Revert "Merge branch 'bug/JAL-3806_mappingCoversSequence' into releases/Release_2_11_...

This reverts commit cb628aab46f9027e71b71203b322f96710e09990, reversing
changes made to a40669b2eeb34a6c760b63c172a31a194b456f24.

diff --git a/src/jalview/datamodel/AlignedCodonFrame.java b/src/jalview/datamodel/AlignedCodonFrame.java
index 6ccc0fc..6faf7a6 100644 (file)
--- a/src/jalview/datamodel/AlignedCodonFrame.java
+++ b/src/jalview/datamodel/AlignedCodonFrame.java
@@ -171,8 +171,8 @@ public class AlignedCodonFrame
 
       if (length != -1)
       {
-        // add 3 to mapped length to allow for a mapped stop codon
-        if (length + 3 >= (mend - mstart + 1))
+        // add 1 to mapped length to allow for a mapped stop codon
+        if (length + 1 >= (mend - mstart + 1))
         {
           return true;
         }

diff --git a/src/jalview/util/MappingUtils.java b/src/jalview/util/MappingUtils.java
index c9113ae..177c54d 100644 (file)
--- a/src/jalview/util/MappingUtils.java
+++ b/src/jalview/util/MappingUtils.java
@@ -408,6 +408,7 @@ public final class MappingUtils
           int mappedEndCol = seq.findIndex(mappedEndResidue) - 1;
           maxEndCol = maxEndCol == -1 ? mappedEndCol
                   : Math.max(maxEndCol, mappedEndCol);
+          break;
         }
       }
     }

diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java
index 204d803..08673ae 100644 (file)
--- a/test/jalview/util/MappingUtilsTest.java
+++ b/test/jalview/util/MappingUtilsTest.java
@@ -67,7 +67,7 @@ public class MappingUtilsTest
   {
     Cache.initLogger();
   }
-
+  
   @BeforeClass(alwaysRun = true)
   public void setUpJvOptionPane()
   {
@@ -277,8 +277,7 @@ public class MappingUtilsTest
     sg.addSequence(cdna.getSequenceAt(0), false);
     sg.setStartRes(0);
     sg.setEndRes(2);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
     assertTrue(mappedGroup.getColourText());
     assertSame(sg.getIdColour(), mappedGroup.getIdColour());
     assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
@@ -574,8 +573,7 @@ public class MappingUtilsTest
     // select columns 2 and 3 in DNA which span protein columns 0 and 1
     sg.setStartRes(2);
     sg.setEndRes(3);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
     assertTrue(mappedGroup.getColourText());
     assertSame(sg.getIdColour(), mappedGroup.getIdColour());
     assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
@@ -658,8 +656,7 @@ public class MappingUtilsTest
      */
     sg.setStartRes(2);
     sg.setEndRes(4);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView,
-            theDnaView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView, theDnaView);
     assertEquals(1, mappedGroup.getStartRes());
     assertEquals(13, mappedGroup.getEndRes());
 
@@ -672,22 +669,19 @@ public class MappingUtilsTest
     // select columns 4,5 - includes Seq1:codon2 (A) only
     sg.setStartRes(4);
     sg.setEndRes(5);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
     assertEquals(2, mappedGroup.getStartRes());
     assertEquals(2, mappedGroup.getEndRes());
 
     // add Seq2 to dna selection cols 4-5 include codons 1 and 2 (LQ)
     sg.addSequence(cdna.getSequenceAt(1), false);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
     assertEquals(2, mappedGroup.getStartRes());
     assertEquals(4, mappedGroup.getEndRes());
 
     // add Seq3 to dna selection cols 4-5 include codon 1 (Q)
     sg.addSequence(cdna.getSequenceAt(2), false);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
     assertEquals(0, mappedGroup.getStartRes());
     assertEquals(4, mappedGroup.getEndRes());
   }
@@ -1336,20 +1330,20 @@ public class MappingUtilsTest
     assertEquals(1, ranges.size());
     assertEquals(9, ranges.get(0)[1]);
   }
-
+  
   @Test(groups = "Functional")
   public void testListToArray()
   {
     List<int[]> ranges = new ArrayList<>();
-
+    
     int[] result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 0);
-    ranges.add(new int[] { 24, 12 });
+    ranges.add(new int[] {24, 12});
     result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 2);
     assertEquals(result[0], 24);
     assertEquals(result[1], 12);
-    ranges.add(new int[] { -7, 30 });
+    ranges.add(new int[] {-7, 30});
     result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 4);
     assertEquals(result[0], 24);
@@ -1370,9 +1364,7 @@ public class MappingUtilsTest
    * Test mapping a sequence group where sequences in and outside the group
    * share a dataset sequence (e.g. alternative CDS for the same gene)
    * <p>
-   * This scenario doesn't arise after JAL-3763 changes, but test left as still
-   * valid
-   * 
+   * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
    * @throws IOException
    */
   @Test(groups = { "Functional" })
@@ -1473,100 +1465,17 @@ public class MappingUtilsTest
   public void testFindOverlap()
   {
     List<int[]> ranges = new ArrayList<>();
-    ranges.add(new int[] { 4, 8 });
-    ranges.add(new int[] { 10, 12 });
-    ranges.add(new int[] { 16, 19 });
-
-    int[] overlap = MappingUtils.findOverlap(ranges, 5, 13);
-    assertArrayEquals(overlap, new int[] { 5, 12 });
+    ranges.add(new int[] {4, 8});
+    ranges.add(new int[] {10, 12});
+    ranges.add(new int[] {16, 19});
+    
+    int[] overlap = MappingUtils.findOverlap(ranges, 5,  13);
+    assertArrayEquals(overlap, new int[] {5, 12});
     overlap = MappingUtils.findOverlap(ranges, -100, 100);
-    assertArrayEquals(overlap, new int[] { 4, 19 });
+    assertArrayEquals(overlap, new int[] {4, 19});
     overlap = MappingUtils.findOverlap(ranges, 7, 17);
-    assertArrayEquals(overlap, new int[] { 7, 17 });
+    assertArrayEquals(overlap, new int[] {7, 17});
     overlap = MappingUtils.findOverlap(ranges, 13, 15);
     assertNull(overlap);
   }
-
-  /**
-   * Test mapping a sequence group including a sequence which maps to more than
-   * one other sequence
-   * 
-   * @throws IOException
-   */
-  @Test(groups = { "Functional" })
-  public void testMapSequenceGroup_oneToMany() throws IOException
-  {
-    /*
-     * Uniprot:FER2_ARATH has cross-refs to 10 EMBLCDS sequences;
-     * we'll just mimic 3 of them here (abbreviated)
-     * From EMBLCDS|BAE98526 [ [1, 444] ] 3:1 to [ [1, 148] ] FER2_ARATH
-     * From EMBLCDS|AAM91336 same
-     * From EMBLCDS|AAM13033 same
-     */
-    String coding = "atggcttccactgctctctca";
-    AlignmentI cds = loadAlignment(">BAE98526\n" + coding + "\n>AAM91336\n"
-            + coding + "\n>AAM13033\n" + coding + "\n",
-            FileFormat.Fasta);
-    cds.setDataset(null);
-    AlignmentI protein = loadAlignment(">FER2_ARATH\nMASTALS\n",
-            FileFormat.Fasta);
-    protein.setDataset(null);
-    AlignedCodonFrame acf = new AlignedCodonFrame();
-    MapList map = new MapList(new int[] { 1, 21 }, new int[] { 1, 7 }, 3, 1);
-    for (int seq = 0; seq < 3; seq++)
-    {
-      acf.addMap(cds.getSequenceAt(seq).getDatasetSequence(),
-              protein.getSequenceAt(0).getDatasetSequence(), map);
-    }
-    List<AlignedCodonFrame> acfList = Arrays
-            .asList(new AlignedCodonFrame[]
-            { acf });
-
-    AlignViewportI theDnaView = new AlignViewport(cds);
-    AlignViewportI theProteinView = new AlignViewport(protein);
-    protein.setCodonFrames(acfList);
-
-    /*
-     * Select FER2_ARATH in the protein
-     */
-    SequenceGroup sg = new SequenceGroup();
-    sg.setColourText(true);
-    sg.setIdColour(Color.GREEN);
-    sg.setOutlineColour(Color.LIGHT_GRAY);
-    sg.addSequence(protein.getSequenceAt(0), false);
-    sg.setEndRes(protein.getWidth() - 1);
-
-    /*
-     * Verify the mapped sequence group in dna
-     */
-    SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
-            theProteinView, theDnaView);
-    assertTrue(mappedGroup.getColourText());
-    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
-    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
-    assertEquals(3, mappedGroup.getSequences().size());
-    assertSame(cds.getSequenceAt(0), mappedGroup.getSequences().get(0));
-    assertSame(cds.getSequenceAt(1), mappedGroup.getSequences().get(1));
-    assertSame(cds.getSequenceAt(2), mappedGroup.getSequences().get(2));
-    assertEquals(0, mappedGroup.getStartRes());
-    assertEquals(20, mappedGroup.getEndRes()); // 21 columns (7 codons)
-
-    /*
-     * Select 2 CDS, verify peptide is mapped
-     */
-    sg.clear();
-    sg.addSequence(cds.getSequenceAt(1), false);
-    sg.addSequence(cds.getSequenceAt(0), false);
-    sg.setStartRes(0);
-    sg.setEndRes(20);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
-            theProteinView);
-    assertTrue(mappedGroup.getColourText());
-    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
-    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
-    assertEquals(1, mappedGroup.getSequences().size());
-    assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0));
-    assertEquals(0, mappedGroup.getStartRes());
-    assertEquals(6, mappedGroup.getEndRes());
-  }
 }