1 package jalview.io.vcf;
3 import static org.testng.Assert.assertEquals;
5 import jalview.bin.Cache;
6 import jalview.datamodel.AlignmentI;
7 import jalview.datamodel.DBRefEntry;
8 import jalview.datamodel.Mapping;
9 import jalview.datamodel.Sequence;
10 import jalview.datamodel.SequenceFeature;
11 import jalview.datamodel.SequenceI;
12 import jalview.datamodel.features.SequenceFeatures;
13 import jalview.gui.AlignFrame;
14 import jalview.io.DataSourceType;
15 import jalview.io.FileLoader;
16 import jalview.io.gff.Gff3Helper;
17 import jalview.io.gff.SequenceOntologyI;
18 import jalview.util.MapList;
21 import java.io.IOException;
22 import java.io.PrintWriter;
23 import java.util.List;
26 import org.testng.annotations.BeforeClass;
27 import org.testng.annotations.Test;
29 public class VCFLoaderTest
31 private static final float DELTA = 0.00001f;
33 // columns 9717- of gene P30419 from Ensembl (much modified)
34 private static final String FASTA = ""
37 * forward strand 'gene' and 'transcript' with two exons
39 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
40 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
41 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
44 * reverse strand gene and transcript (reverse complement alleles!)
46 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
47 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
48 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
51 * 'gene' on chromosome 5 with two transcripts
53 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
54 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
55 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
56 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
58 private static final String[] VCF = { "##fileformat=VCFv4.2",
59 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
60 "##reference=Homo_sapiens/GRCh38",
61 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
62 // A/T,C variants in position 2 of gene sequence (precedes transcript)
63 // should create 2 variant features with respective scores
64 "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
65 // SNP G/C in position 4 of gene sequence, position 2 of transcript
66 // insertion G/GA is transferred to nucleotide but not to peptide
67 "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" };
73 * configure to capture all available VCF and VEP (CSQ) fields
75 Cache.loadProperties("test/jalview/io/testProps.jvprops");
76 Cache.setProperty("VCF_FIELDS", ".*");
77 Cache.setProperty("VEP_FIELDS", ".*");
80 @Test(groups = "Functional")
81 public void testDoLoad() throws IOException
83 AlignmentI al = buildAlignment();
84 VCFLoader loader = new VCFLoader(al);
88 loader.doLoad(f.getPath(), null);
91 * verify variant feature(s) added to gene
92 * NB alleles at a locus may not be processed, and features added,
93 * in the order in which they appear in the VCF record as method
94 * VariantContext.getAlternateAlleles() does not guarantee order
95 * - order of assertions here matches what we find (is not important)
97 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
98 .getSequenceFeatures();
99 SequenceFeatures.sortFeatures(geneFeatures, true);
100 assertEquals(geneFeatures.size(), 4);
101 SequenceFeature sf = geneFeatures.get(0);
102 assertEquals(sf.getFeatureGroup(), "VCF");
103 assertEquals(sf.getBegin(), 2);
104 assertEquals(sf.getEnd(), 2);
105 assertEquals(sf.getScore(), 4.0e-03, DELTA);
106 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
107 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
108 sf = geneFeatures.get(1);
109 assertEquals(sf.getFeatureGroup(), "VCF");
110 assertEquals(sf.getBegin(), 2);
111 assertEquals(sf.getEnd(), 2);
112 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
113 assertEquals(sf.getScore(), 5.0e-03, DELTA);
114 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
116 sf = geneFeatures.get(2);
117 assertEquals(sf.getFeatureGroup(), "VCF");
118 assertEquals(sf.getBegin(), 4);
119 assertEquals(sf.getEnd(), 4);
120 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
121 assertEquals(sf.getScore(), 2.0e-03, DELTA);
122 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
124 sf = geneFeatures.get(3);
125 assertEquals(sf.getFeatureGroup(), "VCF");
126 assertEquals(sf.getBegin(), 4);
127 assertEquals(sf.getEnd(), 4);
128 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
129 assertEquals(sf.getScore(), 3.0e-03, DELTA);
130 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
133 * verify variant feature(s) added to transcript
135 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
136 .getSequenceFeatures();
137 assertEquals(transcriptFeatures.size(), 2);
138 sf = transcriptFeatures.get(0);
139 assertEquals(sf.getFeatureGroup(), "VCF");
140 assertEquals(sf.getBegin(), 2);
141 assertEquals(sf.getEnd(), 2);
142 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
143 assertEquals(sf.getScore(), 2.0e-03, DELTA);
144 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
145 sf = transcriptFeatures.get(1);
146 assertEquals(sf.getFeatureGroup(), "VCF");
147 assertEquals(sf.getBegin(), 2);
148 assertEquals(sf.getEnd(), 2);
149 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
150 assertEquals(sf.getScore(), 3.0e-03, DELTA);
151 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
154 * verify SNP variant feature(s) computed and added to protein
155 * first codon AGC varies to ACC giving S/T
157 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
158 SequenceI peptide = null;
159 for (DBRefEntry dbref : dbRefs)
161 if (dbref.getMap().getMap().getFromRatio() == 3)
163 peptide = dbref.getMap().getTo();
166 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
167 assertEquals(proteinFeatures.size(), 1);
168 sf = proteinFeatures.get(0);
169 assertEquals(sf.getFeatureGroup(), "VCF");
170 assertEquals(sf.getBegin(), 1);
171 assertEquals(sf.getEnd(), 1);
172 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
173 assertEquals(sf.getDescription(), "p.Ser1Thr");
176 private File makeVcf() throws IOException
178 File f = File.createTempFile("Test", ".vcf");
180 PrintWriter pw = new PrintWriter(f);
181 for (String vcfLine : VCF)
190 * Make a simple alignment with one 'gene' and one 'transcript'
194 private AlignmentI buildAlignment()
196 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
197 DataSourceType.PASTE);
200 * map gene1 sequence to chromosome (normally done when the sequence is fetched
201 * from Ensembl and transcripts computed)
203 AlignmentI alignment = af.getViewport().getAlignment();
204 SequenceI gene1 = alignment.findName("gene1");
205 int[] to = new int[] { 45051610, 45051634 };
206 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
207 gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
211 * map 'transcript1' to chromosome via 'gene1'
212 * transcript1/1-18 is gene1/3-10,15-24
213 * which is chromosome 45051612-45051619,45051624-45051633
215 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
216 SequenceI transcript1 = alignment.findName("transcript1");
217 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
218 transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
223 * map gene2 to chromosome reverse strand
225 SequenceI gene2 = alignment.findName("gene2");
226 to = new int[] { 45051634, 45051610 };
227 from = new int[] { gene2.getStart(), gene2.getEnd() };
228 gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
232 * map 'transcript2' to chromosome via 'gene2'
233 * transcript2/1-18 is gene2/2-11,16-23
234 * which is chromosome 45051633-45051624,45051619-45051612
236 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
237 SequenceI transcript2 = alignment.findName("transcript2");
238 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
239 transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
244 * add a protein product as a DBRef on transcript1
246 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
247 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
249 Mapping map = new Mapping(peptide1, mapList);
250 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
251 transcript1.addDBRef(product);
254 * add a protein product as a DBRef on transcript2
256 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
257 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
258 map = new Mapping(peptide2, mapList);
259 product = new DBRefEntry("", "", "ENSP002", map);
260 transcript2.addDBRef(product);
263 * map gene3 to chromosome
265 SequenceI gene3 = alignment.findName("gene3");
266 to = new int[] { 45051610, 45051634 };
267 from = new int[] { gene3.getStart(), gene3.getEnd() };
268 gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
272 * map 'transcript3' to chromosome
274 SequenceI transcript3 = alignment.findName("transcript3");
275 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
276 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
277 transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
282 * map 'transcript4' to chromosome
284 SequenceI transcript4 = alignment.findName("transcript4");
285 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
287 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
288 transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
293 * add a protein product as a DBRef on transcript3
295 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
296 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
297 map = new Mapping(peptide3, mapList);
298 product = new DBRefEntry("", "", "ENSP003", map);
299 transcript3.addDBRef(product);
305 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
306 * chromosome. The VCF variant positions (in forward coordinates) should get
307 * correctly located on sequence positions.
309 * @throws IOException
311 @Test(groups = "Functional")
312 public void testDoLoad_reverseStrand() throws IOException
314 AlignmentI al = buildAlignment();
316 VCFLoader loader = new VCFLoader(al);
320 loader.doLoad(f.getPath(), null);
323 * verify variant feature(s) added to gene2
324 * gene2/1-25 maps to chromosome 45051634- reverse strand
326 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
327 .getSequenceFeatures();
328 SequenceFeatures.sortFeatures(geneFeatures, true);
329 assertEquals(geneFeatures.size(), 4);
332 * variant A/T at 45051611 maps to T/A at gene position 24
334 SequenceFeature sf = geneFeatures.get(3);
335 assertEquals(sf.getFeatureGroup(), "VCF");
336 assertEquals(sf.getBegin(), 24);
337 assertEquals(sf.getEnd(), 24);
338 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
339 assertEquals(sf.getScore(), 5.0e-03, DELTA);
340 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
343 * variant A/C at 45051611 maps to T/G at gene position 24
345 sf = geneFeatures.get(2);
346 assertEquals(sf.getFeatureGroup(), "VCF");
347 assertEquals(sf.getBegin(), 24);
348 assertEquals(sf.getEnd(), 24);
349 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
350 assertEquals(sf.getScore(), 4.0e-03, DELTA);
351 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
354 * variant G/C at 45051613 maps to C/G at gene position 22
356 sf = geneFeatures.get(1);
357 assertEquals(sf.getFeatureGroup(), "VCF");
358 assertEquals(sf.getBegin(), 22);
359 assertEquals(sf.getEnd(), 22);
360 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
361 assertEquals(sf.getScore(), 2.0e-03, DELTA);
362 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
365 * insertion G/GA at 45051613 maps to an insertion at
366 * the preceding position (21) on reverse strand gene
367 * reference: CAAGC -> GCTTG/21-25
368 * genomic variant: CAAGAC (G/GA)
369 * gene variant: GTCTTG (G/GT at 21)
371 sf = geneFeatures.get(0);
372 assertEquals(sf.getFeatureGroup(), "VCF");
373 assertEquals(sf.getBegin(), 21);
374 assertEquals(sf.getEnd(), 21);
375 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
376 assertEquals(sf.getScore(), 3.0e-03, DELTA);
377 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
380 * verify 2 variant features added to transcript2
382 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
383 .getSequenceFeatures();
384 assertEquals(transcriptFeatures.size(), 2);
387 * insertion G/GT at position 21 of gene maps to position 16 of transcript
389 sf = transcriptFeatures.get(0);
390 assertEquals(sf.getFeatureGroup(), "VCF");
391 assertEquals(sf.getBegin(), 16);
392 assertEquals(sf.getEnd(), 16);
393 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
394 assertEquals(sf.getScore(), 3.0e-03, DELTA);
395 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
398 * SNP C/G at position 22 of gene maps to position 17 of transcript
400 sf = transcriptFeatures.get(1);
401 assertEquals(sf.getFeatureGroup(), "VCF");
402 assertEquals(sf.getBegin(), 17);
403 assertEquals(sf.getEnd(), 17);
404 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
405 assertEquals(sf.getScore(), 2.0e-03, DELTA);
406 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
409 * verify variant feature(s) computed and added to protein
410 * last codon GCT varies to GGT giving A/G in the last peptide position
412 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
413 SequenceI peptide = null;
414 for (DBRefEntry dbref : dbRefs)
416 if (dbref.getMap().getMap().getFromRatio() == 3)
418 peptide = dbref.getMap().getTo();
421 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
422 assertEquals(proteinFeatures.size(), 1);
423 sf = proteinFeatures.get(0);
424 assertEquals(sf.getFeatureGroup(), "VCF");
425 assertEquals(sf.getBegin(), 6);
426 assertEquals(sf.getEnd(), 6);
427 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
428 assertEquals(sf.getDescription(), "p.Ala6Gly");
432 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
433 * it is added to the variant feature, but restricted where possible to the
434 * consequences for a specific transcript
436 * @throws IOException
438 @Test(groups = "Functional")
439 public void testDoLoad_vepCsq() throws IOException
441 AlignmentI al = buildAlignment();
443 VCFLoader loader = new VCFLoader(al);
446 * VCF data file with variants at gene3 positions
451 * 17 A/AC (insertion), A/G
453 loader.doLoad("test/jalview/io/vcf/testVcf.dat", null);
456 * verify variant feature(s) added to gene3
458 List<SequenceFeature> geneFeatures = al.findName("gene3")
459 .getSequenceFeatures();
460 SequenceFeatures.sortFeatures(geneFeatures, true);
461 assertEquals(geneFeatures.size(), 7);
462 SequenceFeature sf = geneFeatures.get(0);
463 assertEquals(sf.getBegin(), 1);
464 assertEquals(sf.getEnd(), 1);
465 assertEquals(sf.getScore(), 0.1f, DELTA);
466 assertEquals(sf.getValue("alleles"), "C,A");
467 // gene features include Consequence for all transcripts
468 Map map = (Map) sf.getValue("CSQ");
469 assertEquals(map.size(), 9);
471 sf = geneFeatures.get(1);
472 assertEquals(sf.getBegin(), 5);
473 assertEquals(sf.getEnd(), 5);
474 assertEquals(sf.getScore(), 0.2f, DELTA);
475 assertEquals(sf.getValue("alleles"), "C,T");
476 map = (Map) sf.getValue("CSQ");
477 assertEquals(map.size(), 9);
479 sf = geneFeatures.get(2);
480 assertEquals(sf.getBegin(), 9);
481 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
482 assertEquals(sf.getScore(), 0.3f, DELTA);
483 assertEquals(sf.getValue("alleles"), "CGG,C");
484 map = (Map) sf.getValue("CSQ");
485 assertEquals(map.size(), 9);
487 sf = geneFeatures.get(3);
488 assertEquals(sf.getBegin(), 13);
489 assertEquals(sf.getEnd(), 13);
490 assertEquals(sf.getScore(), 0.5f, DELTA);
491 assertEquals(sf.getValue("alleles"), "C,T");
492 map = (Map) sf.getValue("CSQ");
493 assertEquals(map.size(), 9);
495 sf = geneFeatures.get(4);
496 assertEquals(sf.getBegin(), 13);
497 assertEquals(sf.getEnd(), 13);
498 assertEquals(sf.getScore(), 0.4f, DELTA);
499 assertEquals(sf.getValue("alleles"), "C,G");
500 map = (Map) sf.getValue("CSQ");
501 assertEquals(map.size(), 9);
503 sf = geneFeatures.get(5);
504 assertEquals(sf.getBegin(), 17);
505 assertEquals(sf.getEnd(), 17);
506 assertEquals(sf.getScore(), 0.7f, DELTA);
507 assertEquals(sf.getValue("alleles"), "A,G");
508 map = (Map) sf.getValue("CSQ");
509 assertEquals(map.size(), 9);
511 sf = geneFeatures.get(6);
512 assertEquals(sf.getBegin(), 17);
513 assertEquals(sf.getEnd(), 17); // insertion
514 assertEquals(sf.getScore(), 0.6f, DELTA);
515 assertEquals(sf.getValue("alleles"), "A,AC");
516 map = (Map) sf.getValue("CSQ");
517 assertEquals(map.size(), 9);
520 * verify variant feature(s) added to transcript3
521 * at columns 5 (1), 17 (2), positions 3, 11
522 * note the deletion at columns 9-11 is not transferred since col 11
523 * has no mapping to transcript 3
525 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
526 .getSequenceFeatures();
527 SequenceFeatures.sortFeatures(transcriptFeatures, true);
528 assertEquals(transcriptFeatures.size(), 3);
529 sf = transcriptFeatures.get(0);
530 assertEquals(sf.getBegin(), 3);
531 assertEquals(sf.getEnd(), 3);
532 assertEquals(sf.getScore(), 0.2f, DELTA);
533 assertEquals(sf.getValue("alleles"), "C,T");
534 // transcript features only have Consequence for that transcripts
535 map = (Map) sf.getValue("CSQ");
536 assertEquals(map.size(), 9);
537 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
539 sf = transcriptFeatures.get(1);
540 assertEquals(sf.getBegin(), 11);
541 assertEquals(sf.getEnd(), 11);
542 assertEquals(sf.getScore(), 0.7f, DELTA);
543 assertEquals(sf.getValue("alleles"), "A,G");
544 assertEquals(map.size(), 9);
545 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
547 sf = transcriptFeatures.get(2);
548 assertEquals(sf.getBegin(), 11);
549 assertEquals(sf.getEnd(), 11);
550 assertEquals(sf.getScore(), 0.6f, DELTA);
551 assertEquals(sf.getValue("alleles"), "A,AC");
552 assertEquals(map.size(), 9);
553 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
556 * verify variants computed on protein product for transcript3
558 * codon variants are AGC/AGT position 1 which is synonymous
559 * and GAG/GGG which is E/G in position 4
560 * the insertion variant is not transferred to the peptide
562 DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
563 SequenceI peptide = null;
564 for (DBRefEntry dbref : dbRefs)
566 if (dbref.getMap().getMap().getFromRatio() == 3)
568 peptide = dbref.getMap().getTo();
571 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
572 assertEquals(proteinFeatures.size(), 1);
573 sf = proteinFeatures.get(0);
574 assertEquals(sf.getFeatureGroup(), "VCF");
575 assertEquals(sf.getBegin(), 4);
576 assertEquals(sf.getEnd(), 4);
577 assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
578 assertEquals(sf.getDescription(), "p.Glu4Gly");
581 * verify variant feature(s) added to transcript4
582 * at columns 13 (2) and 17 (2), positions 7 and 11
584 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
585 SequenceFeatures.sortFeatures(transcriptFeatures, true);
586 assertEquals(transcriptFeatures.size(), 4);
587 sf = transcriptFeatures.get(0);
588 assertEquals(sf.getBegin(), 7);
589 assertEquals(sf.getEnd(), 7);
590 assertEquals(sf.getScore(), 0.5f, DELTA);
591 assertEquals(sf.getValue("alleles"), "C,T");
592 assertEquals(map.size(), 9);
593 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
595 sf = transcriptFeatures.get(1);
596 assertEquals(sf.getBegin(), 7);
597 assertEquals(sf.getEnd(), 7);
598 assertEquals(sf.getScore(), 0.4f, DELTA);
599 assertEquals(sf.getValue("alleles"), "C,G");
600 assertEquals(map.size(), 9);
601 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
603 sf = transcriptFeatures.get(2);
604 assertEquals(sf.getBegin(), 11);
605 assertEquals(sf.getEnd(), 11);
606 assertEquals(sf.getScore(), 0.7f, DELTA);
607 assertEquals(sf.getValue("alleles"), "A,G");
608 assertEquals(map.size(), 9);
609 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
611 sf = transcriptFeatures.get(3);
612 assertEquals(sf.getBegin(), 11);
613 assertEquals(sf.getEnd(), 11);
614 assertEquals(sf.getScore(), 0.6f, DELTA);
615 assertEquals(sf.getValue("alleles"), "A,AC");
616 assertEquals(map.size(), 9);
617 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");