2 * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
3 * Copyright (C) $$Year-Rel$$ The Jalview Authors
5 * This file is part of Jalview.
7 * Jalview is free software: you can redistribute it and/or
8 * modify it under the terms of the GNU General Public License
9 * as published by the Free Software Foundation, either version 3
10 * of the License, or (at your option) any later version.
12 * Jalview is distributed in the hope that it will be useful, but
13 * WITHOUT ANY WARRANTY; without even the implied warranty
14 * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
15 * PURPOSE. See the GNU General Public License for more details.
17 * You should have received a copy of the GNU General Public License
18 * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
19 * The Jalview Authors are detailed in the 'AUTHORS' file.
21 package jalview.datamodel;
23 import static org.testng.AssertJUnit.assertEquals;
24 import static org.testng.AssertJUnit.assertFalse;
25 import static org.testng.AssertJUnit.assertNotNull;
26 import static org.testng.AssertJUnit.assertNotSame;
27 import static org.testng.AssertJUnit.assertNull;
28 import static org.testng.AssertJUnit.assertSame;
29 import static org.testng.AssertJUnit.assertTrue;
30 import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
32 import jalview.datamodel.PDBEntry.Type;
33 import jalview.gui.JvOptionPane;
34 import jalview.util.MapList;
37 import java.util.ArrayList;
38 import java.util.Arrays;
39 import java.util.List;
40 import java.util.Vector;
42 import junit.extensions.PA;
44 import org.testng.Assert;
45 import org.testng.annotations.BeforeClass;
46 import org.testng.annotations.BeforeMethod;
47 import org.testng.annotations.Test;
49 public class SequenceTest
52 @BeforeClass(alwaysRun = true)
53 public void setUpJvOptionPane()
55 JvOptionPane.setInteractiveMode(false);
56 JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
61 @BeforeMethod(alwaysRun = true)
64 seq = new Sequence("FER1", "AKPNGVL");
67 @Test(groups = { "Functional" })
68 public void testInsertGapsAndGapmaps()
70 SequenceI aseq = seq.deriveSequence();
71 aseq.insertCharAt(2, 3, '-');
72 aseq.insertCharAt(6, 3, '-');
73 assertEquals("Gap insertions not correct", "AK---P---NGVL",
74 aseq.getSequenceAsString());
75 List<int[]> gapInt = aseq.getInsertions();
76 assertEquals("Gap interval 1 start wrong", 2, gapInt.get(0)[0]);
77 assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
78 assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
79 assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
82 @Test(groups = ("Functional"))
83 public void testIsProtein()
86 assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
88 assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
90 SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
91 assertFalse(sq.isProtein());
92 // change sequence, should trigger an update of cached result
93 sq.setSequence("ASDFASDFADSF");
94 assertTrue(sq.isProtein());
96 * in situ change of sequence doesn't change hashcode :-O
97 * (sequence should not expose internal implementation)
99 for (int i = 0; i < sq.getSequence().length; i++)
101 sq.getSequence()[i] = "acgtu".charAt(i % 5);
103 assertTrue(sq.isProtein()); // but it isn't
106 @Test(groups = { "Functional" })
107 public void testGetAnnotation()
109 // initial state returns null not an empty array
110 assertNull(seq.getAnnotation());
111 AlignmentAnnotation ann = addAnnotation("label1", "desc1", "calcId1",
113 AlignmentAnnotation[] anns = seq.getAnnotation();
114 assertEquals(1, anns.length);
115 assertSame(ann, anns[0]);
117 // removing all annotations reverts array to null
118 seq.removeAlignmentAnnotation(ann);
119 assertNull(seq.getAnnotation());
122 @Test(groups = { "Functional" })
123 public void testGetAnnotation_forLabel()
125 AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
127 addAnnotation("label2", "desc2", "calcId2", 1f);
128 AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
130 AlignmentAnnotation[] anns = seq.getAnnotation("label1");
131 assertEquals(2, anns.length);
132 assertSame(ann1, anns[0]);
133 assertSame(ann3, anns[1]);
136 private AlignmentAnnotation addAnnotation(String label,
137 String description, String calcId, float value)
139 final AlignmentAnnotation annotation = new AlignmentAnnotation(label,
141 annotation.setCalcId(calcId);
142 seq.addAlignmentAnnotation(annotation);
146 @Test(groups = { "Functional" })
147 public void testGetAlignmentAnnotations_forCalcIdAndLabel()
149 addAnnotation("label1", "desc1", "calcId1", 1f);
150 AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
152 addAnnotation("label2", "desc3", "calcId3", 1f);
153 AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
155 addAnnotation("label5", "desc3", null, 1f);
156 addAnnotation(null, "desc3", "calcId3", 1f);
158 List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
160 assertEquals(2, anns.size());
161 assertSame(ann2, anns.get(0));
162 assertSame(ann4, anns.get(1));
164 assertTrue(seq.getAlignmentAnnotations("calcId2", "label3").isEmpty());
165 assertTrue(seq.getAlignmentAnnotations("calcId3", "label5").isEmpty());
166 assertTrue(seq.getAlignmentAnnotations("calcId2", null).isEmpty());
167 assertTrue(seq.getAlignmentAnnotations(null, "label3").isEmpty());
168 assertTrue(seq.getAlignmentAnnotations(null, null).isEmpty());
172 * Tests for addAlignmentAnnotation. Note this method has the side-effect of
173 * setting the sequenceRef on the annotation. Adding the same annotation twice
176 @Test(groups = { "Functional" })
177 public void testAddAlignmentAnnotation()
179 assertNull(seq.getAnnotation());
180 final AlignmentAnnotation annotation = new AlignmentAnnotation("a",
182 assertNull(annotation.sequenceRef);
183 seq.addAlignmentAnnotation(annotation);
184 assertSame(seq, annotation.sequenceRef);
185 AlignmentAnnotation[] anns = seq.getAnnotation();
186 assertEquals(1, anns.length);
187 assertSame(annotation, anns[0]);
189 // re-adding does nothing
190 seq.addAlignmentAnnotation(annotation);
191 anns = seq.getAnnotation();
192 assertEquals(1, anns.length);
193 assertSame(annotation, anns[0]);
195 // an identical but different annotation can be added
196 final AlignmentAnnotation annotation2 = new AlignmentAnnotation("a",
198 seq.addAlignmentAnnotation(annotation2);
199 anns = seq.getAnnotation();
200 assertEquals(2, anns.length);
201 assertSame(annotation, anns[0]);
202 assertSame(annotation2, anns[1]);
205 @Test(groups = { "Functional" })
206 public void testGetStartGetEnd()
208 SequenceI sq = new Sequence("test", "ABCDEF");
209 assertEquals(1, sq.getStart());
210 assertEquals(6, sq.getEnd());
212 sq = new Sequence("test", "--AB-C-DEF--");
213 assertEquals(1, sq.getStart());
214 assertEquals(6, sq.getEnd());
216 sq = new Sequence("test", "----");
217 assertEquals(1, sq.getStart());
218 assertEquals(0, sq.getEnd()); // ??
222 * Tests for the method that returns an alignment column position (base 1) for
223 * a given sequence position (base 1).
225 @Test(groups = { "Functional" })
226 public void testFindIndex()
228 SequenceI sq = new Sequence("test", "ABCDEF");
229 assertEquals(0, sq.findIndex(0));
230 assertEquals(1, sq.findIndex(1));
231 assertEquals(5, sq.findIndex(5));
232 assertEquals(6, sq.findIndex(6));
233 assertEquals(6, sq.findIndex(9));
235 sq = new Sequence("test", "-A--B-C-D-E-F--");
236 assertEquals(2, sq.findIndex(1));
237 assertEquals(5, sq.findIndex(2));
238 assertEquals(7, sq.findIndex(3));
240 // before start returns 0
241 assertEquals(0, sq.findIndex(0));
242 assertEquals(0, sq.findIndex(-1));
244 // beyond end returns last residue column
245 assertEquals(13, sq.findIndex(99));
250 * Tests for the method that returns a dataset sequence position (base 1) for
251 * an aligned column position (base 0).
253 @Test(groups = { "Functional" })
254 public void testFindPosition()
256 SequenceI sq = new Sequence("test", "ABCDEF");
257 assertEquals(1, sq.findPosition(0));
258 assertEquals(6, sq.findPosition(5));
259 // assertEquals(-1, seq.findPosition(6)); // fails
261 sq = new Sequence("test", "AB-C-D--");
262 assertEquals(1, sq.findPosition(0));
263 assertEquals(2, sq.findPosition(1));
264 // gap position 'finds' residue to the right (not the left as per javadoc)
265 assertEquals(3, sq.findPosition(2));
266 assertEquals(3, sq.findPosition(3));
267 assertEquals(4, sq.findPosition(4));
268 assertEquals(4, sq.findPosition(5));
269 // returns 1 more than sequence length if off the end ?!?
270 assertEquals(5, sq.findPosition(6));
271 assertEquals(5, sq.findPosition(7));
273 sq = new Sequence("test", "--AB-C-DEF--");
274 assertEquals(1, sq.findPosition(0));
275 assertEquals(1, sq.findPosition(1));
276 assertEquals(1, sq.findPosition(2));
277 assertEquals(2, sq.findPosition(3));
278 assertEquals(3, sq.findPosition(4));
279 assertEquals(3, sq.findPosition(5));
280 assertEquals(4, sq.findPosition(6));
281 assertEquals(4, sq.findPosition(7));
282 assertEquals(5, sq.findPosition(8));
283 assertEquals(6, sq.findPosition(9));
284 assertEquals(7, sq.findPosition(10));
285 assertEquals(7, sq.findPosition(11));
288 @Test(groups = { "Functional" })
289 public void testDeleteChars()
294 SequenceI sq = new Sequence("test", "ABCDEF");
295 assertNull(PA.getValue(sq, "datasetSequence"));
296 assertEquals(1, sq.getStart());
297 assertEquals(6, sq.getEnd());
298 sq.deleteChars(2, 3);
299 assertEquals("ABDEF", sq.getSequenceAsString());
300 assertEquals(1, sq.getStart());
301 assertEquals(5, sq.getEnd());
302 assertNull(PA.getValue(sq, "datasetSequence"));
307 sq = new Sequence("test", "ABCDEF");
308 sq.deleteChars(0, 2);
309 assertEquals("CDEF", sq.getSequenceAsString());
310 assertEquals(3, sq.getStart());
311 assertEquals(6, sq.getEnd());
312 assertNull(PA.getValue(sq, "datasetSequence"));
317 sq = new Sequence("test", "ABCDEF");
318 sq.deleteChars(4, 6);
319 assertEquals("ABCD", sq.getSequenceAsString());
320 assertEquals(1, sq.getStart());
321 assertEquals(4, sq.getEnd());
322 assertNull(PA.getValue(sq, "datasetSequence"));
325 @Test(groups = { "Functional" })
326 public void testDeleteChars_withDbRefsAndFeatures()
329 * internal delete - new dataset sequence created
330 * gets a copy of any dbrefs
332 SequenceI sq = new Sequence("test", "ABCDEF");
333 sq.createDatasetSequence();
334 DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123");
336 Object ds = PA.getValue(sq, "datasetSequence");
338 assertEquals(1, sq.getStart());
339 assertEquals(6, sq.getEnd());
340 sq.deleteChars(2, 3);
341 assertEquals("ABDEF", sq.getSequenceAsString());
342 assertEquals(1, sq.getStart());
343 assertEquals(5, sq.getEnd());
344 Object newDs = PA.getValue(sq, "datasetSequence");
345 assertNotNull(newDs);
346 assertNotSame(ds, newDs);
347 assertNotNull(sq.getDBRefs());
348 assertEquals(1, sq.getDBRefs().length);
349 assertNotSame(dbr1, sq.getDBRefs()[0]);
350 assertEquals(dbr1, sq.getDBRefs()[0]);
353 * internal delete with sequence features
354 * (failure case for JAL-2541)
356 sq = new Sequence("test", "ABCDEF");
357 sq.createDatasetSequence();
358 SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f,
360 sq.addSequenceFeature(sf1);
361 ds = PA.getValue(sq, "datasetSequence");
363 assertEquals(1, sq.getStart());
364 assertEquals(6, sq.getEnd());
365 sq.deleteChars(2, 4);
366 assertEquals("ABEF", sq.getSequenceAsString());
367 assertEquals(1, sq.getStart());
368 assertEquals(4, sq.getEnd());
369 newDs = PA.getValue(sq, "datasetSequence");
370 assertNotNull(newDs);
371 assertNotSame(ds, newDs);
372 SequenceFeature[] sfs = sq.getSequenceFeatures();
374 assertEquals(1, sfs.length);
375 assertNotSame(sf1, sfs[0]);
376 assertEquals(sf1, sfs[0]);
379 * delete at start - no new dataset sequence created
380 * any sequence features remain as before
382 sq = new Sequence("test", "ABCDEF");
383 sq.createDatasetSequence();
384 ds = PA.getValue(sq, "datasetSequence");
385 sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup");
386 sq.addSequenceFeature(sf1);
387 sq.deleteChars(0, 2);
388 assertEquals("CDEF", sq.getSequenceAsString());
389 assertEquals(3, sq.getStart());
390 assertEquals(6, sq.getEnd());
391 assertSame(ds, PA.getValue(sq, "datasetSequence"));
392 sfs = sq.getSequenceFeatures();
394 assertEquals(1, sfs.length);
395 assertSame(sf1, sfs[0]);
398 * delete at end - no new dataset sequence created
399 * any dbrefs remain as before
401 sq = new Sequence("test", "ABCDEF");
402 sq.createDatasetSequence();
403 ds = PA.getValue(sq, "datasetSequence");
404 dbr1 = new DBRefEntry("Uniprot", "0", "a123");
406 sq.deleteChars(4, 6);
407 assertEquals("ABCD", sq.getSequenceAsString());
408 assertEquals(1, sq.getStart());
409 assertEquals(4, sq.getEnd());
410 assertSame(ds, PA.getValue(sq, "datasetSequence"));
411 assertNotNull(sq.getDBRefs());
412 assertEquals(1, sq.getDBRefs().length);
413 assertSame(dbr1, sq.getDBRefs()[0]);
416 @Test(groups = { "Functional" })
417 public void testInsertCharAt()
419 // non-static methods:
420 SequenceI sq = new Sequence("test", "ABCDEF");
421 sq.insertCharAt(0, 'z');
422 assertEquals("zABCDEF", sq.getSequenceAsString());
423 sq.insertCharAt(2, 2, 'x');
424 assertEquals("zAxxBCDEF", sq.getSequenceAsString());
426 // for static method see StringUtilsTest
430 * Test the method that returns an array of aligned sequence positions where
431 * the array index is the data sequence position (both base 0).
433 @Test(groups = { "Functional" })
434 public void testGapMap()
436 SequenceI sq = new Sequence("test", "-A--B-CD-E--F-");
437 sq.createDatasetSequence();
438 assertEquals("[1, 4, 6, 7, 9, 12]", Arrays.toString(sq.gapMap()));
442 * Test the method that gets sequence features, either from the sequence or
445 @Test(groups = { "Functional" })
446 public void testGetSequenceFeatures()
448 SequenceI sq = new Sequence("test", "GATCAT");
449 sq.createDatasetSequence();
451 assertNull(sq.getSequenceFeatures());
454 * SequenceFeature on sequence
456 SequenceFeature sf = new SequenceFeature();
457 sq.addSequenceFeature(sf);
458 SequenceFeature[] sfs = sq.getSequenceFeatures();
459 assertEquals(1, sfs.length);
460 assertSame(sf, sfs[0]);
463 * SequenceFeature on sequence and dataset sequence; returns that on
466 * Note JAL-2046: spurious: we have no use case for this at the moment.
467 * This test also buggy - as sf2.equals(sf), no new feature is added
469 SequenceFeature sf2 = new SequenceFeature();
470 sq.getDatasetSequence().addSequenceFeature(sf2);
471 sfs = sq.getSequenceFeatures();
472 assertEquals(1, sfs.length);
473 assertSame(sf, sfs[0]);
476 * SequenceFeature on dataset sequence only
477 * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
479 sq.setSequenceFeatures(null);
480 assertNull(sq.getDatasetSequence().getSequenceFeatures());
483 * Corrupt case - no SequenceFeature, dataset's dataset is the original
484 * sequence. Test shows no infinite loop results.
486 sq.getDatasetSequence().setSequenceFeatures(null);
488 * is there a usecase for this ? setDatasetSequence should throw an error if
489 * this actually occurs.
493 sq.getDatasetSequence().setDatasetSequence(sq); // loop!
494 Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference");
495 } catch (IllegalArgumentException e)
497 // TODO Jalview error/exception class for raising implementation errors
498 assertTrue(e.getMessage().toLowerCase()
499 .contains("implementation error"));
501 assertNull(sq.getSequenceFeatures());
505 * Test the method that returns an array, indexed by sequence position, whose
506 * entries are the residue positions at the sequence position (or to the right
509 @Test(groups = { "Functional" })
510 public void testFindPositionMap()
513 * Note: Javadoc for findPosition says it returns the residue position to
514 * the left of a gapped position; in fact it returns the position to the
515 * right. Also it returns a non-existent residue position for a gap beyond
518 Sequence sq = new Sequence("TestSeq", "AB.C-D E.");
519 int[] map = sq.findPositionMap();
520 assertEquals(Arrays.toString(new int[] { 1, 2, 3, 3, 4, 4, 5, 5, 6 }),
521 Arrays.toString(map));
525 * Test for getSubsequence
527 @Test(groups = { "Functional" })
528 public void testGetSubsequence()
530 SequenceI sq = new Sequence("TestSeq", "ABCDEFG");
531 sq.createDatasetSequence();
533 // positions are base 0, end position is exclusive
534 SequenceI subseq = sq.getSubSequence(2, 4);
536 assertEquals("CD", subseq.getSequenceAsString());
537 // start/end are base 1 positions
538 assertEquals(3, subseq.getStart());
539 assertEquals(4, subseq.getEnd());
540 // subsequence shares the full dataset sequence
541 assertSame(sq.getDatasetSequence(), subseq.getDatasetSequence());
545 * test createDatasetSequence behaves to doc
547 @Test(groups = { "Functional" })
548 public void testCreateDatasetSequence()
550 SequenceI sq = new Sequence("my", "ASDASD");
551 assertNull(sq.getDatasetSequence());
552 SequenceI rds = sq.createDatasetSequence();
554 assertNull(rds.getDatasetSequence());
555 assertEquals(sq.getDatasetSequence(), rds);
559 * Test for deriveSequence applied to a sequence with a dataset
561 @Test(groups = { "Functional" })
562 public void testDeriveSequence_existingDataset()
564 Sequence sq = new Sequence("Seq1", "CD");
565 sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF"));
566 sq.getDatasetSequence().addSequenceFeature(
567 new SequenceFeature("", "", 1, 2, 0f, null));
571 sq.setDescription("Test sequence description..");
572 sq.setVamsasId("TestVamsasId");
573 sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
575 sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
576 sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
577 sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
578 sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
580 sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
581 sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
582 sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
583 sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
585 // these are the same as ones already added
586 DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
587 DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
589 List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
592 sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
593 sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
594 sq.getDatasetSequence().addDBRef(
595 new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing
596 sq.getDatasetSequence().addDBRef(
597 new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing
599 PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
600 PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
601 PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
603 PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
605 sq.getDatasetSequence().addPDBId(pdbe1a);
606 sq.getDatasetSequence().addPDBId(pdbe1b);
607 sq.getDatasetSequence().addPDBId(pdbe2a);
608 sq.getDatasetSequence().addPDBId(pdbe2b);
611 * test we added pdb entries to the dataset sequence
613 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays
614 .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
615 "PDB Entries were not found on dataset sequence.");
618 * we should recover a pdb entry that is on the dataset sequence via PDBEntry
620 Assert.assertEquals(pdbe1a,
621 sq.getDatasetSequence().getPDBEntry("1PDB"),
622 "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
623 ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
624 System.out.println(">>>>>> " + sq.getSequenceAsString().length());
625 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
626 annotsList.add(new Annotation("A", "A", 'X', 0.1f));
627 Annotation[] annots = annotsList.toArray(new Annotation[0]);
628 sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
629 "Test annot description", annots));
630 sq.getDatasetSequence().addAlignmentAnnotation(
631 new AlignmentAnnotation("Test annot", "Test annot description",
633 Assert.assertEquals(sq.getDescription(), "Test sequence description..");
634 Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset
636 Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
637 Assert.assertNotNull(sq.getAnnotation());
638 Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
639 Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same
642 Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
644 Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
646 Sequence derived = (Sequence) sq.deriveSequence();
648 Assert.assertEquals(derived.getDescription(),
649 "Test sequence description..");
650 Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset
651 Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
652 Assert.assertNotNull(derived.getAnnotation());
653 Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
654 Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5);
655 Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
657 Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
659 assertEquals("CD", derived.getSequenceAsString());
660 assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
662 assertNull(sq.sequenceFeatures);
663 assertNull(derived.sequenceFeatures);
664 // derived sequence should access dataset sequence features
665 assertNotNull(sq.getSequenceFeatures());
666 assertArrayEquals(sq.getSequenceFeatures(),
667 derived.getSequenceFeatures());
670 * verify we have primary db refs *just* for PDB IDs with associated
674 assertEquals(primRefs, sq.getPrimaryDBRefs());
675 assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
677 assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
682 * Test for deriveSequence applied to an ungapped sequence with no dataset
684 @Test(groups = { "Functional" })
685 public void testDeriveSequence_noDatasetUngapped()
687 SequenceI sq = new Sequence("Seq1", "ABCDEF");
688 assertEquals(1, sq.getStart());
689 assertEquals(6, sq.getEnd());
690 SequenceI derived = sq.deriveSequence();
691 assertEquals("ABCDEF", derived.getSequenceAsString());
692 assertEquals("ABCDEF", derived.getDatasetSequence()
693 .getSequenceAsString());
697 * Test for deriveSequence applied to a gapped sequence with no dataset
699 @Test(groups = { "Functional" })
700 public void testDeriveSequence_noDatasetGapped()
702 SequenceI sq = new Sequence("Seq1", "AB-C.D EF");
703 assertEquals(1, sq.getStart());
704 assertEquals(6, sq.getEnd());
705 assertNull(sq.getDatasetSequence());
706 SequenceI derived = sq.deriveSequence();
707 assertEquals("AB-C.D EF", derived.getSequenceAsString());
708 assertEquals("ABCDEF", derived.getDatasetSequence()
709 .getSequenceAsString());
712 @Test(groups = { "Functional" })
713 public void testCopyConstructor_noDataset()
715 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
716 seq1.setDescription("description");
717 seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
719 seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
721 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
722 seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
724 SequenceI copy = new Sequence(seq1);
726 assertNull(copy.getDatasetSequence());
728 verifyCopiedSequence(seq1, copy);
730 // copy has a copy of the DBRefEntry
731 // this is murky - DBrefs are only copied for dataset sequences
732 // where the test for 'dataset sequence' is 'dataset is null'
733 // but that doesn't distinguish it from an aligned sequence
734 // which has not yet generated a dataset sequence
735 // NB getDBRef looks inside dataset sequence if not null
736 DBRefEntry[] dbrefs = copy.getDBRefs();
737 assertEquals(1, dbrefs.length);
738 assertFalse(dbrefs[0] == seq1.getDBRefs()[0]);
739 assertTrue(dbrefs[0].equals(seq1.getDBRefs()[0]));
742 @Test(groups = { "Functional" })
743 public void testCopyConstructor_withDataset()
745 SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
746 seq1.createDatasetSequence();
747 seq1.setDescription("description");
748 seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
750 // JAL-2046 - what is the contract for using a derived sequence's
751 // addSequenceFeature ?
752 seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
754 seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
755 // here we add DBRef to the dataset sequence:
756 seq1.getDatasetSequence().addDBRef(
757 new DBRefEntry("EMBL", "1.2", "AZ12345"));
759 SequenceI copy = new Sequence(seq1);
761 assertNotNull(copy.getDatasetSequence());
762 assertSame(copy.getDatasetSequence(), seq1.getDatasetSequence());
764 verifyCopiedSequence(seq1, copy);
766 // getDBRef looks inside dataset sequence and this is shared,
767 // so holds the same dbref objects
768 DBRefEntry[] dbrefs = copy.getDBRefs();
769 assertEquals(1, dbrefs.length);
770 assertSame(dbrefs[0], seq1.getDBRefs()[0]);
774 * Helper to make assertions about a copied sequence
779 protected void verifyCopiedSequence(SequenceI seq1, SequenceI copy)
781 // verify basic properties:
782 assertEquals(copy.getName(), seq1.getName());
783 assertEquals(copy.getDescription(), seq1.getDescription());
784 assertEquals(copy.getStart(), seq1.getStart());
785 assertEquals(copy.getEnd(), seq1.getEnd());
786 assertEquals(copy.getSequenceAsString(), seq1.getSequenceAsString());
788 // copy has a copy of the annotation:
789 AlignmentAnnotation[] anns = copy.getAnnotation();
790 assertEquals(1, anns.length);
791 assertFalse(anns[0] == seq1.getAnnotation()[0]);
792 assertEquals(anns[0].label, seq1.getAnnotation()[0].label);
793 assertEquals(anns[0].description, seq1.getAnnotation()[0].description);
794 assertEquals(anns[0].score, seq1.getAnnotation()[0].score);
796 // copy has a copy of the sequence feature:
797 SequenceFeature[] sfs = copy.getSequenceFeatures();
798 assertEquals(1, sfs.length);
799 if (seq1.getDatasetSequence() != null
800 && copy.getDatasetSequence() == seq1.getDatasetSequence())
802 assertTrue(sfs[0] == seq1.getSequenceFeatures()[0]);
806 assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
808 assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0]));
810 // copy has a copy of the PDB entry
811 Vector<PDBEntry> pdbs = copy.getAllPDBEntries();
812 assertEquals(1, pdbs.size());
813 assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0));
814 assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0)));
817 @Test(groups = "Functional")
818 public void testGetCharAt()
820 SequenceI sq = new Sequence("", "abcde");
821 assertEquals('a', sq.getCharAt(0));
822 assertEquals('e', sq.getCharAt(4));
823 assertEquals(' ', sq.getCharAt(5));
824 assertEquals(' ', sq.getCharAt(-1));
828 * Tests for adding (or updating) dbrefs
830 * @see DBRefEntry#updateFrom(DBRefEntry)
832 @Test(groups = { "Functional" })
833 public void testAddDBRef()
835 SequenceI sq = new Sequence("", "abcde");
836 assertNull(sq.getDBRefs());
837 DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
839 assertEquals(1, sq.getDBRefs().length);
840 assertSame(dbref, sq.getDBRefs()[0]);
843 * change of version - new entry
845 DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
847 assertEquals(2, sq.getDBRefs().length);
848 assertSame(dbref, sq.getDBRefs()[0]);
849 assertSame(dbref2, sq.getDBRefs()[1]);
852 * matches existing entry - not added
854 sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
855 assertEquals(2, sq.getDBRefs().length);
858 * different source = new entry
860 DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
862 assertEquals(3, sq.getDBRefs().length);
863 assertSame(dbref3, sq.getDBRefs()[2]);
866 * different ref = new entry
868 DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
870 assertEquals(4, sq.getDBRefs().length);
871 assertSame(dbref4, sq.getDBRefs()[3]);
874 * matching ref with a mapping - map updated
876 DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
877 Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
881 assertEquals(4, sq.getDBRefs().length);
882 assertSame(dbref4, sq.getDBRefs()[3]);
883 assertSame(map, dbref4.getMap());
886 * 'real' version replaces "0" version
888 dbref2.setVersion("0");
889 DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
890 dbref2.getAccessionId());
892 assertEquals(4, sq.getDBRefs().length);
893 assertSame(dbref2, sq.getDBRefs()[1]);
894 assertEquals("3", dbref2.getVersion());
897 * 'real' version replaces "source:0" version
899 dbref3.setVersion("Uniprot:0");
900 DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
901 dbref3.getAccessionId());
903 assertEquals(4, sq.getDBRefs().length);
904 assertSame(dbref3, sq.getDBRefs()[2]);
905 assertEquals("3", dbref2.getVersion());
908 @Test(groups = { "Functional" })
909 public void testGetPrimaryDBRefs_peptide()
911 SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
914 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
915 assertTrue(primaryDBRefs.isEmpty());
918 sq.setDBRefs(new DBRefEntry[] {});
919 primaryDBRefs = sq.getPrimaryDBRefs();
920 assertTrue(primaryDBRefs.isEmpty());
923 DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
924 sq.addDBRef(upentry1);
926 // primary - uniprot with congruent map
927 DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
928 upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
929 new int[] { 10, 22 }, 1, 1)));
930 sq.addDBRef(upentry2);
932 // primary - uniprot with map of enclosing sequence
933 DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
934 upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
935 new int[] { 8, 24 }, 1, 1)));
936 sq.addDBRef(upentry3);
938 // not primary - uniprot with map of sub-sequence (5')
939 DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
940 upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
941 new int[] { 10, 18 }, 1, 1)));
942 sq.addDBRef(upentry4);
944 // not primary - uniprot with map that overlaps 3'
945 DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
946 upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
947 new int[] { 12, 22 }, 1, 1)));
948 sq.addDBRef(upentry5);
950 // not primary - uniprot with map to different coordinates frame
951 DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
952 upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
953 new int[] { 112, 118 }, 1, 1)));
954 sq.addDBRef(upentry6);
956 // not primary - dbref to 'non-core' database
957 DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
958 sq.addDBRef(upentry7);
960 // primary - type is PDB
961 DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
962 sq.addDBRef(pdbentry);
964 // not primary - PDBEntry has no file
965 sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
967 // not primary - no PDBEntry
968 sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
970 // add corroborating PDB entry for primary DBref -
971 // needs to have a file as well as matching ID
972 // note PDB ID is not treated as case sensitive
973 sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
976 // not valid DBRef - no file..
977 sq.addPDBId(new PDBEntry("1AAA", null, null, null));
979 primaryDBRefs = sq.getPrimaryDBRefs();
980 assertEquals(4, primaryDBRefs.size());
981 assertTrue("Couldn't find simple primary reference (UNIPROT)",
982 primaryDBRefs.contains(upentry1));
983 assertTrue("Couldn't find mapped primary reference (UNIPROT)",
984 primaryDBRefs.contains(upentry2));
985 assertTrue("Couldn't find mapped context reference (UNIPROT)",
986 primaryDBRefs.contains(upentry3));
987 assertTrue("Couldn't find expected PDB primary reference",
988 primaryDBRefs.contains(pdbentry));
991 @Test(groups = { "Functional" })
992 public void testGetPrimaryDBRefs_nucleotide()
994 SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
997 DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
1000 // not primary - Ensembl 'transcript' mapping of sub-sequence
1001 DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
1002 dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
1003 new int[] { 1, 11 }, 1, 1)));
1006 // primary - EMBL with congruent map
1007 DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
1008 dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
1009 new int[] { 10, 34 }, 1, 1)));
1012 // not primary - to non-core database
1013 DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
1016 // not primary - to protein
1017 DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
1020 List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
1021 assertEquals(2, primaryDBRefs.size());
1022 assertTrue(primaryDBRefs.contains(dbr1));
1023 assertTrue(primaryDBRefs.contains(dbr3));
1027 * Test the method that updates the list of PDBEntry from any new DBRefEntry
1030 @Test(groups = { "Functional" })
1031 public void testUpdatePDBIds()
1033 PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
1034 seq.addPDBId(pdbe1);
1035 seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
1036 seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
1037 seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
1038 seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
1039 // 7 is not a valid chain code:
1040 seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
1043 List<PDBEntry> pdbIds = seq.getAllPDBEntries();
1044 assertEquals(4, pdbIds.size());
1045 assertSame(pdbe1, pdbIds.get(0));
1046 // chain code got added to 3A6S:
1047 assertEquals("B", pdbe1.getChainCode());
1048 assertEquals("1A70", pdbIds.get(1).getId());
1049 // 4BQGA is parsed into id + chain
1050 assertEquals("4BQG", pdbIds.get(2).getId());
1051 assertEquals("a", pdbIds.get(2).getChainCode());
1052 assertEquals("2GIS7", pdbIds.get(3).getId());
1053 assertNull(pdbIds.get(3).getChainCode());
1057 * Test the method that either adds a pdbid or updates an existing one
1059 @Test(groups = { "Functional" })
1060 public void testAddPDBId()
1062 PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
1064 assertEquals(1, seq.getAllPDBEntries().size());
1065 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1066 assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
1068 // add the same entry
1070 assertEquals(1, seq.getAllPDBEntries().size());
1071 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1073 // add an identical entry
1074 seq.addPDBId(new PDBEntry("3A6S", null, null, null));
1075 assertEquals(1, seq.getAllPDBEntries().size());
1076 assertSame(pdbe, seq.getPDBEntry("3A6S"));
1078 // add a different entry
1079 PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
1080 seq.addPDBId(pdbe2);
1081 assertEquals(2, seq.getAllPDBEntries().size());
1082 assertSame(pdbe, seq.getAllPDBEntries().get(0));
1083 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1085 // update pdbe with chain code, file, type
1086 PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
1087 seq.addPDBId(pdbe3);
1088 assertEquals(2, seq.getAllPDBEntries().size());
1089 assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
1090 assertEquals("3A6S", pdbe.getId()); // unchanged
1091 assertEquals("A", pdbe.getChainCode()); // updated
1092 assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
1093 assertEquals("filepath", pdbe.getFile()); // updated
1094 assertSame(pdbe2, seq.getAllPDBEntries().get(1));
1096 // add with a different file path
1097 PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
1098 seq.addPDBId(pdbe4);
1099 assertEquals(3, seq.getAllPDBEntries().size());
1100 assertSame(pdbe4, seq.getAllPDBEntries().get(2));
1102 // add with a different chain code
1103 PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
1104 seq.addPDBId(pdbe5);
1105 assertEquals(4, seq.getAllPDBEntries().size());
1106 assertSame(pdbe5, seq.getAllPDBEntries().get(3));
1110 groups = { "Functional" },
1111 expectedExceptions = { IllegalArgumentException.class })
1112 public void testSetDatasetSequence_toSelf()
1114 seq.setDatasetSequence(seq);
1118 groups = { "Functional" },
1119 expectedExceptions = { IllegalArgumentException.class })
1120 public void testSetDatasetSequence_cascading()
1122 SequenceI seq2 = new Sequence("Seq2", "xyz");
1123 seq2.createDatasetSequence();
1124 seq.setDatasetSequence(seq2);