Combines patches for JAL-3806 prior to redaction of shared CDS dataset sequences with patches for JAL-3673
Conflicts:
src/jalview/datamodel/AlignedCodonFrame.java
src/jalview/util/MappingUtils.java
test/jalview/util/MappingUtilsTest.java
*/
package jalview.datamodel;
-import jalview.util.MapList;
-import jalview.util.MappingUtils;
-
import java.util.AbstractList;
import java.util.ArrayList;
import java.util.List;
+import jalview.util.MapList;
+import jalview.util.MappingUtils;
+
/**
* Stores mapping between the columns of a protein alignment and a DNA alignment
* and a list of individual codon to amino acid mappings between sequences.
{
return mapping;
}
-
+
/**
* Returns true if the mapping covers the full length of the given sequence.
* This allows us to distinguish the CDS that codes for a protein from
*/
public boolean covers(SequenceI seq)
{
- List<int[]> mappedRanges = null;
+ return covers(seq,false,false);
+ }
+ /**
+ *
+ * @param seq
+ * @param localCover - when true - compare extent of seq's dataset sequence rather than the local extent
+ * @param either - when true coverage is required for either seq or the mapped sequence
+ * @return true if mapping covers full length of given sequence (or the other if either==true)
+ */
+ public boolean covers(SequenceI seq, boolean localCover,boolean either)
+ {
+ List<int[]> mappedRanges = null,otherRanges=null;
MapList mapList = mapping.getMap();
+ int mstart=seq.getStart(),mend=seq.getEnd(),ostart,oend;
+ ;
if (fromSeq == seq || fromSeq == seq.getDatasetSequence())
{
+ if (localCover && fromSeq !=seq)
+ {
+ mstart=fromSeq.getStart();
+ mend=fromSeq.getEnd();
+ }
mappedRanges = mapList.getFromRanges();
+ otherRanges=mapList.getToRanges();
+ ostart=mapping.to.getStart();
+ oend=mapping.to.getEnd();
}
else if (mapping.to == seq || mapping.to == seq.getDatasetSequence())
{
+ if (localCover && mapping.to !=seq)
+ {
+ mstart=mapping.to.getStart();
+ mend=mapping.to.getEnd();
+ }
mappedRanges = mapList.getToRanges();
+ otherRanges=mapList.getFromRanges();
+ ostart=fromSeq.getStart();
+ oend=fromSeq.getEnd();
}
else
{
* (necessary for circular CDS - example EMBL:J03321:AAA91567)
* and mapped length covers (at least) sequence length
*/
- int length = 0;
+ int length = countRange(mappedRanges,mstart,mend);
+
+ if (length != -1)
+ {
+ // add 3 to mapped length to allow for a mapped stop codon
+ if (length + 3 >= (mend - mstart + 1))
+ {
+ return true;
+ }
+ }
+ if (either)
+ {
+ // also check coverage of the other range
+ length = countRange(otherRanges, ostart, oend);
+ if (length != -1)
+ {
+ if (length + 1 >= (oend - ostart + 1))
+ {
+ return true;
+ }
+ }
+ }
+ return false;
+ }
+ private int countRange(List<int[]> mappedRanges,int mstart,int mend)
+ {
+ int length=0;
for (int[] range : mappedRanges)
{
int from = Math.min(range[0], range[1]);
int to = Math.max(range[0], range[1]);
- if (from < seq.getStart() || to > seq.getEnd())
+ if (from < mstart || to > mend)
{
- return false;
+ return -1;
}
length += (to - from + 1);
}
- // add 1 to mapped length to allow for a mapped stop codon
- if (length + 1 < (seq.getEnd() - seq.getStart() + 1))
- {
- return false;
- }
- return true;
+ return length;
}
/**
* Adds any regions mapped to or from position {@code pos} in sequence
* {@code seq} to the given search results
-- *
++ * Note: recommend first using the .covers(,true,true) to ensure mapping covers both sequences
* @param seq
* @param pos
* @param sr
}
/**
+ * Return the corresponding aligned or dataset dna sequence for given amino
+ * acid sequence, or null if not found. returns the sequence from the first
+ * mapping found that involves the protein sequence.
*
- * @param sequenceRef
- * @return null or corresponding aaSeq entry for dnaSeq entry
+ * @param aaSeqRef
+ * @return
*/
public SequenceI getDnaForAaSeq(SequenceI aaSeqRef)
{
/**
* Add search results for regions in other sequences that translate or are
- * translated from a particular position in seq
+ * translated from a particular position in seq (which may be an aligned or
+ * dataset sequence)
*
* @param seq
* @param index
public void markMappedRegion(SequenceI seq, int index,
SearchResultsI results)
{
- int[] codon;
SequenceI ds = seq.getDatasetSequence();
- for (SequenceToSequenceMapping ssm : mappings)
+ if (ds == null)
{
- if (ssm.covers(seq,true,true))
- {
- if ((ssm.fromSeq == seq || ssm.fromSeq == ds))
- {
- codon = ssm.mapping.map.locateInTo(index, index);
- if (codon != null)
- {
- for (int i = 0; i < codon.length; i += 2)
- {
- results.addResult(ssm.mapping.to, codon[i], codon[i + 1]);
- }
- }
- }
- else if ((ssm.mapping.to == seq || ssm.mapping.to == ds))
- {
- {
- codon = ssm.mapping.map.locateInFrom(index, index);
- if (codon != null)
- {
- for (int i = 0; i < codon.length; i += 2)
- {
- results.addResult(ssm.fromSeq, codon[i], codon[i + 1]);
- }
- }
- }
- }}
+ ds = seq;
}
- }
-
- /**
- * Returns the DNA codon positions (base 1) for the given position (base 1) in
- * a mapped protein sequence, or null if no mapping is found.
- *
- * Intended for use in aligning cDNA to match aligned protein. Only the first
- * mapping found is returned, so not suitable for use if multiple protein
- * sequences are mapped to the same cDNA (but aligning cDNA as protein is
- * ill-defined for this case anyway).
- *
- * @param seq
- * the DNA dataset sequence
- * @param aaPos
- * residue position (base 1) in a protein sequence
- * @return
- */
- public int[] getDnaPosition(SequenceI seq, int aaPos)
- {
- /*
- * Adapted from markMappedRegion().
- */
- MapList ml = null;
- int i = 0;
for (SequenceToSequenceMapping ssm : mappings)
{
- ssm.markMappedRegion(ds, index, results);
- if (ssm.fromSeq == seq)
- {
- ml = getdnaToProt()[i];
- break;
++ if (ssm.covers(seq,true,true)) {
++ ssm.markMappedRegion(ds, index, results);
+ }
- i++;
}
- return ml == null ? null : ml.locateInFrom(aaPos, aaPos);
}
/**
* Two AlignedCodonFrame objects are equal if they hold the same ordered list
* of mappings
*
- * @see SequenceToSequenceMapping#
+ * @see SequenceToSequenceMapping#equals
*/
@Override
public boolean equals(Object obj)
{
return mappings;
}
+
+ /**
+ * Returns the first mapping found which is between the two given sequences,
+ * and covers the full extent of both.
+ *
+ * @param seq1
+ * @param seq2
+ * @return
+ */
+ public SequenceToSequenceMapping getCoveringMapping(SequenceI seq1,
+ SequenceI seq2)
+ {
+ for (SequenceToSequenceMapping mapping : mappings)
+ {
+ if (mapping.covers(seq2) && mapping.covers(seq1))
+ {
+ return mapping;
+ }
+ }
+ return null;
+ }
+
+ /**
+ * Returns the first mapping found which is between the given dataset sequence
+ * and another, is a triplet mapping (3:1 or 1:3), and covers the full extent
+ * of both sequences involved
+ *
+ * @param seq
+ * @return
+ */
+ public SequenceToSequenceMapping getCoveringCodonMapping(SequenceI seq)
+ {
+ for (SequenceToSequenceMapping mapping : mappings)
+ {
+ if (mapping.getMapping().getMap().isTripletMap()
+ && mapping.covers(seq))
+ {
+ if (mapping.fromSeq == seq
+ && mapping.covers(mapping.getMapping().getTo()))
+ {
+ return mapping;
+ }
+ else if (mapping.getMapping().getTo() == seq
+ && mapping.covers(mapping.fromSeq))
+ {
+ return mapping;
+ }
+ }
+ }
+ return null;
+ }
}
import jalview.datamodel.AlignmentOrder;
import jalview.datamodel.ColumnSelection;
import jalview.datamodel.HiddenColumns;
+ import jalview.datamodel.Mapping;
import jalview.datamodel.SearchResultMatchI;
import jalview.datamodel.SearchResults;
import jalview.datamodel.SearchResultsI;
*/
int startResiduePos = selected.findPosition(firstUngappedPos);
int endResiduePos = selected.findPosition(lastUngappedPos);
-
- for (AlignedCodonFrame acf : codonFrames)
+ for (SequenceI seq : mapTo.getAlignment().getSequences())
{
- for (SequenceI seq : mapTo.getAlignment().getSequences())
+ int mappedStartResidue = 0;
+ int mappedEndResidue = 0;
+ for (AlignedCodonFrame acf : codonFrames)
{
- SequenceI peptide = targetIsNucleotide ? selected : seq;
- SequenceI cds = targetIsNucleotide ? seq : selected;
- SequenceToSequenceMapping s2s = acf.getCoveringMapping(cds,
- peptide);
- if (s2s == null)
- {
- continue;
- }
- int mappedStartResidue = 0;
- int mappedEndResidue = 0;
- List<AlignedCodonFrame> mapping = Arrays.asList(acf);
- SearchResultsI sr = buildSearchResults(selected, startResiduePos,
- mapping);
- for (SearchResultMatchI m : sr.getResults())
++ // rather than use acf.getCoveringMapping() we iterate through all
++ // mappings to make sure all CDS are selected for a protein
+ for (SequenceToSequenceMapping map: acf.getMappings())
{
- mappedStartResidue = m.getStart();
- mappedEndResidue = m.getEnd();
- }
- sr = buildSearchResults(selected, endResiduePos, mapping);
- for (SearchResultMatchI m : sr.getResults())
+ if (map.covers(selected) && map.covers(seq))
{
- mappedStartResidue = Math.min(mappedStartResidue, m.getStart());
- mappedEndResidue = Math.max(mappedEndResidue, m.getEnd());
- }
+ /*
+ * Found a sequence mapping. Locate the start/end mapped residues.
+ */
+ List<AlignedCodonFrame> mapping = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+ // locate start
+ SearchResultsI sr = buildSearchResults(selected,
+ startResiduePos, mapping);
+ for (SearchResultMatchI m : sr.getResults())
+ {
+ mappedStartResidue = m.getStart();
+ mappedEndResidue = m.getEnd();
+ }
+ // locate end - allowing for adjustment of start range
+ sr = buildSearchResults(selected, endResiduePos, mapping);
+ for (SearchResultMatchI m : sr.getResults())
+ {
+ mappedStartResidue = Math.min(mappedStartResidue,
+ m.getStart());
+ mappedEndResidue = Math.max(mappedEndResidue, m.getEnd());
+ }
- /*
- * Find the mapped aligned columns, save the range. Note findIndex
- * returns a base 1 position, SequenceGroup uses base 0
- */
- int mappedStartCol = seq.findIndex(mappedStartResidue) - 1;
- minStartCol = minStartCol == -1 ? mappedStartCol
- : Math.min(minStartCol, mappedStartCol);
- int mappedEndCol = seq.findIndex(mappedEndResidue) - 1;
- maxEndCol = maxEndCol == -1 ? mappedEndCol
- : Math.max(maxEndCol, mappedEndCol);
- mappedGroup.addSequence(seq, false);
- break;
- }
+ /*
+ * Find the mapped aligned columns, save the range. Note findIndex
+ * returns a base 1 position, SequenceGroup uses base 0
+ */
+ int mappedStartCol = seq.findIndex(mappedStartResidue) - 1;
+ minStartCol = minStartCol == -1 ? mappedStartCol
+ : Math.min(minStartCol, mappedStartCol);
+ int mappedEndCol = seq.findIndex(mappedEndResidue) - 1;
+ maxEndCol = maxEndCol == -1 ? mappedEndCol
+ : Math.max(maxEndCol, mappedEndCol);
+ mappedGroup.addSequence(seq, false);
+ break;
+ }
+ }}
}
}
mappedGroup.setStartRes(minStartCol < 0 ? 0 : minStartCol);
{
for (AlignedCodonFrame acf : mappings)
{
- SequenceI mappedSeq = mappingToNucleotide ? acf.getDnaForAaSeq(seq)
- : acf.getAaForDnaSeq(seq);
- if (mappedSeq != null)
- {
for (SequenceI seq2 : mapTo.getSequences())
{
- if (seq2.getDatasetSequence() == mappedSeq)
+ /*
+ * the corresponding peptide / CDS is the one for which there is
+ * a complete ('covering') mapping to 'seq'
+ */
+ SequenceI peptide = mappingToNucleotide ? seq2 : seq;
+ SequenceI cds = mappingToNucleotide ? seq : seq2;
+ SequenceToSequenceMapping s2s = acf.getCoveringMapping(cds,
+ peptide);
+ if (s2s != null)
{
mappedOrder.add(seq2);
j++;
break;
}
}
- }
}
}
if (colsel == null)
{
- return; // mappedColumns;
+ return;
}
char fromGapChar = mapFrom.getAlignment().getGapCharacter();
mapHiddenColumns(regions.next(), codonFrames, newHidden,
fromSequences, toSequences, fromGapChar);
}
- return; // mappedColumns;
+ return;
}
/**
*/
for (SequenceI toSeq : toSequences)
{
- if (toSeq.getDatasetSequence() == mappedSeq)
+ if (toSeq.getDatasetSequence() == mappedSeq
+ && mappedStartResidue >= toSeq.getStart()
+ && mappedEndResidue <= toSeq.getEnd())
{
int mappedStartCol = toSeq.findIndex(mappedStartResidue);
int mappedEndCol = toSeq.findIndex(mappedEndResidue);
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
- import java.awt.Color;
- import java.io.IOException;
- import java.util.ArrayList;
- import java.util.Arrays;
- import java.util.Iterator;
- import java.util.List;
-
- import org.testng.annotations.BeforeClass;
- import org.testng.annotations.Test;
-
import jalview.api.AlignViewportI;
import jalview.bin.Cache;
import jalview.commands.EditCommand;
protein.setCodonFrames(acfList);
/*
- * Select Seq1 and Seq3 in the protein (startRes=endRes=0)
+ * Select Seq1 and Seq3 in the protein
*/
SequenceGroup sg = new SequenceGroup();
sg.setColourText(true);
sg.setOutlineColour(Color.LIGHT_GRAY);
sg.addSequence(protein.getSequenceAt(0), false);
sg.addSequence(protein.getSequenceAt(2), false);
+ sg.setEndRes(protein.getWidth() - 1);
/*
* Verify the mapped sequence group in dna
assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0));
assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1));
assertEquals(0, mappedGroup.getStartRes());
- assertEquals(2, mappedGroup.getEndRes());
+ assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon)
/*
* Verify mapping sequence group from dna to protein
overlap = MappingUtils.findOverlap(ranges, 13, 15);
assertNull(overlap);
}
+
+ /**
+ * Test mapping a sequence group where sequences in and outside the group
+ * share a dataset sequence (e.g. alternative CDS for the same gene)
+ * <p>
+ * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+ * @throws IOException
+ */
+ @Test(groups = { "Functional" })
+ public void testMapSequenceGroup_sharedDataset() throws IOException
+ {
+ /*
+ * Set up dna and protein Seq1/2/3 with mappings (held on the protein
+ * viewport). CDS sequences share the same 'gene' dataset sequence.
+ */
+ SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
+ SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
+ SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
+ SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
+
+ cds1.setDatasetSequence(dna);
+ cds2.setDatasetSequence(dna);
+ cds3.setDatasetSequence(dna);
+
+ SequenceI pep1 = new Sequence("pep1", "KF");
+ SequenceI pep2 = new Sequence("pep2", "FG");
+ SequenceI pep3 = new Sequence("pep3", "GP");
+ pep1.createDatasetSequence();
+ pep2.createDatasetSequence();
+ pep3.createDatasetSequence();
+
+ /*
+ * add mappings from coding positions of dna to respective peptides
+ */
+ AlignedCodonFrame acf = new AlignedCodonFrame();
+ acf.addMap(dna, pep1,
+ new MapList(new int[]
+ { 1, 6 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep2,
+ new MapList(new int[]
+ { 4, 9 }, new int[] { 1, 2 }, 3, 1));
+ acf.addMap(dna, pep3,
+ new MapList(new int[]
+ { 19, 24 }, new int[] { 1, 2 }, 3, 1));
+
+ List<AlignedCodonFrame> acfList = Arrays
+ .asList(new AlignedCodonFrame[]
+ { acf });
+
+ AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
+ AlignmentI protein = new Alignment(
+ new SequenceI[]
+ { pep1, pep2, pep3 });
+ AlignViewportI cdnaView = new AlignViewport(cdna);
+ AlignViewportI peptideView = new AlignViewport(protein);
+ protein.setCodonFrames(acfList);
+
+ /*
+ * Select pep1 and pep3 in the protein alignment
+ */
+ SequenceGroup sg = new SequenceGroup();
+ sg.setColourText(true);
+ sg.setIdColour(Color.GREEN);
+ sg.setOutlineColour(Color.LIGHT_GRAY);
+ sg.addSequence(pep1, false);
+ sg.addSequence(pep3, false);
+ sg.setEndRes(protein.getWidth() - 1);
+
+ /*
+ * Verify the mapped sequence group in dna is cds1 and cds3
+ */
+ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+ peptideView, cdnaView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(cds1, mappedGroup.getSequences().get(0));
+ assertSame(cds3, mappedGroup.getSequences().get(1));
+ // columns 1-6 selected (0-5 base zero)
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(5, mappedGroup.getEndRes());
+
+ /*
+ * Select mapping sequence group from dna to protein
+ */
+ sg.clear();
+ sg.addSequence(cds2, false);
+ sg.addSequence(cds1, false);
+ sg.setStartRes(0);
+ sg.setEndRes(cdna.getWidth() - 1);
+ mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
+ assertTrue(mappedGroup.getColourText());
+ assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+ assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+ assertEquals(2, mappedGroup.getSequences().size());
+ assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
+ assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
+ assertEquals(0, mappedGroup.getStartRes());
+ assertEquals(1, mappedGroup.getEndRes()); // two columns
+ }
}