import jalview.datamodel.PDBEntry.Type;
import jalview.util.MapList;
+import java.io.File;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version1", "2PDB");
- //FIXME pdb2pdb's matching PDBEntry has Type.MMCIF - but 2.10 only has PDBEntry with type==PDB to indicate ID is a real PDB entry
- List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb });
+ List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
+ pdb2pdb });
sq.getDatasetSequence().addDBRef(pdb1pdb);
sq.getDatasetSequence().addDBRef(pdb2pdb);
}
@Test(groups = { "Functional" })
- public void testGetPrimaryDBRefs()
+ public void testGetPrimaryDBRefs_peptide()
{
- /*
- * test PDB relationships for for getPrimaryDBRefs
- */
- SequenceI seq = new Sequence("aseq", "ASDF");
- DBRefEntry upentry = new DBRefEntry("UNIPROT", "0", "1qip");
+ SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
+
+ // no dbrefs
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
+ // empty dbrefs
+ sq.setDBRefs(new DBRefEntry[] {});
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertTrue(primaryDBRefs.isEmpty());
+
// primary - uniprot
- seq.addDBRef(upentry);
+ DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
+ sq.addDBRef(upentry1);
+
+ // primary - uniprot with congruent map
+ DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
+ upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
+ new int[] { 10, 22 }, 1, 1)));
+ sq.addDBRef(upentry2);
+
+ // primary - uniprot with map of enclosing sequence
+ DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
+ upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
+ new int[] { 8, 24 }, 1, 1)));
+ sq.addDBRef(upentry3);
+
+ // not primary - uniprot with map of sub-sequence (5')
+ DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
+ upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
+ new int[] { 10, 18 }, 1, 1)));
+ sq.addDBRef(upentry4);
+
+ // not primary - uniprot with map that overlaps 3'
+ DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
+ upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
+ new int[] { 12, 22 }, 1, 1)));
+ sq.addDBRef(upentry5);
+
+ // not primary - uniprot with map to different coordinates frame
+ DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
+ upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
+ new int[] { 112, 118 }, 1, 1)));
+ sq.addDBRef(upentry6);
+
+ // not primary - dbref to 'non-core' database
+ DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
+ sq.addDBRef(upentry7);
+
// primary - type is PDB
DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
- seq.addDBRef(pdbentry);
- // not primary - type of PDBEntry is not PDB
- seq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+ sq.addDBRef(pdbentry);
+
+ // not primary - PDBEntry has no file
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+
// not primary - no PDBEntry
- seq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
- seq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, null));
- seq.addPDBId(new PDBEntry("1AAA", null, null, null));
- assertTrue("Couldn't find simple primary reference (UNIPROT)", seq
- .getPrimaryDBRefs().contains(upentry));
- assertTrue("Couldn't find expected PDB primary reference", seq
- .getPrimaryDBRefs().contains(pdbentry));
- assertEquals(2, seq.getPrimaryDBRefs().size());
+ sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
+
+ // add corroborating PDB entry for primary DBref -
+ // needs to have a file as well as matching ID
+ // note PDB ID is not treated as case sensitive
+ sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
+ .toString()));
+
+ // not valid DBRef - no file..
+ sq.addPDBId(new PDBEntry("1AAA", null, null, null));
+
+ primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(4, primaryDBRefs.size());
+ assertTrue("Couldn't find simple primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry1));
+ assertTrue("Couldn't find mapped primary reference (UNIPROT)",
+ primaryDBRefs.contains(upentry2));
+ assertTrue("Couldn't find mapped context reference (UNIPROT)",
+ primaryDBRefs.contains(upentry3));
+ assertTrue("Couldn't find expected PDB primary reference",
+ primaryDBRefs.contains(pdbentry));
+ }
+
+ @Test(groups = { "Functional" })
+ public void testGetPrimaryDBRefs_nucleotide()
+ {
+ SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
+
+ // primary - Ensembl
+ DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
+ sq.addDBRef(dbr1);
+
+ // not primary - Ensembl 'transcript' mapping of sub-sequence
+ DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
+ dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
+ new int[] { 1, 11 }, 1, 1)));
+ sq.addDBRef(dbr2);
+
+ // primary - EMBL with congruent map
+ DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
+ dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
+ new int[] { 10, 34 }, 1, 1)));
+ sq.addDBRef(dbr3);
+
+ // not primary - to non-core database
+ DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
+ sq.addDBRef(dbr4);
+
+ // not primary - to protein
+ DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
+ sq.addDBRef(dbr5);
+
+ List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+ assertEquals(2, primaryDBRefs.size());
+ assertTrue(primaryDBRefs.contains(dbr1));
+ assertTrue(primaryDBRefs.contains(dbr3));
}
}