JAL-2106 increased coverage for testGetPrimaryDbRefs

diff --git a/src/jalview/datamodel/Sequence.java b/src/jalview/datamodel/Sequence.java
index 0018ea1..b50e5af 100755 (executable)
--- a/src/jalview/datamodel/Sequence.java
+++ b/src/jalview/datamodel/Sequence.java
@@ -28,6 +28,7 @@ import jalview.util.StringUtils;
 
 import java.util.ArrayList;
 import java.util.Arrays;
+import java.util.Collections;
 import java.util.Enumeration;
 import java.util.List;
 import java.util.Vector;
@@ -1422,12 +1423,12 @@ public class Sequence extends ASequence implements SequenceI
     }
     if (dbrefs==null || dbrefs.length==0)
     {
-      return Arrays.asList(new DBRefEntry[0]);
+      return Collections.emptyList();
     }
     synchronized (dbrefs)
     {
       List<DBRefEntry> primaries = new ArrayList<DBRefEntry>();
-      DBRefEntry tmp[] = new DBRefEntry[1], res[] = null;
+      DBRefEntry[] tmp = new DBRefEntry[1];
       for (DBRefEntry ref : dbrefs)
       {
         if (!ref.isPrimary())
@@ -1462,7 +1463,7 @@ public class Sequence extends ASequence implements SequenceI
         }
         // check standard protein or dna sources
         tmp[0] = ref;
-        res = DBRefUtils.selectDbRefs(!isProtein(), tmp);
+        DBRefEntry[] res = DBRefUtils.selectDbRefs(!isProtein(), tmp);
         if (res != null && res[0] == tmp[0])
         {
           primaries.add(ref);

diff --git a/test/jalview/datamodel/SequenceTest.java b/test/jalview/datamodel/SequenceTest.java
index 0a1ca67..c7e53a9 100644 (file)
--- a/test/jalview/datamodel/SequenceTest.java
+++ b/test/jalview/datamodel/SequenceTest.java
@@ -768,32 +768,120 @@ public class SequenceTest
   }
 
   @Test(groups = { "Functional" })
-  public void testGetPrimaryDBRefs()
+  public void testGetPrimaryDBRefs_peptide()
   {
-    /*
-     * test PDB relationships for for getPrimaryDBRefs
-     */
-    SequenceI seq = new Sequence("aseq", "ASDF");
-    DBRefEntry upentry = new DBRefEntry("UNIPROT", "0", "1qip");
+    SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
+
+    // no dbrefs
+    List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+    assertTrue(primaryDBRefs.isEmpty());
+
+    // empty dbrefs
+    sq.setDBRefs(new DBRefEntry[] {});
+    primaryDBRefs = sq.getPrimaryDBRefs();
+    assertTrue(primaryDBRefs.isEmpty());
+
     // primary - uniprot
-    seq.addDBRef(upentry);
+    DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
+    sq.addDBRef(upentry1);
+
+    // primary - uniprot with congruent map
+    DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
+    upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
+            new int[] { 10, 22 }, 1, 1)));
+    sq.addDBRef(upentry2);
+
+    // primary - uniprot with map of enclosing sequence
+    DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
+    upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
+            new int[] { 8, 24 }, 1, 1)));
+    sq.addDBRef(upentry3);
+
+    // not primary - uniprot with map of sub-sequence (5')
+    DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
+    upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
+            new int[] { 10, 18 }, 1, 1)));
+    sq.addDBRef(upentry4);
+
+    // not primary - uniprot with map that overlaps 3'
+    DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
+    upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
+            new int[] { 12, 22 }, 1, 1)));
+    sq.addDBRef(upentry5);
+
+    // not primary - uniprot with map to different coordinates frame
+    DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
+    upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
+            new int[] { 112, 118 }, 1, 1)));
+    sq.addDBRef(upentry6);
+
+    // not primary - dbref to 'non-core' database
+    DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
+    sq.addDBRef(upentry7);
+
     // primary - type is PDB
     DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
-    seq.addDBRef(pdbentry);
+    sq.addDBRef(pdbentry);
+
     // not primary - PDBEntry has no file
-    seq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+    sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+
     // not primary - no PDBEntry
-    seq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
-    // add corroborating PDB entry for primary DBref - needs to have a file as
-    // well as matching ID
-    seq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
+    sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
+
+    // add corroborating PDB entry for primary DBref -
+    // needs to have a file as well as matching ID
+    // note PDB ID is not treated as case sensitive
+    sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
             .toString()));
+
     // not valid DBRef - no file..
-    seq.addPDBId(new PDBEntry("1AAA", null, null, null));
-    assertTrue("Couldn't find simple primary reference (UNIPROT)", seq
-            .getPrimaryDBRefs().contains(upentry));
-    assertTrue("Couldn't find expected PDB primary reference", seq
-            .getPrimaryDBRefs().contains(pdbentry));
-    assertEquals(2, seq.getPrimaryDBRefs().size());
+    sq.addPDBId(new PDBEntry("1AAA", null, null, null));
+
+    primaryDBRefs = sq.getPrimaryDBRefs();
+    assertEquals(4, primaryDBRefs.size());
+    assertTrue("Couldn't find simple primary reference (UNIPROT)",
+            primaryDBRefs.contains(upentry1));
+    assertTrue("Couldn't find mapped primary reference (UNIPROT)",
+            primaryDBRefs.contains(upentry2));
+    assertTrue("Couldn't find mapped context reference (UNIPROT)",
+            primaryDBRefs.contains(upentry3));
+    assertTrue("Couldn't find expected PDB primary reference",
+            primaryDBRefs.contains(pdbentry));
+  }
+
+  @Test(groups = { "Functional" })
+  public void testGetPrimaryDBRefs_nucleotide()
+  {
+    SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
+  
+    // primary - Ensembl
+    DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
+    sq.addDBRef(dbr1);
+  
+    // not primary - Ensembl 'transcript' mapping of sub-sequence
+    DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
+    dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
+            new int[] { 1, 11 }, 1, 1)));
+    sq.addDBRef(dbr2);
+
+    // primary - EMBL with congruent map
+    DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
+    dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
+            new int[] { 10, 34 }, 1, 1)));
+    sq.addDBRef(dbr3);
+
+    // not primary - to non-core database
+    DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
+    sq.addDBRef(dbr4);
+
+    // not primary - to protein
+    DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
+    sq.addDBRef(dbr5);
+  
+    List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+    assertEquals(2, primaryDBRefs.size());
+    assertTrue(primaryDBRefs.contains(dbr1));
+    assertTrue(primaryDBRefs.contains(dbr3));
   }
 }