, AlignFrame> dsses = new Hashtable<String, AlignFrame>();
+ List<String> viewIds = new ArrayList<String>();
+
for (AlignmentPanel apanel : af.alignPanels)
{
String jfileName = apSize == 1 ? fileName : fileName + ap;
{
jfileName = jfileName + ".xml";
}
- saveState(apanel, jfileName, jout);
+ saveState(apanel, jfileName, jout, viewIds);
String dssid = getDatasetIdRef(af.getViewport().getAlignment()
.getDataset());
if (!dsses.containsKey(dssid))
{
jfileName = jfileName + ".xml";
}
- saveState(_af.alignPanel, jfileName, true, jout);
+ saveState(_af.alignPanel, jfileName, true, jout, null);
}
}
* name of alignment panel written to output stream
* @param jout
* jar output stream
+ * @param viewIds
* @param out
* jar entry name
*/
public JalviewModel saveState(AlignmentPanel ap, String fileName,
- JarOutputStream jout)
+ JarOutputStream jout, List<String> viewIds)
{
- return saveState(ap, fileName, false, jout);
+ return saveState(ap, fileName, false, jout, viewIds);
}
/**
* jar entry name
*/
public JalviewModel saveState(AlignmentPanel ap, String fileName,
- boolean storeDS, JarOutputStream jout)
+ boolean storeDS, JarOutputStream jout, List<String> viewIds)
{
+ if (viewIds == null)
+ {
+ viewIds = new ArrayList<String>();
+ }
+
initSeqRefs();
- List<String> viewIds = new ArrayList<String>();
+
List<UserColourScheme> userColours = new ArrayList<UserColourScheme>();
AlignViewport av = ap.av;
Set<String> calcIdSet = new HashSet<String>();
// SAVE SEQUENCES
- String id = "";
- jalview.datamodel.SequenceI jds, jdatasq;
for (int i = 0; i < jal.getHeight(); i++)
{
- jds = jal.getSequenceAt(i);
- jdatasq = jds.getDatasetSequence() == null ? jds : jds
+ final SequenceI jds = jal.getSequenceAt(i);
+ final SequenceI jdatasq = jds.getDatasetSequence() == null ? jds
+ : jds
.getDatasetSequence();
- id = seqHash(jds);
+ String id = seqHash(jds);
if (seqRefIds.get(id) != null)
{
matchedFile = saveStructureState(ap, jds, pdb, entry,
viewIds, matchedFile, viewFrame);
/*
- * Only store each structure viewer's state once in each XML
- * document. First time through only (storeDS==false)
+ * Only store each structure viewer's state once in the project
+ * jar. First time through only (storeDS==false)
*/
String viewId = viewFrame.getViewId();
if (!storeDS && !viewIds.contains(viewId))
viewIds.add(viewId);
try
{
+ String viewerState = viewFrame.getStateInfo();
writeJarEntry(jout, getViewerJarEntryName(viewId),
- viewFrame.getStateInfo().getBytes());
+ viewerState.getBytes());
} catch (IOException e)
{
System.err.println("Error saving viewer state: "
}
}
+ saveRnaViewers(jout, jseq, jds, viewIds, storeDS);
+
jms.addJSeq(jseq);
}
}
}
- /*
- * Save associated Varna panels
- */
- if (Desktop.desktop != null)
- {
- for (JInternalFrame frame : Desktop.desktop.getAllFrames())
- {
- if (frame instanceof AppVarna)
- {
- AppVarna vp = (AppVarna) frame;
- if (vp.ap == ap)
- {
- // save Varna state
- }
- }
- }
- }
-
// SAVE ANNOTATIONS
/**
* store forward refs from an annotationRow to any groups
*/
- IdentityHashMap groupRefs = new IdentityHashMap();
+ IdentityHashMap<SequenceGroup, String> groupRefs = new IdentityHashMap<SequenceGroup, String>();
if (storeDS)
{
for (SequenceI sq : jal.getSequences())
{
// Store annotation on dataset sequences only
- jalview.datamodel.AlignmentAnnotation[] aa = sq.getAnnotation();
+ AlignmentAnnotation[] aa = sq.getAnnotation();
if (aa != null && aa.length > 0)
{
storeAlignmentAnnotation(aa, groupRefs, av, calcIdSet, storeDS,
if (jal.getAlignmentAnnotation() != null)
{
// Store the annotation shown on the alignment.
- jalview.datamodel.AlignmentAnnotation[] aa = jal
- .getAlignmentAnnotation();
+ AlignmentAnnotation[] aa = jal.getAlignmentAnnotation();
storeAlignmentAnnotation(aa, groupRefs, av, calcIdSet, storeDS,
vamsasSet);
}
int i = -1;
for (jalview.datamodel.SequenceGroup sg : jal.getGroups())
{
- groups[++i] = new JGroup();
+ JGroup jGroup = new JGroup();
+ groups[++i] = jGroup;
- groups[i].setStart(sg.getStartRes());
- groups[i].setEnd(sg.getEndRes());
- groups[i].setName(sg.getName());
+ jGroup.setStart(sg.getStartRes());
+ jGroup.setEnd(sg.getEndRes());
+ jGroup.setName(sg.getName());
if (groupRefs.containsKey(sg))
{
- // group has references so set it's ID field
- groups[i].setId(groupRefs.get(sg).toString());
+ // group has references so set its ID field
+ jGroup.setId(groupRefs.get(sg));
}
if (sg.cs != null)
{
if (sg.cs.conservationApplied())
{
- groups[i].setConsThreshold(sg.cs.getConservationInc());
+ jGroup.setConsThreshold(sg.cs.getConservationInc());
if (sg.cs instanceof jalview.schemes.UserColourScheme)
{
- groups[i].setColour(setUserColourScheme(sg.cs, userColours,
+ jGroup.setColour(setUserColourScheme(sg.cs, userColours,
jms));
}
else
{
- groups[i]
+ jGroup
.setColour(ColourSchemeProperty.getColourName(sg.cs));
}
}
else if (sg.cs instanceof jalview.schemes.AnnotationColourGradient)
{
- groups[i].setColour("AnnotationColourGradient");
- groups[i].setAnnotationColours(constructAnnotationColours(
+ jGroup.setColour("AnnotationColourGradient");
+ jGroup.setAnnotationColours(constructAnnotationColours(
(jalview.schemes.AnnotationColourGradient) sg.cs,
userColours, jms));
}
else if (sg.cs instanceof jalview.schemes.UserColourScheme)
{
- groups[i]
+ jGroup
.setColour(setUserColourScheme(sg.cs, userColours, jms));
}
else
{
- groups[i].setColour(ColourSchemeProperty.getColourName(sg.cs));
+ jGroup.setColour(ColourSchemeProperty.getColourName(sg.cs));
}
- groups[i].setPidThreshold(sg.cs.getThreshold());
+ jGroup.setPidThreshold(sg.cs.getThreshold());
}
- groups[i].setOutlineColour(sg.getOutlineColour().getRGB());
- groups[i].setDisplayBoxes(sg.getDisplayBoxes());
- groups[i].setDisplayText(sg.getDisplayText());
- groups[i].setColourText(sg.getColourText());
- groups[i].setTextCol1(sg.textColour.getRGB());
- groups[i].setTextCol2(sg.textColour2.getRGB());
- groups[i].setTextColThreshold(sg.thresholdTextColour);
- groups[i].setShowUnconserved(sg.getShowNonconserved());
- groups[i].setIgnoreGapsinConsensus(sg.getIgnoreGapsConsensus());
- groups[i].setShowConsensusHistogram(sg.isShowConsensusHistogram());
- groups[i].setShowSequenceLogo(sg.isShowSequenceLogo());
- groups[i].setNormaliseSequenceLogo(sg.isNormaliseSequenceLogo());
- for (int s = 0; s < sg.getSize(); s++)
- {
- jalview.datamodel.Sequence seq = (jalview.datamodel.Sequence) sg
- .getSequenceAt(s);
- groups[i].addSeq(seqHash(seq));
+ jGroup.setOutlineColour(sg.getOutlineColour().getRGB());
+ jGroup.setDisplayBoxes(sg.getDisplayBoxes());
+ jGroup.setDisplayText(sg.getDisplayText());
+ jGroup.setColourText(sg.getColourText());
+ jGroup.setTextCol1(sg.textColour.getRGB());
+ jGroup.setTextCol2(sg.textColour2.getRGB());
+ jGroup.setTextColThreshold(sg.thresholdTextColour);
+ jGroup.setShowUnconserved(sg.getShowNonconserved());
+ jGroup.setIgnoreGapsinConsensus(sg.getIgnoreGapsConsensus());
+ jGroup.setShowConsensusHistogram(sg.isShowConsensusHistogram());
+ jGroup.setShowSequenceLogo(sg.isShowSequenceLogo());
+ jGroup.setNormaliseSequenceLogo(sg.isNormaliseSequenceLogo());
+ for (SequenceI seq : sg.getSequences())
+ {
+ jGroup.addSeq(seqHash(seq));
}
}
// using save and then load
try
{
+ System.out.println("Writing jar entry " + fileName);
JarEntry entry = new JarEntry(fileName);
jout.putNextEntry(entry);
PrintWriter pout = new PrintWriter(new OutputStreamWriter(jout,
}
/**
- * Copy the contents of a file to a new file added to the output jar
+ * Save any Varna viewers linked to this sequence. Writes an rnaViewer element
+ * for each viewer, with
+ * <ul>
+ * <li>viewer geometry (position, size, split pane divider location)</li>
+ * <li>index of the selected structure in the viewer (currently shows gapped
+ * or ungapped)</li>
+ * <li>the id of the annotation holding RNA secondary structure</li>
+ * <li>(currently only one SS is shown per viewer, may be more in future)</li>
+ * </ul>
+ * Varna viewer state is also written out (in native Varna XML) to separate
+ * project jar entries. A separate entry is written for each RNA structure
+ * displayed, with the naming convention
+ * <ul>
+ * <li>rna_viewId_sequenceId_annotationId_[gapped|trimmed]</li>
+ * </ul>
+ *
+ * @param jout
+ * @param jseq
+ * @param jds
+ * @param viewIds
+ * @param storeDataset
+ */
+ protected void saveRnaViewers(JarOutputStream jout, JSeq jseq,
+ final SequenceI jds, List<String> viewIds, boolean storeDataset)
+ {
+ JInternalFrame[] frames = Desktop.desktop.getAllFrames();
+ for (int f = frames.length - 1; f > -1; f--)
+ {
+ if (frames[f] instanceof AppVarna)
+ {
+ AppVarna varna = (AppVarna) frames[f];
+ if (varna.isListeningFor(jds))
+ {
+ /*
+ * link the sequence to every viewer that is showing it
+ */
+ String viewId = varna.getViewId();
+ RnaViewer rna = new RnaViewer();
+ rna.setViewId(viewId);
+ rna.setTitle(varna.getTitle());
+ rna.setXpos(varna.getX());
+ rna.setYpos(varna.getY());
+ rna.setWidth(varna.getWidth());
+ rna.setHeight(varna.getHeight());
+ rna.setDividerLocation(varna.getDividerLocation());
+ rna.setSelectedRna(varna.getSelectedIndex());
+ jseq.addRnaViewer(rna);
+
+ /*
+ * Store each Varna panel's state once in the project per sequence.
+ * First time through only (storeDataset==false)
+ */
+ // boolean storeSessions = false;
+ // String sequenceViewId = viewId + seqsToIds.get(jds);
+ // if (!storeDataset && !viewIds.contains(sequenceViewId))
+ // {
+ // viewIds.add(sequenceViewId);
+ // storeSessions = true;
+ // }
+ for (RnaModel model : varna.getModels())
+ {
+ if (model.seq == jds)
+ {
+ /*
+ * VARNA saves each view (sequence or alignment secondary
+ * structure, gapped or trimmed) as a separate XML file
+ */
+ String jarEntryName = rnaSessions.get(model);
+ if (jarEntryName == null)
+ {
+
+ String varnaStateFile = varna.getStateInfo(model.rna);
+ jarEntryName = RNA_PREFIX + viewId + "_"
+ + nextCounter();
+ copyFileToJar(jout, varnaStateFile, jarEntryName);
+ rnaSessions.put(model, jarEntryName);
+ }
+ SecondaryStructure ss = new SecondaryStructure();
+ String annotationId = varna.getAnnotation(jds).annotationId;
+ ss.setAnnotationId(annotationId);
+ ss.setViewerState(jarEntryName);
+ ss.setGapped(model.gapped);
+ ss.setTitle(model.title);
+ rna.addSecondaryStructure(ss);
+ }
+ }
+ }
+ }
+ }
+ }
+
+ /**
+ * Copy the contents of a file to a new entry added to the output jar
*
* @param jout
* @param infilePath
- * @param jarfileName
+ * @param jarEntryName
*/
protected void copyFileToJar(JarOutputStream jout, String infilePath,
- String jarfileName)
+ String jarEntryName)
{
DataInputStream dis = null;
try
dis = new DataInputStream(new FileInputStream(file));
byte[] data = new byte[(int) file.length()];
dis.readFully(data);
- writeJarEntry(jout, jarfileName, data);
+ writeJarEntry(jout, jarEntryName, data);
}
} catch (Exception ex)
{
* Write the data to a new entry of given name in the output jar file
*
* @param jout
- * @param jarfileName
+ * @param jarEntryName
* @param data
* @throws IOException
*/
- protected void writeJarEntry(JarOutputStream jout, String jarfileName,
+ protected void writeJarEntry(JarOutputStream jout, String jarEntryName,
byte[] data) throws IOException
{
if (jout != null)
{
- jout.putNextEntry(new JarEntry(jarfileName));
+ System.out.println("Writing jar entry " + jarEntryName);
+ jout.putNextEntry(new JarEntry(jarEntryName));
DataOutputStream dout = new DataOutputStream(jout);
dout.write(data, 0, data.length);
dout.flush();
}
private void storeAlignmentAnnotation(AlignmentAnnotation[] aa,
- IdentityHashMap groupRefs, AlignmentViewport av,
+ IdentityHashMap<SequenceGroup, String> groupRefs,
+ AlignmentViewport av,
Set<String> calcIdSet, boolean storeDS, SequenceSet vamsasSet)
{
{
Annotation an = new Annotation();
- if (aa[i].annotationId != null)
+ AlignmentAnnotation annotation = aa[i];
+ if (annotation.annotationId != null)
{
- annotationIds.put(aa[i].annotationId, aa[i]);
+ annotationIds.put(annotation.annotationId, annotation);
}
- an.setId(aa[i].annotationId);
+ an.setId(annotation.annotationId);
- an.setVisible(aa[i].visible);
+ an.setVisible(annotation.visible);
- an.setDescription(aa[i].description);
+ an.setDescription(annotation.description);
- if (aa[i].sequenceRef != null)
+ if (annotation.sequenceRef != null)
{
// 2.9 JAL-1781 xref on sequence id rather than name
- an.setSequenceRef(seqsToIds.get(aa[i].sequenceRef));
+ an.setSequenceRef(seqsToIds.get(annotation.sequenceRef));
}
- if (aa[i].groupRef != null)
+ if (annotation.groupRef != null)
{
- Object groupIdr = groupRefs.get(aa[i].groupRef);
+ String groupIdr = groupRefs.get(annotation.groupRef);
if (groupIdr == null)
{
// make a locally unique String
- groupRefs.put(aa[i].groupRef,
+ groupRefs.put(annotation.groupRef,
groupIdr = ("" + System.currentTimeMillis()
- + aa[i].groupRef.getName() + groupRefs.size()));
+ + annotation.groupRef.getName() + groupRefs.size()));
}
an.setGroupRef(groupIdr.toString());
}
// store all visualization attributes for annotation
- an.setGraphHeight(aa[i].graphHeight);
- an.setCentreColLabels(aa[i].centreColLabels);
- an.setScaleColLabels(aa[i].scaleColLabel);
- an.setShowAllColLabels(aa[i].showAllColLabels);
- an.setBelowAlignment(aa[i].belowAlignment);
+ an.setGraphHeight(annotation.graphHeight);
+ an.setCentreColLabels(annotation.centreColLabels);
+ an.setScaleColLabels(annotation.scaleColLabel);
+ an.setShowAllColLabels(annotation.showAllColLabels);
+ an.setBelowAlignment(annotation.belowAlignment);
- if (aa[i].graph > 0)
+ if (annotation.graph > 0)
{
an.setGraph(true);
- an.setGraphType(aa[i].graph);
- an.setGraphGroup(aa[i].graphGroup);
- if (aa[i].getThreshold() != null)
+ an.setGraphType(annotation.graph);
+ an.setGraphGroup(annotation.graphGroup);
+ if (annotation.getThreshold() != null)
{
ThresholdLine line = new ThresholdLine();
- line.setLabel(aa[i].getThreshold().label);
- line.setValue(aa[i].getThreshold().value);
- line.setColour(aa[i].getThreshold().colour.getRGB());
+ line.setLabel(annotation.getThreshold().label);
+ line.setValue(annotation.getThreshold().value);
+ line.setColour(annotation.getThreshold().colour.getRGB());
an.setThresholdLine(line);
}
}
an.setGraph(false);
}
- an.setLabel(aa[i].label);
+ an.setLabel(annotation.label);
- if (aa[i] == av.getAlignmentQualityAnnot()
- || aa[i] == av.getAlignmentConservationAnnotation()
- || aa[i] == av.getAlignmentConsensusAnnotation()
- || aa[i].autoCalculated)
+ if (annotation == av.getAlignmentQualityAnnot()
+ || annotation == av.getAlignmentConservationAnnotation()
+ || annotation == av.getAlignmentConsensusAnnotation()
+ || annotation.autoCalculated)
{
// new way of indicating autocalculated annotation -
- an.setAutoCalculated(aa[i].autoCalculated);
+ an.setAutoCalculated(annotation.autoCalculated);
}
- if (aa[i].hasScore())
+ if (annotation.hasScore())
{
- an.setScore(aa[i].getScore());
+ an.setScore(annotation.getScore());
}
- if (aa[i].getCalcId() != null)
+ if (annotation.getCalcId() != null)
{
- calcIdSet.add(aa[i].getCalcId());
- an.setCalcId(aa[i].getCalcId());
+ calcIdSet.add(annotation.getCalcId());
+ an.setCalcId(annotation.getCalcId());
}
- if (aa[i].hasProperties())
+ if (annotation.hasProperties())
{
- for (String pr : aa[i].getProperties())
+ for (String pr : annotation.getProperties())
{
Property prop = new Property();
prop.setName(pr);
- prop.setValue(aa[i].getProperty(pr));
+ prop.setValue(annotation.getProperty(pr));
an.addProperty(prop);
}
}
AnnotationElement ae;
- if (aa[i].annotations != null)
+ if (annotation.annotations != null)
{
an.setScoreOnly(false);
- for (int a = 0; a < aa[i].annotations.length; a++)
+ for (int a = 0; a < annotation.annotations.length; a++)
{
- if ((aa[i] == null) || (aa[i].annotations[a] == null))
+ if ((annotation == null) || (annotation.annotations[a] == null))
{
continue;
}
ae = new AnnotationElement();
- if (aa[i].annotations[a].description != null)
+ if (annotation.annotations[a].description != null)
{
- ae.setDescription(aa[i].annotations[a].description);
+ ae.setDescription(annotation.annotations[a].description);
}
- if (aa[i].annotations[a].displayCharacter != null)
+ if (annotation.annotations[a].displayCharacter != null)
{
- ae.setDisplayCharacter(aa[i].annotations[a].displayCharacter);
+ ae.setDisplayCharacter(annotation.annotations[a].displayCharacter);
}
- if (!Float.isNaN(aa[i].annotations[a].value))
+ if (!Float.isNaN(annotation.annotations[a].value))
{
- ae.setValue(aa[i].annotations[a].value);
+ ae.setValue(annotation.annotations[a].value);
}
ae.setPosition(a);
- if (aa[i].annotations[a].secondaryStructure > ' ')
+ if (annotation.annotations[a].secondaryStructure > ' ')
{
- ae.setSecondaryStructure(aa[i].annotations[a].secondaryStructure
+ ae.setSecondaryStructure(annotation.annotations[a].secondaryStructure
+ "");
}
- if (aa[i].annotations[a].colour != null
- && aa[i].annotations[a].colour != java.awt.Color.black)
+ if (annotation.annotations[a].colour != null
+ && annotation.annotations[a].colour != java.awt.Color.black)
{
- ae.setColour(aa[i].annotations[a].colour.getRGB());
+ ae.setColour(annotation.annotations[a].colour.getRGB());
}
an.addAnnotationElement(ae);
- if (aa[i].autoCalculated)
+ if (annotation.autoCalculated)
{
// only write one non-null entry into the annotation row -
// sufficient to get the visualization attributes necessary to
{
an.setScoreOnly(true);
}
- if (!storeDS || (storeDS && !aa[i].autoCalculated))
+ if (!storeDS || (storeDS && !annotation.autoCalculated))
{
// skip autocalculated annotation - these are only provided for
// alignments
}
} while (jarentry != null);
resolveFrefedSequences();
- } catch (java.io.FileNotFoundException ex)
- {
- ex.printStackTrace();
- errorMessage = "Couldn't locate Jalview XML file : " + file;
- System.err.println("Exception whilst loading jalview XML file : "
- + ex + "\n");
- } catch (java.net.UnknownHostException ex)
+ } catch (IOException ex)
{
ex.printStackTrace();
errorMessage = "Couldn't locate Jalview XML file : " + file;
// ////////////////////////////////
// LOAD ANNOTATIONS
List<JvAnnotRow> autoAlan = new ArrayList<JvAnnotRow>();
- /**
+
+ /*
* store any annotations which forward reference a group's ID
*/
- Hashtable<String, ArrayList<jalview.datamodel.AlignmentAnnotation>> groupAnnotRefs = new Hashtable<String, ArrayList<jalview.datamodel.AlignmentAnnotation>>();
+ Map<String, List<AlignmentAnnotation>> groupAnnotRefs = new Hashtable<String, List<AlignmentAnnotation>>();
if (vamsasSet.getAnnotationCount() > 0)
{
for (int i = 0; i < an.length; i++)
{
+ Annotation annotation = an[i];
+
/**
* test if annotation is automatically calculated for this view only
*/
boolean autoForView = false;
- if (an[i].getLabel().equals("Quality")
- || an[i].getLabel().equals("Conservation")
- || an[i].getLabel().equals("Consensus"))
+ if (annotation.getLabel().equals("Quality")
+ || annotation.getLabel().equals("Conservation")
+ || annotation.getLabel().equals("Consensus"))
{
// Kludge for pre 2.5 projects which lacked the autocalculated flag
autoForView = true;
- if (!an[i].hasAutoCalculated())
+ if (!annotation.hasAutoCalculated())
{
- an[i].setAutoCalculated(true);
+ annotation.setAutoCalculated(true);
}
}
if (autoForView
- || (an[i].hasAutoCalculated() && an[i].isAutoCalculated()))
+ || (annotation.hasAutoCalculated() && annotation
+ .isAutoCalculated()))
{
// remove ID - we don't recover annotation from other views for
// view-specific annotation
- an[i].setId(null);
+ annotation.setId(null);
}
// set visiblity for other annotation in this view
- if (an[i].getId() != null
- && annotationIds.containsKey(an[i].getId()))
+ String annotationId = annotation.getId();
+ if (annotationId != null
+ && annotationIds.containsKey(annotationId))
{
- AlignmentAnnotation jda = annotationIds.get(an[i].getId());
+ AlignmentAnnotation jda = annotationIds.get(annotationId);
// in principle Visible should always be true for annotation displayed
// in multiple views
- if (an[i].hasVisible())
+ if (annotation.hasVisible())
{
- jda.visible = an[i].getVisible();
+ jda.visible = annotation.getVisible();
}
al.addAnnotation(jda);
continue;
}
// Construct new annotation from model.
- AnnotationElement[] ae = an[i].getAnnotationElement();
+ AnnotationElement[] ae = annotation.getAnnotationElement();
jalview.datamodel.Annotation[] anot = null;
java.awt.Color firstColour = null;
int anpos;
- if (!an[i].getScoreOnly())
+ if (!annotation.getScoreOnly())
{
anot = new jalview.datamodel.Annotation[al.getWidth()];
for (int aa = 0; aa < ae.length && aa < anot.length; aa++)
}
jalview.datamodel.AlignmentAnnotation jaa = null;
- if (an[i].getGraph())
+ if (annotation.getGraph())
{
float llim = 0, hlim = 0;
// if (autoForView || an[i].isAutoCalculated()) {
// hlim=11f;
// }
- jaa = new jalview.datamodel.AlignmentAnnotation(an[i].getLabel(),
- an[i].getDescription(), anot, llim, hlim,
- an[i].getGraphType());
+ jaa = new jalview.datamodel.AlignmentAnnotation(
+ annotation.getLabel(), annotation.getDescription(), anot,
+ llim, hlim, annotation.getGraphType());
- jaa.graphGroup = an[i].getGraphGroup();
+ jaa.graphGroup = annotation.getGraphGroup();
jaa._linecolour = firstColour;
- if (an[i].getThresholdLine() != null)
+ if (annotation.getThresholdLine() != null)
{
- jaa.setThreshold(new jalview.datamodel.GraphLine(an[i]
- .getThresholdLine().getValue(), an[i]
+ jaa.setThreshold(new jalview.datamodel.GraphLine(annotation
+ .getThresholdLine().getValue(), annotation
.getThresholdLine().getLabel(), new java.awt.Color(
- an[i].getThresholdLine().getColour())));
+ annotation.getThresholdLine().getColour())));
}
- if (autoForView || an[i].isAutoCalculated())
+ if (autoForView || annotation.isAutoCalculated())
{
// Hardwire the symbol display line to ensure that labels for
// histograms are displayed
// and make a note of any group association
if (an[i].getGroupRef() != null && an[i].getGroupRef().length() > 0)
{
- ArrayList<jalview.datamodel.AlignmentAnnotation> aal = groupAnnotRefs
+ List<jalview.datamodel.AlignmentAnnotation> aal = groupAnnotRefs
.get(an[i].getGroupRef());
if (aal == null)
{
boolean addAnnotSchemeGroup = false;
for (int i = 0; i < groups.length; i++)
{
+ JGroup jGroup = groups[i];
ColourSchemeI cs = null;
-
- if (groups[i].getColour() != null)
+ if (jGroup.getColour() != null)
{
- if (groups[i].getColour().startsWith("ucs"))
+ if (jGroup.getColour().startsWith("ucs"))
{
- cs = getUserColourScheme(jms, groups[i].getColour());
+ cs = getUserColourScheme(jms, jGroup.getColour());
}
- else if (groups[i].getColour().equals("AnnotationColourGradient")
- && groups[i].getAnnotationColours() != null)
+ else if (jGroup.getColour().equals("AnnotationColourGradient")
+ && jGroup.getAnnotationColours() != null)
{
addAnnotSchemeGroup = true;
cs = null;
}
else
{
- cs = ColourSchemeProperty.getColour(al, groups[i].getColour());
+ cs = ColourSchemeProperty.getColour(al, jGroup.getColour());
}
if (cs != null)
{
- cs.setThreshold(groups[i].getPidThreshold(), true);
+ cs.setThreshold(jGroup.getPidThreshold(), true);
}
}
- Vector seqs = new Vector();
+ Vector<SequenceI> seqs = new Vector<SequenceI>();
- for (int s = 0; s < groups[i].getSeqCount(); s++)
+ for (int s = 0; s < jGroup.getSeqCount(); s++)
{
- String seqId = groups[i].getSeq(s) + "";
- jalview.datamodel.SequenceI ts = seqRefIds.get(seqId);
+ String seqId = jGroup.getSeq(s) + "";
+ SequenceI ts = seqRefIds.get(seqId);
if (ts != null)
{
continue;
}
- jalview.datamodel.SequenceGroup sg = new jalview.datamodel.SequenceGroup(
- seqs, groups[i].getName(), cs, groups[i].getDisplayBoxes(),
- groups[i].getDisplayText(), groups[i].getColourText(),
- groups[i].getStart(), groups[i].getEnd());
+ SequenceGroup sg = new SequenceGroup(seqs, jGroup.getName(), cs,
+ jGroup.getDisplayBoxes(), jGroup.getDisplayText(),
+ jGroup.getColourText(), jGroup.getStart(),
+ jGroup.getEnd());
- sg.setOutlineColour(new java.awt.Color(groups[i].getOutlineColour()));
+ sg.setOutlineColour(new java.awt.Color(jGroup.getOutlineColour()));
- sg.textColour = new java.awt.Color(groups[i].getTextCol1());
- sg.textColour2 = new java.awt.Color(groups[i].getTextCol2());
- sg.setShowNonconserved(groups[i].hasShowUnconserved() ? groups[i]
+ sg.textColour = new java.awt.Color(jGroup.getTextCol1());
+ sg.textColour2 = new java.awt.Color(jGroup.getTextCol2());
+ sg.setShowNonconserved(jGroup.hasShowUnconserved() ? jGroup
.isShowUnconserved() : false);
- sg.thresholdTextColour = groups[i].getTextColThreshold();
- if (groups[i].hasShowConsensusHistogram())
+ sg.thresholdTextColour = jGroup.getTextColThreshold();
+ if (jGroup.hasShowConsensusHistogram())
{
- sg.setShowConsensusHistogram(groups[i].isShowConsensusHistogram());
+ sg.setShowConsensusHistogram(jGroup.isShowConsensusHistogram());
}
;
- if (groups[i].hasShowSequenceLogo())
+ if (jGroup.hasShowSequenceLogo())
{
- sg.setshowSequenceLogo(groups[i].isShowSequenceLogo());
+ sg.setshowSequenceLogo(jGroup.isShowSequenceLogo());
}
- if (groups[i].hasNormaliseSequenceLogo())
+ if (jGroup.hasNormaliseSequenceLogo())
{
- sg.setNormaliseSequenceLogo(groups[i].isNormaliseSequenceLogo());
+ sg.setNormaliseSequenceLogo(jGroup.isNormaliseSequenceLogo());
}
- if (groups[i].hasIgnoreGapsinConsensus())
+ if (jGroup.hasIgnoreGapsinConsensus())
{
- sg.setIgnoreGapsConsensus(groups[i].getIgnoreGapsinConsensus());
+ sg.setIgnoreGapsConsensus(jGroup.getIgnoreGapsinConsensus());
}
- if (groups[i].getConsThreshold() != 0)
+ if (jGroup.getConsThreshold() != 0)
{
jalview.analysis.Conservation c = new jalview.analysis.Conservation(
"All", ResidueProperties.propHash, 3,
sg.cs.setConservation(c);
}
- if (groups[i].getId() != null && groupAnnotRefs.size() > 0)
+ if (jGroup.getId() != null && groupAnnotRefs.size() > 0)
{
// re-instate unique group/annotation row reference
- ArrayList<jalview.datamodel.AlignmentAnnotation> jaal = groupAnnotRefs
- .get(groups[i].getId());
+ List<AlignmentAnnotation> jaal = groupAnnotRefs
+ .get(jGroup.getId());
if (jaal != null)
{
- for (jalview.datamodel.AlignmentAnnotation jaa : jaal)
+ for (AlignmentAnnotation jaa : jaal)
{
jaa.groupRef = sg;
if (jaa.autoCalculated)
{
// reconstruct the annotation colourscheme
sg.cs = constructAnnotationColour(
- groups[i].getAnnotationColours(), null, al, jms, false);
+ jGroup.getAnnotationColours(), null, al, jms, false);
}
}
}
av = af.viewport;
ap = af.alignPanel;
}
- // LOAD TREES
- // /////////////////////////////////////
- if (loadTreesAndStructures && jms.getTreeCount() > 0)
+
+ /*
+ * Load any trees, PDB structures and viewers
+ *
+ * Not done if flag is false (when this method is used for New View)
+ */
+ if (loadTreesAndStructures)
{
- try
+ loadTrees(jms, view, af, av, ap);
+ loadPDBStructures(jprovider, jseqs, af, ap);
+ loadRnaViewers(jprovider, jseqs, ap);
+ }
+ // and finally return.
+ return af;
+ }
+
+ /**
+ * Instantiate and link any saved RNA (Varna) viewers. The state of the Varna
+ * panel is restored from separate jar entries, two (gapped and trimmed) per
+ * sequence and secondary structure.
+ *
+ * Currently each viewer shows just one sequence and structure (gapped and
+ * trimmed), however this method is designed to support multiple sequences or
+ * structures in viewers if wanted in future.
+ *
+ * @param jprovider
+ * @param jseqs
+ * @param ap
+ */
+ private void loadRnaViewers(jarInputStreamProvider jprovider,
+ JSeq[] jseqs, AlignmentPanel ap)
+ {
+ /*
+ * scan the sequences for references to viewers; create each one the first
+ * time it is referenced, add Rna models to existing viewers
+ */
+ for (JSeq jseq : jseqs)
+ {
+ for (int i = 0; i < jseq.getRnaViewerCount(); i++)
{
- for (int t = 0; t < jms.getTreeCount(); t++)
+ RnaViewer viewer = jseq.getRnaViewer(i);
+ AppVarna appVarna = findOrCreateVarnaViewer(viewer, uniqueSetSuffix,
+ ap);
+
+ for (int j = 0; j < viewer.getSecondaryStructureCount(); j++)
{
+ SecondaryStructure ss = viewer.getSecondaryStructure(j);
+ SequenceI seq = seqRefIds.get(jseq.getId());
+ AlignmentAnnotation ann = this.annotationIds.get(ss
+ .getAnnotationId());
- Tree tree = jms.getTree(t);
+ /*
+ * add the structure to the Varna display (with session state copied
+ * from the jar to a temporary file)
+ */
+ boolean gapped = ss.isGapped();
+ String rnaTitle = ss.getTitle();
+ String sessionState = ss.getViewerState();
+ String tempStateFile = copyJarEntry(jprovider, sessionState,
+ "varna");
+ RnaModel rna = new RnaModel(rnaTitle, ann, seq, null, gapped,
+ tempStateFile);
+ appVarna.addModel(rna, rnaTitle);
+ }
+ appVarna.setSelectedIndex(viewer.getSelectedRna());
+ }
+ }
+ }
- TreePanel tp = (TreePanel) retrieveExistingObj(tree.getId());
- if (tp == null)
- {
- tp = af.ShowNewickTree(
- new jalview.io.NewickFile(tree.getNewick()),
- tree.getTitle(), tree.getWidth(), tree.getHeight(),
- tree.getXpos(), tree.getYpos());
- if (tree.getId() != null)
- {
- // perhaps bind the tree id to something ?
- }
- }
- else
- {
- // update local tree attributes ?
- // TODO: should check if tp has been manipulated by user - if so its
- // settings shouldn't be modified
- tp.setTitle(tree.getTitle());
- tp.setBounds(new Rectangle(tree.getXpos(), tree.getYpos(), tree
- .getWidth(), tree.getHeight()));
- tp.av = av; // af.viewport; // TODO: verify 'associate with all
- // views'
- // works still
- tp.treeCanvas.av = av; // af.viewport;
- tp.treeCanvas.ap = ap; // af.alignPanel;
+ /**
+ * Locate and return an already instantiated matching AppVarna, or create one
+ * if not found
+ *
+ * @param viewer
+ * @param viewIdSuffix
+ * @param ap
+ * @return
+ */
+ protected AppVarna findOrCreateVarnaViewer(RnaViewer viewer,
+ String viewIdSuffix, AlignmentPanel ap)
+ {
+ /*
+ * on each load a suffix is appended to the saved viewId, to avoid conflicts
+ * if load is repeated
+ */
+ String postLoadId = viewer.getViewId() + viewIdSuffix;
+ for (JInternalFrame frame : getAllFrames())
+ {
+ if (frame instanceof AppVarna)
+ {
+ AppVarna varna = (AppVarna) frame;
+ if (postLoadId.equals(varna.getViewId()))
+ {
+ // this viewer is already instantiated
+ // could in future here add ap as another 'parent' of the
+ // AppVarna window; currently just 1-to-many
+ return varna;
+ }
+ }
+ }
- }
- if (tp == null)
- {
- warn("There was a problem recovering stored Newick tree: \n"
- + tree.getNewick());
- continue;
- }
+ /*
+ * viewer not found - make it
+ */
+ RnaViewerModel model = new RnaViewerModel(postLoadId,
+ viewer.getTitle(), viewer.getXpos(),
+ viewer.getYpos(), viewer.getWidth(), viewer.getHeight(),
+ viewer.getDividerLocation());
+ AppVarna varna = new AppVarna(model, ap);
- tp.fitToWindow.setState(tree.getFitToWindow());
- tp.fitToWindow_actionPerformed(null);
+ return varna;
+ }
- if (tree.getFontName() != null)
- {
- tp.setTreeFont(new java.awt.Font(tree.getFontName(), tree
- .getFontStyle(), tree.getFontSize()));
- }
- else
+ /**
+ * Load any saved trees
+ *
+ * @param jms
+ * @param view
+ * @param af
+ * @param av
+ * @param ap
+ */
+ protected void loadTrees(JalviewModelSequence jms, Viewport view,
+ AlignFrame af, AlignViewport av, AlignmentPanel ap)
+ {
+ // TODO result of automated refactoring - are all these parameters needed?
+ try
+ {
+ for (int t = 0; t < jms.getTreeCount(); t++)
+ {
+
+ Tree tree = jms.getTree(t);
+
+ TreePanel tp = (TreePanel) retrieveExistingObj(tree.getId());
+ if (tp == null)
+ {
+ tp = af.ShowNewickTree(
+ new jalview.io.NewickFile(tree.getNewick()),
+ tree.getTitle(), tree.getWidth(), tree.getHeight(),
+ tree.getXpos(), tree.getYpos());
+ if (tree.getId() != null)
{
- tp.setTreeFont(new java.awt.Font(view.getFontName(), view
- .getFontStyle(), tree.getFontSize()));
+ // perhaps bind the tree id to something ?
}
+ }
+ else
+ {
+ // update local tree attributes ?
+ // TODO: should check if tp has been manipulated by user - if so its
+ // settings shouldn't be modified
+ tp.setTitle(tree.getTitle());
+ tp.setBounds(new Rectangle(tree.getXpos(), tree.getYpos(), tree
+ .getWidth(), tree.getHeight()));
+ tp.av = av; // af.viewport; // TODO: verify 'associate with all
+ // views'
+ // works still
+ tp.treeCanvas.av = av; // af.viewport;
+ tp.treeCanvas.ap = ap; // af.alignPanel;
- tp.showPlaceholders(tree.getMarkUnlinked());
- tp.showBootstrap(tree.getShowBootstrap());
- tp.showDistances(tree.getShowDistances());
+ }
+ if (tp == null)
+ {
+ warn("There was a problem recovering stored Newick tree: \n"
+ + tree.getNewick());
+ continue;
+ }
- tp.treeCanvas.threshold = tree.getThreshold();
+ tp.fitToWindow.setState(tree.getFitToWindow());
+ tp.fitToWindow_actionPerformed(null);
- if (tree.getCurrentTree())
- {
- af.viewport.setCurrentTree(tp.getTree());
- }
+ if (tree.getFontName() != null)
+ {
+ tp.setTreeFont(new java.awt.Font(tree.getFontName(), tree
+ .getFontStyle(), tree.getFontSize()));
+ }
+ else
+ {
+ tp.setTreeFont(new java.awt.Font(view.getFontName(), view
+ .getFontStyle(), tree.getFontSize()));
}
- } catch (Exception ex)
- {
- ex.printStackTrace();
+ tp.showPlaceholders(tree.getMarkUnlinked());
+ tp.showBootstrap(tree.getShowBootstrap());
+ tp.showDistances(tree.getShowDistances());
+
+ tp.treeCanvas.threshold = tree.getThreshold();
+
+ if (tree.getCurrentTree())
+ {
+ af.viewport.setCurrentTree(tp.getTree());
+ }
}
- }
- // //LOAD STRUCTURES
- if (loadTreesAndStructures)
+ } catch (Exception ex)
{
- loadStructures(jprovider, jseqs, af, ap);
+ ex.printStackTrace();
}
- // and finally return.
- return af;
}
/**
* @param af
* @param ap
*/
- protected void loadStructures(jarInputStreamProvider jprovider,
+ protected void loadPDBStructures(jarInputStreamProvider jprovider,
JSeq[] jseqs, AlignFrame af, AlignmentPanel ap)
{
/*
/*
* Copy Chimera session from jar entry "viewer_"+viewId to a temporary file
*
- * Note this is the 'saved' viewId as in the project file XML, _not_ the
+ * NB this is the 'saved' viewId as in the project file XML, _not_ the
* 'uniquified' sviewid used to reconstruct the viewer here
*/
- chimeraSessionFile = copyJarEntry(jprovider,
- getViewerJarEntryName(data.getViewId()), "chimera");
+ String viewerJarEntryName = getViewerJarEntryName(data.getViewId());
+ chimeraSessionFile = copyJarEntry(jprovider, viewerJarEntryName,
+ "chimera");
Set<Entry<File, StructureData>> fileData = data.getFileData()
.entrySet();
final SequenceI[][] seqsArray = allseqs.toArray(new SequenceI[allseqs
.size()][]);
String newViewId = viewerData.getKey();
+
ChimeraViewFrame cvf = new ChimeraViewFrame(chimeraSessionFile,
af.alignPanel, pdbArray,
seqsArray, colourByChimera, colourBySequence, newViewId);
*/
protected String getViewerJarEntryName(String viewId)
{
- return "viewer_" + viewId;
+ return VIEWER_PREFIX + viewId;
}
/**
* @return true if version is development/null or evaluates to the same or
* later X.Y.Z (where X,Y,Z are like [0-9]+b?[0-9]*)
*/
- private boolean isVersionStringLaterThan(String supported, String version)
+ protected boolean isVersionStringLaterThan(String supported,
+ String version)
{
if (version == null || version.equalsIgnoreCase("DEVELOPMENT BUILD")
|| version.equalsIgnoreCase("Test")
}
}
- java.util.Hashtable datasetIds = null;
+ /*
+ * TODO use AlignmentI here and in related methods - needs
+ * AlignmentI.getDataset() changed to return AlignmentI instead of Alignment
+ */
+ Hashtable<String, Alignment> datasetIds = null;
- java.util.IdentityHashMap dataset2Ids = null;
+ IdentityHashMap<Alignment, String> dataset2Ids = null;
private Alignment getDatasetFor(String datasetId)
{
if (datasetIds == null)
{
- datasetIds = new Hashtable();
+ datasetIds = new Hashtable<String, Alignment>();
return null;
}
if (datasetIds.containsKey(datasetId))
{
- return (Alignment) datasetIds.get(datasetId);
+ return datasetIds.get(datasetId);
}
return null;
}
{
if (datasetIds == null)
{
- datasetIds = new Hashtable();
+ datasetIds = new Hashtable<String, Alignment>();
}
datasetIds.put(datasetId, dataset);
}
* @param dataset
* @return
*/
- private String getDatasetIdRef(jalview.datamodel.Alignment dataset)
+ private String getDatasetIdRef(Alignment dataset)
{
if (dataset.getDataset() != null)
{
// make a new datasetId and record it
if (dataset2Ids == null)
{
- dataset2Ids = new IdentityHashMap();
+ dataset2Ids = new IdentityHashMap<Alignment, String>();
}
else
{
- datasetId = (String) dataset2Ids.get(dataset);
+ datasetId = dataset2Ids.get(dataset);
}
if (datasetId == null)
{
boolean keepSeqRefs)
{
initSeqRefs();
- jalview.schemabinding.version2.JalviewModel jm = saveState(ap, null,
- null);
+ JalviewModel jm = saveState(ap, null, null, null);
if (!keepSeqRefs)
{
return result;
}
+
+ /**
+ * Returns an incrementing counter (0, 1, 2...)
+ *
+ * @return
+ */
+ private synchronized int nextCounter()
+ {
+ return counter++;
+ }
}
*/
package jalview.gui;
+import java.awt.Color;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.util.Arrays;
+import java.util.Collections;
+import java.util.Hashtable;
+import java.util.LinkedHashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.TreeMap;
+import java.util.Vector;
+
+import javax.swing.ButtonGroup;
+import javax.swing.JCheckBoxMenuItem;
+import javax.swing.JColorChooser;
+import javax.swing.JMenu;
+import javax.swing.JMenuItem;
+import javax.swing.JOptionPane;
+import javax.swing.JPopupMenu;
+import javax.swing.JRadioButtonMenuItem;
+
import jalview.analysis.AAFrequency;
import jalview.analysis.AlignmentAnnotationUtils;
import jalview.analysis.AlignmentUtils;
import jalview.util.MessageManager;
import jalview.util.UrlLink;
-import java.awt.Color;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.util.Arrays;
-import java.util.Collections;
-import java.util.Hashtable;
-import java.util.LinkedHashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.TreeMap;
-import java.util.Vector;
-
-import javax.swing.ButtonGroup;
-import javax.swing.JCheckBoxMenuItem;
-import javax.swing.JColorChooser;
-import javax.swing.JMenu;
-import javax.swing.JMenuItem;
-import javax.swing.JOptionPane;
-import javax.swing.JPopupMenu;
-import javax.swing.JRadioButtonMenuItem;
-
/**
* DOCUMENT ME!
*
makeReferenceSeq.setText("Mark as representative");
}
- if (ap.av.getAlignment().isNucleotide() == false)
+ if (!ap.av.getAlignment().isNucleotide())
{
remove(rnaStructureMenu);
}
-
- if (ap.av.getAlignment().isNucleotide() == true)
+ else
{
- AlignmentAnnotation[] aa = ap.av.getAlignment()
+ /*
+ * add menu items to 2D-render any alignment or sequence secondary
+ * structure annotation
+ */
+ AlignmentAnnotation[] aas = ap.av.getAlignment()
.getAlignmentAnnotation();
- for (int i = 0; aa != null && i < aa.length; i++)
+ if (aas != null)
{
- if (aa[i].isValidStruc() && aa[i].sequenceRef == null)
+ for (final AlignmentAnnotation aa : aas)
{
- final String rnastruc = aa[i].getRNAStruc();
- final String structureLine = aa[i].label + " (alignment)";
- menuItem = new JMenuItem();
- menuItem.setText(MessageManager.formatMessage(
- "label.2d_rna_structure_line", new Object[]
- { structureLine }));
- menuItem.addActionListener(new java.awt.event.ActionListener()
+ if (aa.isValidStruc() && aa.sequenceRef == null)
{
- @Override
- public void actionPerformed(ActionEvent e)
+ /*
+ * valid alignment RNA secondary structure annotation
+ */
+ final String structureLine = aa.label + " (alignment)";
+ menuItem = new JMenuItem();
+ menuItem.setText(MessageManager.formatMessage(
+ "label.2d_rna_structure_line", new Object[]
+ { structureLine }));
+ menuItem.addActionListener(new java.awt.event.ActionListener()
{
- new AppVarna(structureLine, seq, seq.getSequenceAsString(),
- rnastruc, seq.getName(), ap);
- System.out.println("end");
- }
- });
- rnaStructureMenu.add(menuItem);
+ @Override
+ public void actionPerformed(ActionEvent e)
+ {
+ new AppVarna(structureLine, seq, aa, ap);
+ }
+ });
+ rnaStructureMenu.add(menuItem);
+ }
}
}
if (seq.getAnnotation() != null)
{
- AlignmentAnnotation seqAnno[] = seq.getAnnotation();
- for (int i = 0; i < seqAnno.length; i++)
+ AlignmentAnnotation seqAnns[] = seq.getAnnotation();
+ for (final AlignmentAnnotation aa : seqAnns)
{
- if (seqAnno[i].isValidStruc())
+ if (aa.isValidStruc())
{
- final String rnastruc = seqAnno[i].getRNAStruc();
-
+ /*
+ * valid sequence RNA secondary structure annotation
+ */
// TODO: make rnastrucF a bit more nice
menuItem = new JMenuItem();
menuItem.setText(MessageManager.formatMessage(
{
// TODO: VARNA does'nt print gaps in the sequence
- new AppVarna(seq.getName() + " structure", seq, seq
- .getSequenceAsString(), rnastruc, seq.getName(),
+ new AppVarna(seq.getName() + " structure", seq, aa,
ap);
}
});
git://source.jalview.org / jalview.git / commitdiff