JAL-2113 JAL-1919 mmcif/pdb configurable retrieval from EBI/PDBe - verfied as working
<!--
History: Originally created from EMBL_common_V1.0
Updated on 24th April 2007 for WsDBFetch Service move to EMBL_Services_V1.1.xsd
+ Updated May 2016 for EMBL XML 1.2 JAL-2113 JAL-2114
+ see ftp://ftp.sra.ebi.ac.uk/meta/xsd/sra_1_5/ENA.embl.xsd
+ see http://www.ebi.ac.uk/ena/submit/data-formats
-->
<class name="jalview.datamodel.xdb.embl.EmblFile">
- <map-to xml="EMBL_Services"/>
+ <map-to xml="ROOT"/>
<field name="entries" type="jalview.datamodel.xdb.embl.EmblEntry" collection="vector">
<bind-xml name="entry"/>
</field>
-
<field name="errors" type="jalview.datamodel.xdb.embl.EmblError" collection="vector">
<bind-xml name="Error"/>
</field>
</class>
<class name="jalview.datamodel.xdb.embl.EmblEntry">
<field name="accession" type="string">
- <bind-xml location="accession" node="attribute"/>
+ <bind-xml name="accession" node="attribute"/>
</field>
- <!-- May 2015 changed from last-updated to match xml -->
- <field name="lastUpdated" type="string">
- <bind-xml location="lastUpdated" node="attribute"/>
+ <!--
+ in EMBL XML 1.2 sequence/@version became entry/version
+ entry/@version became entry/@entryVersion
+ -->
+ <field name="sequenceVersion" type="string">
+ <bind-xml name="version" node="attribute"/>
</field>
- <field name="version" type="string">
- <bind-xml location="version" node="attribute"/>
+ <field name="entryVersion" type="string">
+ <bind-xml name="entryVersion" node="attribute"/>
+ </field>
+ <field name="dataClass" type="string">
+ <bind-xml name="dataClass" node="attribute"/>
+ </field>
+ <field name="taxonomicDivision" type="string">
+ <bind-xml name="taxonomicDivision" node="attribute"/>
+ </field>
+ <field name="moleculeType" type="string">
+ <bind-xml name="moleculeType" node="attribute"/>
+ </field>
+ <field name="sequenceLength" type="string">
+ <bind-xml name="sequenceLength" node="attribute"/>
+ </field>
+ <field name="topology" type="string">
+ <bind-xml name="topology" node="attribute" location="type"/>
+ </field>
+ <field name="firstPublicDate" type="string">
+ <bind-xml name="firstPublic" node="attribute"/>
</field>
- <field name="rCreated" type="string">
- <bind-xml location="releaseCreated" node="attribute"/>
+ <field name="firstPublicRelease" type="string">
+ <bind-xml name="firstPublicRelease" node="attribute"/>
</field>
- <field name="rLastUpdated" type="string">
- <bind-xml location="releaseLastUpdated" node="attribute"/>
+ <field name="lastUpdatedDate" type="string">
+ <bind-xml name="lastUpdated" node="attribute"/>
</field>
- <field name="desc" type="string">
+ <field name="lastUpdatedRelease" type="string">
+ <bind-xml name="lastUpdatedRelease" node="attribute"/>
+ </field>
+ <field name="description" type="string">
<bind-xml name="description" node="element"/>
</field>
<field name="keywords" type="string" collection="vector">
<bind-xml name="feature"/>
</field>
<field name="dbRefs" type="jalview.datamodel.DBRefEntry" collection="vector">
- <bind-xml name="dbreference" />
+ <bind-xml name="xref" />
</field>
<field name="sequence" type="jalview.datamodel.xdb.embl.EmblSequence">
<bind-xml name="sequence"/>
</field>
</class>
<class name="jalview.datamodel.xdb.embl.EmblSequence">
- <field name="type" type="string">
- <bind-xml name="type" node="attribute" location="type"/>
- </field>
- <field name="version" type="string">
- <bind-xml name="version" node="attribute" location="version"/>
- </field>
<field name="sequence" type="string">
<bind-xml node="text"/>
</field>
<field name="name" type="string">
<bind-xml name="name" node="attribute"/>
</field>
+ <field name="location" type="string">
+ <bind-xml name="location" node="attribute"/>
+ </field>
<field name="dbRefs" type="jalview.datamodel.DBRefEntry" collection="vector">
- <bind-xml name="dbreference" node="element"/>
+ <bind-xml name="xref" node="element"/>
</field>
<field name="qualifiers" type="jalview.datamodel.xdb.embl.Qualifier" collection="vector">
<bind-xml name="qualifier"/>
</field>
- <field name="locations" type="jalview.datamodel.xdb.embl.EmblFeatureLocations" collection="vector">
- <bind-xml name="location"/>
- </field>
</class>
<class name="jalview.datamodel.DBRefEntry" verify-constructable="false">
<field name="accessionId" type="java.lang.String">
- <bind-xml name="primary" node="attribute"/>
+ <bind-xml name="id" node="attribute"/>
</field>
<field name="source" type="java.lang.String">
<bind-xml name="db" node="attribute"/>
</field>
<field name="version" type="string">
- <bind-xml name="secondary" node="attribute"/>
+ <bind-xml name="secondaryId" node="attribute"/>
</field>
</class>
<class name="jalview.datamodel.xdb.embl.Qualifier" verify-constructable="false">
<bind-xml name="value" node="element"/>
</field>
</class>
- <class name="jalview.datamodel.xdb.embl.EmblFeatureLocations">
- <field name="locationType" type="string">
- <bind-xml name="type" node="attribute"/>
- </field>
- <field name="locationComplement" type="boolean">
- <bind-xml name="complement" node="attribute"/>
- </field>
- <field name="locElements" type="jalview.datamodel.xdb.embl.EmblFeatureLocElement" collection="vector">
- <bind-xml name="locationElement"/>
- </field>
- </class>
- <class name="jalview.datamodel.xdb.embl.EmblFeatureLocElement">
- <field name="type" type="string">
- <bind-xml name="type" node="attribute"/>
- </field>
- <field name="accession" type="string">
- <bind-xml name="accession" node="attribute"/>
- </field>
- <field name="version" type="string">
- <bind-xml name="version" node="attribute"/>
- </field>
- <field name="complement" type="boolean">
- <bind-xml name="complement"/>
- </field>
- <field name="basePositions" type="jalview.datamodel.xdb.embl.BasePosition" collection="array">
- <bind-xml name="basePosition" node="element"/>
- </field>
- </class>
- <class name="jalview.datamodel.xdb.embl.BasePosition">
- <field name="type">
- <bind-xml name="type" node="attribute"/>
- </field>
- <field name="pos">
- <bind-xml node="text"/>
- </field>
- </class>
</mapping>
{
EBIFetchClient ebi = new EBIFetchClient();
String query = "pdb:" + pdbentry.getId();
- pdbentry.setFile(ebi.fetchDataAsFile(query, "default", "raw", ".xml")
+ pdbentry.setFile(ebi.fetchDataAsFile(query, "default", ".xml")
.getAbsolutePath());
if (pdbentry.getFile() != null)
*/
public class FeatureProperties
{
-
- private static final String EMBL_CODING_FEATURE = "CDS";
+ public static final String EMBL_CODING_FEATURE = "CDS";
public static final String EXONPOS = "exon number";
// private key for Phase designed not to conflict with real GFF data
private static final String PHASE = "!Phase";
+ // private key for ENA location designed not to conflict with real GFF data
+ private static final String LOCATION = "!Location";
+
/*
* ATTRIBUTES is reserved for the GFF 'column 9' data, formatted as
* name1=value1;name2=value2,value3;...etc
public String description;
+ /*
+ * a map of key-value pairs; may be populated from GFF 'column 9' data,
+ * other data sources (e.g. GenBank file), or programmatically
+ */
public Map<String, Object> otherDetails;
public Vector<String> links;
}
/**
+ * Sets the 'raw' ENA format location specifier e.g. join(12..45,89..121)
+ *
+ * @param loc
+ */
+ public void setEnaLocation(String loc)
+ {
+ setValue(LOCATION, loc);
+ }
+
+ /**
+ * Gets the 'raw' ENA format location specifier e.g. join(12..45,89..121)
+ *
+ * @param loc
+ */
+ public String getEnaLocation()
+ {
+ return (String) getValue(LOCATION);
+ }
+
+ /**
* Readable representation, for debug only, not guaranteed not to change
* between versions
*/
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-/**
- * Data model for a feature/location/locationElement/basePosition read from an
- * EMBL query reply
- *
- * @see embl_mapping.xml
- */
-public class BasePosition
-{
- String type;
-
- String pos;
-
- /**
- * @return the pos
- */
- public String getPos()
- {
- return pos;
- }
-
- /**
- * @param pos
- * the pos to set
- */
- public void setPos(String pos)
- {
- this.pos = pos;
- }
-
- /**
- * @return the type
- */
- public String getType()
- {
- return type;
- }
-
- /**
- * @param type
- * the type to set
- */
- public void setType(String type)
- {
- this.type = type;
- }
-}
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.util.DBRefUtils;
+import jalview.util.DnaUtils;
import jalview.util.MapList;
import jalview.util.MappingUtils;
import jalview.util.StringUtils;
String accession;
- String version;
+ String entryVersion;
- String taxDivision;
+ String sequenceVersion;
- String desc;
+ String dataClass;
- String rCreated;
+ String moleculeType;
- String rLastUpdated;
+ String topology;
- String lastUpdated;
+ String sequenceLength;
+
+ String taxonomicDivision;
+
+ String description;
+
+ String firstPublicDate;
+
+ String firstPublicRelease;
+
+ String lastUpdatedDate;
+
+ String lastUpdatedRelease;
Vector<String> keywords;
}
/**
- * @return the desc
- */
- public String getDesc()
- {
- return desc;
- }
-
- /**
- * @param desc
- * the desc to set
- */
- public void setDesc(String desc)
- {
- this.desc = desc;
- }
-
- /**
* @return the features
*/
public Vector<EmblFeature> getFeatures()
}
/**
- * @return the lastUpdated
- */
- public String getLastUpdated()
- {
- return lastUpdated;
- }
-
- /**
- * @param lastUpdated
- * the lastUpdated to set
- */
- public void setLastUpdated(String lastUpdated)
- {
- this.lastUpdated = lastUpdated;
- }
-
- /**
- * @return the releaseCreated
- */
- public String getRCreated()
- {
- return rCreated;
- }
-
- /**
- * @param releaseCreated
- * the releaseCreated to set
- */
- public void setRCreated(String releaseCreated)
- {
- this.rCreated = releaseCreated;
- }
-
- /**
- * @return the releaseLastUpdated
- */
- public String getRLastUpdated()
- {
- return rLastUpdated;
- }
-
- /**
- * @param releaseLastUpdated
- * the releaseLastUpdated to set
- */
- public void setRLastUpdated(String releaseLastUpdated)
- {
- this.rLastUpdated = releaseLastUpdated;
- }
-
- /**
* @return the sequence
*/
public EmblSequence getSequence()
}
/**
- * @return the taxDivision
- */
- public String getTaxDivision()
- {
- return taxDivision;
- }
-
- /**
- * @param taxDivision
- * the taxDivision to set
- */
- public void setTaxDivision(String taxDivision)
- {
- this.taxDivision = taxDivision;
- }
-
- /**
- * @return the version
- */
- public String getVersion()
- {
- return version;
- }
-
- /**
- * @param version
- * the version to set
- */
- public void setVersion(String version)
- {
- this.version = version;
- }
-
- /**
* Recover annotated sequences from EMBL file
*
* @param sourceDb
{
SequenceI dna = new Sequence(sourceDb + "|" + accession,
sequence.getSequence());
- dna.setDescription(desc);
- DBRefEntry retrievedref = new DBRefEntry(sourceDb, version, accession);
+ dna.setDescription(description);
+ DBRefEntry retrievedref = new DBRefEntry(sourceDb,
+ getSequenceVersion(), accession);
dna.addDBRef(retrievedref);
// add map to indicate the sequence is a valid coordinate frame for the
// dbref
DBRefEntry pcdnaref = new DBRefEntry();
pcdnaref.setAccessionId(prid);
pcdnaref.setSource(DBRefSource.EMBLCDS);
- pcdnaref.setVersion(getVersion()); // same as parent EMBL version.
+ pcdnaref.setVersion(getSequenceVersion()); // same as parent EMBL
+ // version.
MapList mp = new MapList(new int[] { 1, prseq.length() },
new int[] { 1 + (codonStart - 1),
(codonStart - 1) + 3 * prseq.length() }, 1, 3);
SequenceFeature sf = makeCdsFeature(exon, xint, prname, prid, vals,
codonStart);
sf.setType(feature.getName()); // "CDS"
+ sf.setEnaLocation(feature.getLocation());
sf.setFeatureGroup(sourceDb);
dna.addSequenceFeature(sf);
}
if (map != null)
{
Mapping pmap = new Mapping(dna, map.getMap().getInverse());
- pref = new DBRefEntry(sourceDb, getVersion(),
+ pref = new DBRefEntry(sourceDb, getSequenceVersion(),
this.getAccession());
pref.setMap(pmap);
if (map.getTo() != null)
protEMBLCDS = new DBRefEntry();
protEMBLCDS.setAccessionId(prid);
protEMBLCDS.setSource(DBRefSource.EMBLCDSProduct);
- protEMBLCDS.setVersion(getVersion());
+ protEMBLCDS.setVersion(getSequenceVersion());
protEMBLCDS
.setMap(new Mapping(product, map.getMap().getInverse()));
}
*/
protected int[] getCdsRanges(EmblFeature feature)
{
- if (feature.locations == null)
+ if (feature.location == null)
{
return new int[] {};
}
- int cdsBoundaryCount = 0; // count of all start/stop locations
- int[][] cdsLocations = new int[feature.locations.size()][];
- int locationNumber = 0;
- for (EmblFeatureLocations loc : feature.locations)
- {
- int[] locationRanges = loc.getElementRanges(accession);
- cdsLocations[locationNumber++] = locationRanges;
- cdsBoundaryCount += locationRanges.length;
- }
- int[] cdsRanges = new int[cdsBoundaryCount];
- int copyTo = 0;
- for (int[] ranges : cdsLocations)
+ List<int[]> ranges = DnaUtils.parseLocation(feature.location);
+ return ranges == null ? new int[] {} : listToArray(ranges);
+ }
+
+ /**
+ * Converts a list of [start, end] ranges to a single array of [start, end,
+ * start, end ...]
+ *
+ * @param ranges
+ * @return
+ */
+ int[] listToArray(List<int[]> ranges)
+ {
+ int[] result = new int[ranges.size() * 2];
+ int i = 0;
+ for (int[] range : ranges)
{
- System.arraycopy(ranges, 0, cdsRanges, copyTo, ranges.length);
- copyTo += ranges.length;
+ result[i++] = range[0];
+ result[i++] = range[1];
}
- return cdsRanges;
-
+ return result;
}
/**
}
return exon;
}
+
+ public String getSequenceVersion()
+ {
+ return sequenceVersion;
+ }
+
+ public void setSequenceVersion(String sequenceVersion)
+ {
+ this.sequenceVersion = sequenceVersion;
+ }
+
+ public String getSequenceLength()
+ {
+ return sequenceLength;
+ }
+
+ public void setSequenceLength(String sequenceLength)
+ {
+ this.sequenceLength = sequenceLength;
+ }
+
+ public String getEntryVersion()
+ {
+ return entryVersion;
+ }
+
+ public void setEntryVersion(String entryVersion)
+ {
+ this.entryVersion = entryVersion;
+ }
+
+ public String getMoleculeType()
+ {
+ return moleculeType;
+ }
+
+ public void setMoleculeType(String moleculeType)
+ {
+ this.moleculeType = moleculeType;
+ }
+
+ public String getTopology()
+ {
+ return topology;
+ }
+
+ public void setTopology(String topology)
+ {
+ this.topology = topology;
+ }
+
+ public String getTaxonomicDivision()
+ {
+ return taxonomicDivision;
+ }
+
+ public void setTaxonomicDivision(String taxonomicDivision)
+ {
+ this.taxonomicDivision = taxonomicDivision;
+ }
+
+ public String getDescription()
+ {
+ return description;
+ }
+
+ public void setDescription(String description)
+ {
+ this.description = description;
+ }
+
+ public String getFirstPublicDate()
+ {
+ return firstPublicDate;
+ }
+
+ public void setFirstPublicDate(String firstPublicDate)
+ {
+ this.firstPublicDate = firstPublicDate;
+ }
+
+ public String getFirstPublicRelease()
+ {
+ return firstPublicRelease;
+ }
+
+ public void setFirstPublicRelease(String firstPublicRelease)
+ {
+ this.firstPublicRelease = firstPublicRelease;
+ }
+
+ public String getLastUpdatedDate()
+ {
+ return lastUpdatedDate;
+ }
+
+ public void setLastUpdatedDate(String lastUpdatedDate)
+ {
+ this.lastUpdatedDate = lastUpdatedDate;
+ }
+
+ public String getLastUpdatedRelease()
+ {
+ return lastUpdatedRelease;
+ }
+
+ public void setLastUpdatedRelease(String lastUpdatedRelease)
+ {
+ this.lastUpdatedRelease = lastUpdatedRelease;
+ }
+
+ public String getDataClass()
+ {
+ return dataClass;
+ }
+
+ public void setDataClass(String dataClass)
+ {
+ this.dataClass = dataClass;
+ }
}
Vector<Qualifier> qualifiers;
- Vector<EmblFeatureLocations> locations;
+ String location;
/**
* @return the dbRefs
}
/**
- * @return the locations
+ * @return the location
*/
- public Vector<EmblFeatureLocations> getLocations()
+ public String getLocation()
{
- return locations;
+ return location;
}
/**
- * @param locations
- * the locations to set
+ * @param loc
*/
- public void setLocations(Vector<EmblFeatureLocations> locations)
+ public void setLocation(String loc)
{
- this.locations = locations;
+ this.location = loc;
}
/**
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-/**
- * Data model for a feature/location/locationElement read from an EMBL query
- * reply
- *
- * @see embl_mapping.xml
- */
-public class EmblFeatureLocElement
-{
- String type;
-
- String accession;
-
- String version;
-
- boolean complement;
-
- BasePosition basePositions[];
-
- /**
- * @return the accession
- */
- public String getAccession()
- {
- return accession;
- }
-
- /**
- * @param accession
- * the accession to set
- */
- public void setAccession(String accession)
- {
- this.accession = accession;
- }
-
- /**
- * @return the basePositions
- */
- public BasePosition[] getBasePositions()
- {
- return basePositions;
- }
-
- /**
- * @param basePositions
- * the basePositions to set
- */
- public void setBasePositions(BasePosition[] basePositions)
- {
- this.basePositions = basePositions;
- }
-
- /**
- * @return the complement
- */
- public boolean isComplement()
- {
- return complement;
- }
-
- /**
- * @param complement
- * the complement to set
- */
- public void setComplement(boolean complement)
- {
- this.complement = complement;
- }
-
- /**
- * @return the type
- */
- public String getType()
- {
- return type;
- }
-
- /**
- * @param type
- * the type to set
- */
- public void setType(String type)
- {
- this.type = type;
- }
-
- /**
- * @return the version
- */
- public String getVersion()
- {
- return version;
- }
-
- /**
- * @param version
- * the version to set
- */
- public void setVersion(String version)
- {
- this.version = version;
- }
-}
+++ /dev/null
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-import jalview.bin.Cache;
-import jalview.util.ArrayUtils;
-
-import java.util.Arrays;
-import java.util.Vector;
-
-/**
- * Data model for a <location> child element of a <feature> read
- * from an EMBL query reply
- *
- * @see embl_mapping.xml
- * @see http://www.insdc.org/files/feature_table.html#3.4.2
- */
-public class EmblFeatureLocations
-{
- Vector<EmblFeatureLocElement> locElements;
-
- String locationType;
-
- boolean locationComplement;
-
- /**
- * @return the locationComplement
- */
- public boolean isLocationComplement()
- {
- return locationComplement;
- }
-
- /**
- * @param locationComplement
- * the locationComplement to set
- */
- public void setLocationComplement(boolean locationComplement)
- {
- this.locationComplement = locationComplement;
- }
-
- /**
- * @return the locationType
- */
- public String getLocationType()
- {
- return locationType;
- }
-
- /**
- * @param locationType
- * the locationType to set
- */
- public void setLocationType(String locationType)
- {
- this.locationType = locationType;
- }
-
- /**
- * @return the locElements
- */
- public Vector<EmblFeatureLocElement> getLocElements()
- {
- return locElements;
- }
-
- /**
- * @param locElements
- * the locElements to set
- */
- public void setLocElements(Vector<EmblFeatureLocElement> locElements)
- {
- this.locElements = locElements;
- }
-
- /**
- * Return all location elements as start-end pairs (without accessions) TODO:
- * pass back complement and 'less than or more than' range information Note:
- * do not use this since it throws away any accessionIds associated with each
- * location!
- *
- * @return int[] { start1, end1, ... }
- */
- public int[] getElementRanges()
- {
- return getElementRanges(null);
- }
-
- /**
- * Return all location elements concerning given accession as start-end pairs.
- * If the CDS feature is on the forward strand, then start <= end, if on the
- * reverse strand then start > end.
- *
- * @param accession
- * the accession string for which locations are requested, or null
- * for all locations
- * @return int[] { start1, end1, ... }
- */
- int[] getElementRanges(String accession)
- {
- int sepos = 0;
- int[] se = new int[locElements.size() * 2];
- if ("single".equalsIgnoreCase(locationType)
- || "join".equalsIgnoreCase(locationType))
- {
- for (EmblFeatureLocElement loce : locElements)
- {
- if (accession == null || loce.accession != null
- && accession.equals(loce.accession))
- {
- BasePosition bp[] = loce.getBasePositions();
- if (bp.length == 2)
- {
- try
- {
- int start = Integer.parseInt(bp[0].getPos());
- int end = Integer.parseInt(bp[1].getPos());
- se[sepos++] = start;
- se[sepos++] = end;
- } catch (NumberFormatException e)
- {
- System.err
- .println("format error in EMBL CDS location basePosition: "
- + e.getMessage());
- }
- }
- else
- {
- System.err
- .println("format error in EMBL CDS location, basePosition count = "
- + bp.length);
- }
- }
- }
- }
- else if (locationType != null)
- {
- if (Cache.log != null)
- {
- Cache.log
- .error("EmblFeatureLocations.getElementRanges cannot deal with locationType=='"
- + locationType + "'");
- }
- else
- {
- System.err
- .println("EmblFeatureLocations.getElementRanges cannot deal with locationType=='"
- + locationType + "'");
- }
- }
-
- if (sepos != se.length)
- {
- /*
- * we failed to parse something - trim off null values
- */
- se = Arrays.copyOf(se, sepos);
- }
-
- /*
- * If on the complement, reverse the ranges to [end, start, ...end1, start1].
- * For an example of a joined complement, see (tRNA feature) CAGL0B00165r on
- * http://www.ebi.ac.uk/ena/data/view/CR380948&display=xml
- * http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/embl/CR380948/emblxml
- */
- if (locationComplement)
- {
- ArrayUtils.reverseIntArray(se);
- }
- return se;
- }
-}
*/
public class EmblSequence
{
- String version;
-
String sequence;
- String type;
-
/**
* @return the sequence
*/
*/
public void setSequence(String sequence)
{
- this.sequence = sequence;
- }
-
- /**
- * @return the type
- */
- public String getType()
- {
- return type;
- }
-
- /**
- * @param type
- * the type to set
- */
- public void setType(String type)
- {
- this.type = type;
- }
-
- /**
- * @return the version
- */
- public String getVersion()
- {
- return version;
- }
-
- /**
- * @param version
- * the version to set
- */
- public void setVersion(String version)
- {
- this.version = version;
+ // remove spaces introduced by unmarshalling of newline characters
+ this.sequence = sequence.replace(" ", "");
}
}
try
{
reply = dbFetch.fetchDataAsFile(
- emprefx.toLowerCase() + ":" + query.trim(), "emblxml", null,
+ emprefx.toLowerCase() + ":" + query.trim(), "display=xml",
".xml");
} catch (Exception e)
{
+
/*
* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
* Copyright (C) $$Year-Rel$$ The Jalview Authors
: ".xml";
EBIFetchClient ebi = new EBIFetchClient();
file = ebi.fetchDataAsFile("pdb:" + id,
- getCurrentDefaultFormat().toLowerCase(), "raw", ext)
+ getCurrentDefaultFormat().toLowerCase(), ext)
.getAbsolutePath();
stopQuery();
if (file == null)
// uniprotxml parameter required since december 2007
// uniprotkb dbname changed introduced december 2008
File file = ebi.fetchDataAsFile("uniprotkb:" + queries, "uniprotxml",
- null, ".xml");
+ ".xml");
Vector<UniprotEntry> entries = getUniprotEntries(new FileReader(file));
if (entries != null)
*/
public class EBIFetchClient
{
- String format = "default";
-
- String style = "raw";
/**
* Creates a new EBIFetchClient object.
* the query formatted as db:query1;query2;query3
* @param format
* the format wanted
- * @param s
- * - unused parameter
+ * @param extension
+ * for the temporary file to hold response
* @return the file holding the response
* @throws OutOfMemoryError
*/
- public File fetchDataAsFile(String ids, String format, String s,
- String ext)
+ public File fetchDataAsFile(String ids, String format, String ext)
throws OutOfMemoryError
{
File outFile = null;
{
outFile = File.createTempFile("jalview", ext);
outFile.deleteOnExit();
- fetchData(ids, format, s, outFile);
+ fetchData(ids, format, outFile);
if (outFile.length() == 0)
{
outFile.delete();
}
/**
- * Single DB multiple record retrieval
+ * Fetches queries and either saves the response to a file or returns as
+ * string data
*
* @param ids
- * db:query1;query2;query3
* @param format
- * raw/xml
- * @param s
- * not used - remove?
- *
- * @return Raw string array result of query set
+ * @param outFile
+ * @return
+ * @throws OutOfMemoryError
*/
- public String[] fetchData(String ids, String format, String s)
+ String[] fetchData(String ids, String format, File outFile)
throws OutOfMemoryError
{
- return fetchData(ids, format, s, null);
+ StringBuilder querystring = new StringBuilder(ids.length());
+ String database = parseIds(ids, querystring);
+ if (database == null)
+ {
+ System.err.println("Invalid Query string : '" + ids + "'");
+ System.err.println("Should be of form 'dbname:q1;q2;q3;q4'");
+ return null;
+ }
+
+ // note: outFile is currently always specified, so return value is null
+ String[] rslt = fetchBatch(querystring.toString(), database, format, outFile);
+
+ return (rslt != null && rslt.length > 0 ? rslt : null);
}
- String[] fetchData(String ids, String f, String s, File outFile)
- throws OutOfMemoryError
+ /**
+ * Parses ids formatted as dbname:q1;q2;q3, returns the dbname and adds
+ * queries as comma-separated items to the querystring. dbname must be
+ * specified for at least one queryId. Returns null if a mixture of different
+ * dbnames is found (ignoring case).
+ *
+ * @param ids
+ * @param queryString
+ * @return
+ */
+ static String parseIds(String ids, StringBuilder queryString)
{
- // Need to split
- // ids of the form uniprot:25KD_SARPE;ADHR_DROPS;
- String[] rslts = new String[0];
+ String database = null;
StringTokenizer queries = new StringTokenizer(ids, ";");
- String db = null;
- StringBuffer querystring = null;
- int nq = 0;
+ boolean appending = queryString.length() > 0;
while (queries.hasMoreTokens())
{
String query = queries.nextToken();
- int p;
- if ((p = query.indexOf(':')) > -1)
+ int p = query.indexOf(':');
+ if (p > -1)
{
- db = query.substring(0, p);
+ String db = query.substring(0, p);
+ if (database != null && !db.equalsIgnoreCase(database))
+ {
+ /*
+ * different databases mixed in together - invalid
+ */
+ return null;
+ }
+ database = db;
query = query.substring(p + 1);
}
- if (querystring == null)
- {
- querystring = new StringBuffer(query);
- nq++;
- }
- else
- {
- querystring.append("," + query);
- nq++;
- }
- }
- if (db == null)
- {
- System.err.println("Invalid Query string : '" + ids
- + "'\nShould be of form 'dbname:q1;q2;q3;q4'");
- return null;
- }
- String[] rslt = fetchBatch(querystring.toString(), db, f, s, outFile);
- if (rslt != null)
- {
- String[] nrslts = new String[rslt.length + rslts.length];
- System.arraycopy(rslts, 0, nrslts, 0, rslts.length);
- System.arraycopy(rslt, 0, nrslts, rslts.length, rslt.length);
- rslts = nrslts;
+ queryString.append(appending ? "," : "");
+ queryString.append(query);
+ appending = true;
}
-
- return (rslts.length == 0 ? null : rslts);
+ return database;
}
- public String[] fetchBatch(String ids, String dbPath, String format, String s,
+ /**
+ * Fetches queries and either saves the response to a file or (if no file
+ * specified) returns as string data
+ *
+ * @param ids
+ * @param database
+ * @param format
+ * @param outFile
+ * @return
+ * @throws OutOfMemoryError
+ */
+ String[] fetchBatch(String ids, String database, String format,
File outFile) throws OutOfMemoryError
{
// long time = System.currentTimeMillis();
- /*
- * JAL-1855 dbfetch from ena_sequence, ena_coding
- */
- if (dbPath.equalsIgnoreCase(DBRefSource.EMBL))
- {
- dbPath = "ena_sequence";
- }
- else if (dbPath.equalsIgnoreCase(DBRefSource.EMBLCDS))
- {
- dbPath = "ena_coding";
- }
+ String url = buildUrl(ids, database, format);
try
{
- URL rcall = new URL("http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/"
- + dbPath.toLowerCase() + "/" + ids.toLowerCase()
- + (format != null ? "/" + format : ""));
+ URL rcall = new URL(url);
InputStream is = new BufferedInputStream(rcall.openStream());
if (outFile != null)
}
} catch (OutOfMemoryError er)
{
-
- System.out.println("OUT OF MEMORY DOWNLOADING QUERY FROM " + dbPath
+ System.out.println("OUT OF MEMORY DOWNLOADING QUERY FROM " + database
+ ":\n" + ids);
throw er;
} catch (Exception ex)
return null;
}
System.err.println("Unexpected exception when retrieving from "
- + dbPath
+ + database
+ "\nQuery was : '" + ids + "'");
ex.printStackTrace(System.err);
return null;
}
return null;
}
+
+ /**
+ * Constructs the URL to fetch from
+ *
+ * @param ids
+ * @param database
+ * @param format
+ * @return
+ */
+ static String buildUrl(String ids, String database, String format)
+ {
+ String url;
+ if (database.equalsIgnoreCase(DBRefSource.EMBL)
+ || database.equalsIgnoreCase(DBRefSource.EMBLCDS))
+ {
+ url = "http://www.ebi.ac.uk/ena/data/view/" + ids.toLowerCase()
+ + (format != null ? "&" + format : "");
+ }
+ else
+ {
+ url = "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/"
+ + database.toLowerCase() + "/" + ids.toLowerCase()
+ + (format != null ? "/" + format : "");
+ }
+ return url;
+ }
}
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertSame;
-import jalview.util.MappingUtils;
+import jalview.datamodel.DBRefEntry;
+import jalview.datamodel.Sequence;
+import jalview.datamodel.SequenceI;
+import java.util.ArrayList;
import java.util.Arrays;
-import java.util.Vector;
+import java.util.List;
import org.testng.annotations.Test;
* Make a (CDS) Feature with 4 locations
*/
EmblFeature cds = new EmblFeature();
- Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
- cds.setLocations(locs);
-
- /*
- * single range [10-20]
- */
- EmblFeatureLocations loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
- EmblFeatureLocElement locElement = new EmblFeatureLocElement();
- BasePosition b1 = new BasePosition();
- b1.setPos("10");
- BasePosition b2 = new BasePosition();
- b2.setPos("20");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * complement range [30-40]
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(true);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("30");
- b2 = new BasePosition();
- b2.setPos("40");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * join range [50-60], [70-80]
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("join");
- loc.setLocationComplement(false);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("50");
- b2 = new BasePosition();
- b2.setPos("60");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("70");
- b2 = new BasePosition();
- b2.setPos("80");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * complement range [90-100], [110-120]
- * this should be the same as complement(join(90..100,110.120))
- * which is "join 90-100 and 110-120, then complement"
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("join");
- loc.setLocationComplement(true);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("90");
- b2 = new BasePosition();
- b2.setPos("100");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("110");
- b2 = new BasePosition();
- b2.setPos("120");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
+ cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
int[] exons = testee.getCdsRanges(cds);
- assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110, 100, 90]",
+ assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110]",
Arrays.toString(exons));
}
@Test(groups = "Functional")
- public void testGetCdsRanges_badData()
+ public void testParseCodingFeature()
{
- EmblEntry testee = new EmblEntry();
+ // not the whole sequence but enough for this test...
+ SequenceI dna = new Sequence("J03321", "GGATCCGTAAGTTAGACGAAATT");
+ List<SequenceI> peptides = new ArrayList<SequenceI>();
+ EmblFile ef = EmblTestHelper.getEmblFile();
/*
- * Make a (CDS) Feature with 4 locations
- */
- EmblFeature cds = new EmblFeature();
- Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
- cds.setLocations(locs);
-
- /*
- * single range [10-20]
- */
- EmblFeatureLocations loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
- EmblFeatureLocElement locElement = new EmblFeatureLocElement();
- BasePosition b1 = new BasePosition();
- b1.setPos("10");
- BasePosition b2 = new BasePosition();
- b2.setPos("20");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * single range with missing end position - should be skipped
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("30");
- locElement.setBasePositions(new BasePosition[] { b1 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * single range with extra base position - should be skipped
+ * parse two CDS features, one with two Uniprot cross-refs,
+ * the other with one
*/
- loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("30");
- locElement.setBasePositions(new BasePosition[] { b1, b1, b1 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * single valid range [50-60] to finish
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("50");
- b2 = new BasePosition();
- b2.setPos("60");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- int[] exons = testee.getCdsRanges(cds);
- assertEquals("[10, 20, 50, 60]", Arrays.toString(exons));
- }
-
- /**
- * Test retrieval of exon locations matching an accession id
- */
- @Test(groups = "Functional")
- public void testGetCdsRanges_forAccession()
- {
EmblEntry testee = new EmblEntry();
- String accession = "A1234";
- testee.setAccession(accession);
- /*
- * Make a (CDS) Feature with 4 locations
- */
- EmblFeature cds = new EmblFeature();
- Vector<EmblFeatureLocations> locs = new Vector<EmblFeatureLocations>();
- cds.setLocations(locs);
-
- /*
- * single range [10-20] for 'this' accession
- */
- EmblFeatureLocations loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(false);
- Vector<EmblFeatureLocElement> elements = new Vector<EmblFeatureLocElement>();
- EmblFeatureLocElement locElement = new EmblFeatureLocElement();
- locElement.setAccession(accession);
- BasePosition b1 = new BasePosition();
- b1.setPos("10");
- BasePosition b2 = new BasePosition();
- b2.setPos("20");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * complement range [30-40] - no accession
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("single");
- loc.setLocationComplement(true);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- b1 = new BasePosition();
- b1.setPos("30");
- b2 = new BasePosition();
- b2.setPos("40");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * join range [50-60] this accession, [70-80] another
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("join");
- loc.setLocationComplement(false);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- locElement.setAccession(accession);
- b1 = new BasePosition();
- b1.setPos("50");
- b2 = new BasePosition();
- b2.setPos("60");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- locElement = new EmblFeatureLocElement();
- locElement.setAccession("notme");
- b1 = new BasePosition();
- b1.setPos("70");
- b2 = new BasePosition();
- b2.setPos("80");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * complement range [90-100] wrong accession, [110-120] good
- * this should be the same as complement(join(90..100,110.120))
- * which is "join 90-100 and 110-120, then complement"
- */
- loc = new EmblFeatureLocations();
- loc.setLocationType("join");
- loc.setLocationComplement(true);
- elements = new Vector<EmblFeatureLocElement>();
- locElement = new EmblFeatureLocElement();
- locElement.setAccession("wrong");
- b1 = new BasePosition();
- b1.setPos("90");
- b2 = new BasePosition();
- b2.setPos("100");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- locElement = new EmblFeatureLocElement();
- locElement.setAccession(accession);
- b1 = new BasePosition();
- b1.setPos("110");
- b2 = new BasePosition();
- b2.setPos("120");
- locElement.setBasePositions(new BasePosition[] { b1, b2 });
- elements.add(locElement);
- loc.setLocElements(elements);
- locs.add(loc);
-
- /*
- * verify we pick out only ranges for A1234
- */
- int[] exons = testee.getCdsRanges(cds);
- assertEquals("[10, 20, 50, 60, 120, 110]",
- Arrays.toString(exons));
+ for (EmblFeature feature : ef.getEntries().get(0).getFeatures())
+ {
+ if ("CDS".equals(feature.getName()))
+ {
+ testee.parseCodingFeature(feature, "EMBL", dna, peptides);
+ }
+ }
+
+ /*
+ * peptides should now have five entries:
+ * EMBL product and two Uniprot accessions for the first CDS / translation
+ * EMBL product and one Uniprot accession for the second CDS / translation
+ */
+ assertEquals(5, peptides.size());
+ assertEquals("CAA30420.1", peptides.get(0).getName());
+ assertEquals("MLCF", peptides.get(0).getSequenceAsString());
+ assertEquals("UNIPROT|B0BCM4", peptides.get(1).getName());
+ assertEquals("MLCF", peptides.get(1).getSequenceAsString());
+ assertEquals("UNIPROT|P0CE20", peptides.get(2).getName());
+ assertEquals("MLCF", peptides.get(2).getSequenceAsString());
+ assertEquals("CAA30421.1", peptides.get(3).getName());
+ assertEquals("MSSS", peptides.get(3).getSequenceAsString());
+ assertEquals("UNIPROT|B0BCM3", peptides.get(4).getName());
+ assertEquals("MSSS", peptides.get(4).getSequenceAsString());
+
+ /*
+ * verify dna sequence has dbrefs with mappings to the peptide 'products'
+ */
+ DBRefEntry[] dbrefs = dna.getDBRefs();
+ assertEquals(3, dbrefs.length);
+ DBRefEntry dbRefEntry = dbrefs[0];
+ assertEquals("UNIPROT", dbRefEntry.getSource());
+ assertEquals("B0BCM4", dbRefEntry.getAccessionId());
+ assertSame(peptides.get(1), dbRefEntry.getMap().getTo());
+ List<int[]> fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+ assertEquals(1, fromRanges.size());
+ assertEquals(57, fromRanges.get(0)[0]);
+ assertEquals(46, fromRanges.get(0)[1]);
+ List<int[]> toRanges = dbRefEntry.getMap().getMap().getToRanges();
+ assertEquals(1, toRanges.size());
+ assertEquals(1, toRanges.get(0)[0]);
+ assertEquals(4, toRanges.get(0)[1]);
+
+ dbRefEntry = dbrefs[1];
+ assertEquals("UNIPROT", dbRefEntry.getSource());
+ assertEquals("P0CE20", dbRefEntry.getAccessionId());
+ assertSame(peptides.get(2), dbRefEntry.getMap().getTo());
+ fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+ assertEquals(1, fromRanges.size());
+ assertEquals(57, fromRanges.get(0)[0]);
+ assertEquals(46, fromRanges.get(0)[1]);
+ toRanges = dbRefEntry.getMap().getMap().getToRanges();
+ assertEquals(1, toRanges.size());
+ assertEquals(1, toRanges.get(0)[0]);
+ assertEquals(4, toRanges.get(0)[1]);
+
+ dbRefEntry = dbrefs[2];
+ assertEquals("UNIPROT", dbRefEntry.getSource());
+ assertEquals("B0BCM3", dbRefEntry.getAccessionId());
+ assertSame(peptides.get(4), dbRefEntry.getMap().getTo());
+ fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
+ assertEquals(1, fromRanges.size());
+ assertEquals(4, fromRanges.get(0)[0]);
+ assertEquals(15, fromRanges.get(0)[1]);
+ toRanges = dbRefEntry.getMap().getMap().getToRanges();
+ assertEquals(1, toRanges.size());
+ assertEquals(1, toRanges.get(0)[0]);
+ assertEquals(4, toRanges.get(0)[1]);
}
}
package jalview.datamodel.xdb.embl;
import static org.testng.AssertJUnit.assertEquals;
-import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertNull;
-import static org.testng.AssertJUnit.assertTrue;
import jalview.datamodel.DBRefEntry;
-import java.io.StringReader;
import java.util.Vector;
import org.testng.annotations.Test;
public class EmblFileTest
{
- // adapted from http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/embl/x53828/emblxml
- private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
- + "<EMBL_Services>"
- + "<entry accession=\"X53828\" version=\"3\" lastUpdated=\"2005-04-18\" releaseCreated=\"25\" releaseLastUpdated=\"83\">"
- + "<description>Chicken LDH-A mRNA for lactate dehydrogenase A chain (EC 1.1.1.27)</description>"
- + "<keyword>L-lactate dehydrogenase</keyword><keyword>chutney</keyword>"
- + "<dbreference db=\"EuropePMC\" primary=\"PMC1460223\" secondary=\"9649548\" />"
- + "<dbreference db=\"MD5\" primary=\"d3b68\" />"
- + "<feature name=\"CDS\"><dbreference db=\"GOA\" primary=\"P00340\" secondary=\"2.1\" /><dbreference db=\"InterPro\" primary=\"IPR001236\" />"
- + "<qualifier name=\"note\"><value>L-lactate dehydrogenase A-chain</value><value>pickle</value></qualifier>"
- + "<qualifier name=\"translation\"><value>MSLKDHLIHN</value><evidence>Keith</evidence></qualifier>"
- + "<location type=\"single\" complement=\"true\">"
- + "<locationElement type=\"range\" accession=\"X53828\" version=\"1\" complement=\"false\">"
- + "<basePosition type=\"simple\">60</basePosition><basePosition type=\"join\">1058</basePosition>"
- + "</locationElement></location></feature>"
- + "<sequence type=\"mRNA\" version=\"2\">GTGACG</sequence></entry></EMBL_Services>";
@Test(groups = { "Functional" })
public void testGetEmblFile()
{
- Vector<EmblEntry> entries = EmblFile.getEmblFile(
- new StringReader(TESTDATA)).getEntries();
+ Vector<EmblEntry> entries = EmblTestHelper.getEmblFile().getEntries();
assertEquals(1, entries.size());
EmblEntry entry = entries.get(0);
- assertEquals("X53828", entry.getAccession());
- assertEquals(
- "Chicken LDH-A mRNA for lactate dehydrogenase A chain (EC 1.1.1.27)",
- entry.getDesc());
- assertEquals("2005-04-18", entry.getLastUpdated());
+ assertEquals("X07547", entry.getAccession());
+ assertEquals("C. trachomatis plasmid", entry.getDescription());
+ assertEquals("STD", entry.getDataClass());
+ assertEquals("PRO", entry.getTaxonomicDivision());
+ assertEquals("1999-02-10", entry.getLastUpdatedDate());
+ assertEquals("58", entry.getLastUpdatedRelease());
+ assertEquals("1988-11-10", entry.getFirstPublicDate());
+ assertEquals("18", entry.getFirstPublicRelease());
+ assertEquals("genomic DNA", entry.getMoleculeType());
+ assertEquals("1", entry.getSequenceVersion());
+ assertEquals("8", entry.getEntryVersion());
+ assertEquals("linear", entry.getTopology());
+ assertEquals("7499", entry.getSequenceLength());
/*
* FIXME these assertions fail - values are null - why?? Adding or removing
* attributes in the test XML modifies behaviour. eg. inserting an attribute
* _before_ lastUpdated results in a null value in this field.
*/
- // assertEquals("25", entry.getRCreated());
- // assertEquals("83", entry.getRLastUpdated());
+ assertEquals("1988-11-10", entry.getFirstPublicDate());
+ assertEquals("18", entry.getFirstPublicRelease());
assertEquals(2, entry.getKeywords().size());
- assertEquals("L-lactate dehydrogenase", entry.getKeywords().get(0));
- assertEquals("chutney", entry.getKeywords().get(1));
+ assertEquals("plasmid", entry.getKeywords().get(0));
+ assertEquals("unidentified reading frame", entry.getKeywords().get(1));
/*
* dbrefs
assertEquals(2, entry.getDbRefs().size());
DBRefEntry dbref = entry.getDbRefs().get(0);
assertEquals("EuropePMC", dbref.getSource());
- assertEquals("PMC1460223", dbref.getAccessionId());
- assertEquals("9649548", dbref.getVersion());
+ assertEquals("PMC107176", dbref.getAccessionId());
+ assertEquals("9573186", dbref.getVersion());
dbref = entry.getDbRefs().get(1);
assertEquals("MD5", dbref.getSource());
- assertEquals("d3b68", dbref.getAccessionId());
+ assertEquals("ac73317", dbref.getAccessionId());
// blank version has been converted to "0"
assertEquals("0", dbref.getVersion());
/*
- * sequence features
+ * two sequence features for CDS
+ */
+ assertEquals(2, entry.getFeatures().size());
+ /*
+ * first CDS
*/
- assertEquals(1, entry.getFeatures().size());
EmblFeature ef = entry.getFeatures().get(0);
assertEquals("CDS", ef.getName());
+ assertEquals("complement(46..57)", ef.getLocation());
assertEquals(2, ef.getDbRefs().size());
dbref = ef.getDbRefs().get(0);
- assertEquals("GOA", dbref.getSource());
- assertEquals("P00340", dbref.getAccessionId());
+ assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+ assertEquals("B0BCM4", dbref.getAccessionId());
assertEquals("2.1", dbref.getVersion());
dbref = ef.getDbRefs().get(1);
- assertEquals("InterPro", dbref.getSource());
- assertEquals("IPR001236", dbref.getAccessionId());
- // blank version converted to "0":
+ assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+ assertEquals("P0CE20", dbref.getAccessionId());
+ // blank version gets converted to "0":
assertEquals("0", dbref.getVersion());
- assertEquals(2, ef.getQualifiers().size());
-
- // feature qualifiers
+ // CDS feature qualifiers
+ assertEquals(3, ef.getQualifiers().size());
Qualifier q = ef.getQualifiers().get(0);
assertEquals("note", q.getName());
assertEquals(2, q.getValues().length);
- assertEquals("L-lactate dehydrogenase A-chain", q.getValues()[0]);
+ assertEquals("ORF 8 (AA 1-330)", q.getValues()[0]);
assertEquals("pickle", q.getValues()[1]);
assertNull(q.getEvidence());
q = ef.getQualifiers().get(1);
+ assertEquals("protein_id", q.getName());
+ assertEquals(1, q.getValues().length);
+ assertEquals("CAA30420.1", q.getValues()[0]);
+ q = ef.getQualifiers().get(2);
assertEquals("translation", q.getName());
assertEquals(1, q.getValues().length);
- assertEquals("MSLKDHLIHN", q.getValues()[0]);
+ assertEquals("MLCF", q.getValues()[0]);
assertEquals(1, q.getEvidence().length);
assertEquals("Keith", q.getEvidence()[0]);
- // feature locations
- assertEquals(1, ef.getLocations().size());
- EmblFeatureLocations fl = ef.getLocations().get(0);
- assertEquals("single", fl.getLocationType());
- assertTrue(fl.isLocationComplement());
- assertEquals(1, fl.getLocElements().size());
- EmblFeatureLocElement le = fl.getLocElements().get(0);
- assertEquals("range", le.getType());
- assertEquals("X53828", le.getAccession());
- assertEquals("1", le.getVersion());
- assertFalse(le.isComplement());
- assertEquals(2, le.getBasePositions().length);
- BasePosition bp = le.getBasePositions()[0];
- assertEquals("simple", bp.getType());
- assertEquals("60", bp.getPos());
- bp = le.getBasePositions()[1];
- assertEquals("join", bp.getType());
- assertEquals("1058", bp.getPos());
+ /*
+ * second CDS
+ */
+ ef = entry.getFeatures().get(1);
+ assertEquals("CDS", ef.getName());
+ assertEquals("4..15", ef.getLocation());
+ assertEquals(1, ef.getDbRefs().size());
+ dbref = ef.getDbRefs().get(0);
+ assertEquals("UniProtKB/Swiss-Prot", dbref.getSource());
+ assertEquals("B0BCM3", dbref.getAccessionId());
+ assertEquals("0", dbref.getVersion());
+ assertEquals(2, ef.getQualifiers().size());
+ q = ef.getQualifiers().get(0);
+ assertEquals("protein_id", q.getName());
+ assertEquals(1, q.getValues().length);
+ assertEquals("CAA30421.1", q.getValues()[0]);
+ q = ef.getQualifiers().get(1);
+ assertEquals("translation", q.getName());
+ assertEquals(1, q.getValues().length);
+ assertEquals("MSSS", q.getValues()[0]);
/*
- * Sequence
+ * Sequence - verify newline not converted to space (JAL-2029)
*/
EmblSequence seq = entry.getSequence();
- assertEquals("mRNA", seq.getType());
- assertEquals("2", seq.getVersion());
- assertEquals("GTGACG", seq.getSequence());
+ assertEquals(
+ "GGTATGTCCTCTAGTACAAACACCCCCAATATTGTGATATAATTAAAAACATAGCAT",
+ seq.getSequence());
/*
* getSequence() converts empty DBRefEntry.version to "0"
--- /dev/null
+package jalview.datamodel.xdb.embl;
+
+import java.io.StringReader;
+
+public class EmblTestHelper
+{
+ // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
+ // dna and translations truncated for convenience
+ private static final String TESTDATA = "<?xml version=\"1.0\" encoding=\"UTF-8\" ?>"
+ + "<ROOT>"
+ + "<entry accession=\"X07547\" version=\"1\" entryVersion=\"8\""
+ + " dataClass=\"STD\" taxonomicDivision=\"PRO\""
+ + " moleculeType=\"genomic DNA\" sequenceLength=\"7499\" topology=\"linear\""
+ + " firstPublic=\"1988-11-10\" firstPublicRelease=\"18\""
+ + " lastUpdated=\"1999-02-10\" lastUpdatedRelease=\"58\">"
+ + "<secondaryAccession>X07574</secondaryAccession>"
+ + "<description>C. trachomatis plasmid</description>"
+ + "<keyword>plasmid</keyword><keyword>unidentified reading frame</keyword>"
+ + "<xref db=\"EuropePMC\" id=\"PMC107176\" secondaryId=\"9573186\" />"
+ + "<xref db=\"MD5\" id=\"ac73317\" />"
+ /*
+ * first CDS (range and translation changed to keep test data manageable)
+ */
+ + "<feature name=\"CDS\" location=\"complement(46..57)\">"
+ // test the case of >1 cross-ref to the same database (JAL-2029)
+ + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM4\" secondaryId=\"2.1\" />"
+ + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"P0CE20\" />"
+ + "<qualifier name=\"note\"><value>ORF 8 (AA 1-330)</value><value>pickle</value></qualifier>"
+ + "<qualifier name=\"protein_id\"><value>CAA30420.1</value></qualifier>"
+ + "<qualifier name=\"translation\"><value>MLCF</value><evidence>Keith</evidence></qualifier>"
+ + "</feature>"
+ /*
+ * second CDS (range and translation changed to keep test data manageable)
+ */
+ + "<feature name=\"CDS\" location=\"4..15\">"
+ + "<xref db=\"UniProtKB/Swiss-Prot\" id=\"B0BCM3\" />"
+ + "<qualifier name=\"protein_id\"><value>CAA30421.1</value></qualifier>"
+ + "<qualifier name=\"translation\"><value>MSSS</value></qualifier>"
+ + "</feature>"
+ /*
+ * sequence (modified for test purposes)
+ * emulates EMBL XML 1.2 which splits sequence data every 60 characters
+ * see EmblSequence.setSequence
+ */
+ + "<sequence>GGTATGTCCTCTAGTACAAAC\n"
+ + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
+ + "</sequence></entry></ROOT>";
+
+ static EmblFile getEmblFile()
+ {
+ return EmblFile.getEmblFile(new StringReader(TESTDATA));
+ }
+}
--- /dev/null
+package jalview.ws.ebi;
+
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertNull;
+
+import org.testng.annotations.Test;
+
+public class EBIFetchClientTest
+{
+ /**
+ * Test method that constructs URL to fetch from
+ */
+ @Test(groups = "Functional")
+ public void testBuildUrl()
+ {
+ /*
+ * EMBL
+ */
+ assertEquals("http://www.ebi.ac.uk/ena/data/view/x53838&display=xml",
+ EBIFetchClient.buildUrl("X53838", "EMBL", "display=xml"));
+
+ /*
+ * EMBLCDS
+ */
+ assertEquals("http://www.ebi.ac.uk/ena/data/view/caa37824&display=xml",
+ EBIFetchClient.buildUrl("CAA37824", "EMBL", "display=xml"));
+
+ /*
+ * Uniprot
+ */
+ assertEquals(
+ "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/uniprot/p00340/uniprotxml",
+ EBIFetchClient.buildUrl("P00340", "UNIPROT", "uniprotxml"));
+
+ /*
+ * PDB / pdb
+ */
+ assertEquals("http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/pdb/3a6s/pdb",
+ EBIFetchClient.buildUrl("3A6S", "PDB", "pdb"));
+
+ /*
+ * PDB / mmCIF
+ */
+ assertEquals(
+ "http://www.ebi.ac.uk/Tools/dbfetch/dbfetch/pdb/3a6s/mmCIF",
+ EBIFetchClient.buildUrl("3A6S", "PDB", "mmCIF"));
+ }
+
+ /**
+ * Test method that parses db:id;id;id
+ */
+ @Test(groups = "Functional")
+ public void testParseIds()
+ {
+ /*
+ * pdb, two accessions
+ */
+ StringBuilder queries = new StringBuilder();
+ String db = EBIFetchClient.parseIds("pdb:3a6s;1A70", queries);
+ assertEquals("pdb", db);
+ assertEquals("3a6s,1A70", queries.toString());
+
+ /*
+ * pdb specified on second accession
+ */
+ queries.setLength(0);
+ queries = new StringBuilder();
+ db = EBIFetchClient.parseIds("3a6s;pdb:1A70", queries);
+ assertEquals("pdb", db);
+ assertEquals("3a6s,1A70", queries.toString());
+
+ /*
+ * uniprot, one accession
+ */
+ queries.setLength(0);
+ db = EBIFetchClient.parseIds("uniprot:P00340", queries);
+ assertEquals("uniprot", db);
+ assertEquals("P00340", queries.toString());
+
+ /*
+ * uniprot, one accession, appending to existing queries
+ */
+ queries.setLength(0);
+ queries.append("P30419");
+ db = EBIFetchClient.parseIds("uniprot:P00340", queries);
+ assertEquals("uniprot", db);
+ assertEquals("P30419,P00340", queries.toString());
+
+ /*
+ * pdb and uniprot mixed - rejected
+ */
+ queries.setLength(0);
+ db = EBIFetchClient.parseIds("pdb:3a6s;1a70;uniprot:P00340", queries);
+ assertNull(db);
+ assertEquals("3a6s,1a70", queries.toString());
+
+ /*
+ * pdb and PDB mixed - ok
+ */
+ queries.setLength(0);
+ db = EBIFetchClient.parseIds("pdb:3a6s;pdb:1a70;PDB:1QIP", queries);
+ assertEquals("PDB", db);
+ assertEquals("3a6s,1a70,1QIP", queries.toString());
+
+ /*
+ * no database (improper format)
+ */
+ queries.setLength(0);
+ db = EBIFetchClient.parseIds("P00340", queries);
+ assertNull(db);
+ assertEquals("P00340", queries.toString());
+ }
+}