JAL-3822 pass panel height and width to wrapped geometry calculations

diff --git a/src/jalview/gui/SeqCanvas.java b/src/jalview/gui/SeqCanvas.java
index b27208a..a9b9d4d 100755 (executable)
--- a/src/jalview/gui/SeqCanvas.java
+++ b/src/jalview/gui/SeqCanvas.java
@@ -456,7 +456,7 @@ public class SeqCanvas extends JPanel implements ViewportListenerI
 
       if (av.getWrapAlignment())
       {
-        drawWrappedPanel(gg, width, height, ranges.getStartRes());
+        drawWrappedPanel(gg, getWidth(), getHeight(), ranges.getStartRes());
       }
       else
       {

diff --git a/src/jalview/gui/SeqPanel.java b/src/jalview/gui/SeqPanel.java
index 4ffefba..163ae25 100644 (file)
--- a/src/jalview/gui/SeqPanel.java
+++ b/src/jalview/gui/SeqPanel.java
@@ -275,6 +275,9 @@ public class SeqPanel extends JPanel
   /**
    * Computes the column and sequence row (and possibly annotation row when in
    * wrapped mode) for the given mouse position
+   * <p>
+   * Mouse position is not set if in wrapped mode with the cursor either between
+   * sequences, or over the left or right vertical scale.
    * 
    * @param evt
    * @return
@@ -342,6 +345,9 @@ public class SeqPanel extends JPanel
   /**
    * Returns the aligned sequence position (base 0) at the mouse position, or
    * the closest visible one
+   * <p>
+   * Returns -1 if in wrapped mode with the mouse over either left or right
+   * vertical scale.
    * 
    * @param evt
    * @return

diff --git a/test/jalview/gui/SeqPanelTest.java b/test/jalview/gui/SeqPanelTest.java
index a03819d..b0fc116 100644 (file)
--- a/test/jalview/gui/SeqPanelTest.java
+++ b/test/jalview/gui/SeqPanelTest.java
@@ -24,6 +24,17 @@ import static org.testng.Assert.assertEquals;
 import static org.testng.Assert.assertNull;
 import static org.testng.Assert.assertTrue;
 
+import java.awt.EventQueue;
+import java.awt.FontMetrics;
+import java.awt.event.MouseEvent;
+import java.lang.reflect.InvocationTargetException;
+
+import javax.swing.JLabel;
+
+import org.testng.annotations.AfterMethod;
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.Test;
+
 import jalview.api.AlignViewportI;
 import jalview.bin.Cache;
 import jalview.bin.Jalview;
@@ -33,6 +44,8 @@ import jalview.commands.EditCommand.Edit;
 import jalview.datamodel.Alignment;
 import jalview.datamodel.AlignmentAnnotation;
 import jalview.datamodel.AlignmentI;
+import jalview.datamodel.SearchResults;
+import jalview.datamodel.SearchResultsI;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceI;
 import jalview.gui.SeqPanel.MousePos;
@@ -40,17 +53,6 @@ import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
 import jalview.util.MessageManager;
 import jalview.viewmodel.ViewportRanges;
-
-import java.awt.EventQueue;
-import java.awt.event.MouseEvent;
-import java.lang.reflect.InvocationTargetException;
-
-import javax.swing.JLabel;
-
-import org.testng.annotations.AfterMethod;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
-
 import junit.extensions.PA;
 
 public class SeqPanelTest
@@ -635,6 +637,7 @@ public class SeqPanelTest
   {
     Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
     Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+    Cache.applicationProperties.setProperty("FONT_SIZE", "10");
     AlignFrame alignFrame = new FileLoader().LoadFileWaitTillLoaded(
             "examples/uniref50.fa", DataSourceType.FILE);
     AlignViewportI av = alignFrame.getViewport();
@@ -902,4 +905,157 @@ public class SeqPanelTest
       e.printStackTrace();
     }
   }
+  @Test(groups = "Functional")
+  public void testFindMousePosition_wrapped_scales_longSequence()
+  {
+    Cache.applicationProperties.setProperty("SHOW_ANNOTATIONS", "false");
+    Cache.applicationProperties.setProperty("WRAP_ALIGNMENT", "true");
+    Cache.applicationProperties.setProperty("FONT_SIZE", "14");
+    Cache.applicationProperties.setProperty("FONT_NAME", "SansSerif");
+    Cache.applicationProperties.setProperty("FONT_STYLE", "0");
+    // sequence of 50 bases, doubled 10 times, = 51200 bases
+    String dna = "ATGGCCATTGGGCCCAAATTTCCCAAAGGGTTTCCCTGAGGTCAGTCAGA";
+    for (int i = 0 ; i < 10 ; i++)
+    {
+      dna += dna;
+    }
+    assertEquals(dna.length(), 51200);
+    AlignFrame alignFrame = new FileLoader()
+            .LoadFileWaitTillLoaded(dna, DataSourceType.PASTE);
+    SeqPanel testee = alignFrame.alignPanel.getSeqPanel();
+    AlignViewport av = alignFrame.getViewport();
+    av.setScaleAboveWrapped(true);
+    av.setScaleLeftWrapped(true);
+    av.setScaleRightWrapped(true);
+    alignFrame.alignPanel.updateLayout();
+
+    try
+    {
+      Thread.sleep(200);
+    } catch (InterruptedException e)
+    {
+    }
+  
+    final int charHeight = av.getCharHeight();
+    final int charWidth = av.getCharWidth();
+    assertEquals(charHeight, 17);
+    assertEquals(charWidth, 12);
+    
+    FontMetrics fm = testee.getFontMetrics(av.getFont());
+    int labelWidth = fm.stringWidth("00000") + charWidth;
+    assertEquals(labelWidth, 57); // 5 x 9 + charWidth
+    assertEquals(testee.seqCanvas.getLabelWidthWest(), labelWidth);
+
+    int x = 0;
+    int y = 0;
+  
+    /*
+     * mouse at top left of wrapped panel; there is a gap of 2 * charHeight
+     * above the alignment
+     */
+    MouseEvent evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y,
+            0, 0, 0, false, 0);
+    MousePos pos = testee.findMousePosition(evt);
+    assertEquals(pos.column, -1); // over scale left, not an alignment column
+    assertEquals(pos.seqIndex, -1); // above sequences
+    assertEquals(pos.annotationIndex, -1);
+
+    /*
+     * cursor over scale above first sequence
+     */
+    y += charHeight;
+    x = labelWidth;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, -1);
+    assertEquals(pos.column, 0);
+    assertEquals(pos.annotationIndex, -1);
+    
+    /*
+     * cursor over scale left of first sequence
+     */
+    y += charHeight;
+    x = 0;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, 0);
+    assertEquals(pos.column, -1);
+    assertEquals(pos.annotationIndex, -1);
+  
+    /*
+     * cursor over start of first sequence
+     */
+    x = labelWidth;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, 0);
+    assertEquals(pos.column, 0);
+    assertEquals(pos.annotationIndex, -1);
+  
+    /*
+     * move one character right, to bottom pixel of same row
+     */
+    x += charWidth;
+    y += charHeight - 1;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, 0);
+    assertEquals(pos.column, 1);
+    
+    /*
+     * move down one pixel - now in the no man's land between rows
+     */
+    y += 1;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, -1);
+    assertEquals(pos.column, 1);
+    
+    /*
+     * move down two char heights less one pixel - still in the no man's land
+     * (scale above + spacer line)
+     */
+    y += (2 * charHeight - 1);
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, -1);
+    assertEquals(pos.column, 1);
+    
+    /*
+     * move down one more pixel - now on the next row of the sequence
+     */
+    y += 1;
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, 0);
+    assertEquals(pos.column, 1 + av.getWrappedWidth());
+    
+    /*
+     * scroll to near the end of the sequence
+     */
+    SearchResultsI sr = new SearchResults();
+    int scrollTo = dna.length() - 1000;
+    sr.addResult(av.getAlignment().getSequenceAt(0), scrollTo, scrollTo); 
+    alignFrame.alignPanel.scrollToPosition(sr);
+    
+    /*
+     * place the mouse on the first column of the 6th sequence, and
+     * verify that (computed) findMousePosition matches (actual) ViewportRanges
+     */
+    x = labelWidth;
+    y = 17 * charHeight; // 17 = 6 times two header rows and 5 sequence rows
+    evt = new MouseEvent(testee, MouseEvent.MOUSE_MOVED, 0L, 0, x, y, 0, 0, 0,
+            false, 0);
+    pos = testee.findMousePosition(evt);
+    assertEquals(pos.seqIndex, 0);
+    int expected = av.getRanges().getStartRes() + 5 * av.getWrappedWidth();
+    assertEquals(pos.column, expected);
+  }
 }