--- /dev/null
+2.1.2
+
+.\" DO NOT MODIFY THIS FILE! It was generated by help2man 1.38.2.
+.TH RNAUP "1" "July 2013" "RNAup 2.1.2" "User Commands"
+.SH NAME
+RNAup \- manual page for RNAup 2.1.2
+.SH SYNOPSIS
+.B RNAup
+[\fIOPTIONS\fR]...
+.SH DESCRIPTION
+RNAup 2.1.2
+.PP
+Calculate the thermodynamics of RNA\-RNA interactions
+.PP
+RNAup calculates the thermodynamics of RNA\-RNA interactions, by decomposing the
+binding into two stages. (1) First the probability that a potential binding
+sites remains unpaired (equivalent to the free energy needed to open the site)
+is computed. (2) Then this accessibility is combined with the interaction
+energy to obtain the total binding energy. All calculations are done by
+computing partition functions over all possible conformations.
+.PP
+
+RNAup provides two different modes: By default RNAup computes accessibilities,
+in terms of the free energies needed to open a region (default length 4). It
+prints the region of highest accessibility and its opening energy to stdout,
+opening energies for all other regions are written to a file.
+
+.br
+In interaction mode the interaction between two RNAs is calculated. It is
+invoked if the input consists of two sequences concatenated with an "&",
+or if the options -X[pf] or -b are given. Unless the -b option is specified
+RNAup assumes that the longer RNA is a structured target sequence
+while the shorter one is an unstructured small RNA.
+.br
+Additionally, for every position along the target sequence we write the best
+free energy of binding for an interaction that includes this position to the
+the output file.
+Output to stdout consists of the location and free energy, dG,
+for the optimal region of interaction. The binding energy dG is also split into
+its components the interaction energy dGint and the opening energy dGu_l (and
+possibly dGu_s for the shorter sequence).
+.br
+In addition we print the optimal interaction structure as computed by RNAduplex
+for this region. Note that it can happen that the RNAduplex computed optimal
+interaction does not coincide with the optimal RNAup region. If the two
+predictions don't match the structure string is replaced by a run of "."
+and a message is written to stderr.
+.br
+
+Each sequence should be in 5' to 3' direction. If the sequence is preceded
+by a line of the form
+.nf
+.ft CW
+> name
+.ft
+.fi
+
+the output file "name_ux_up.out" is produced, where the "x" in "ux" is the
+value set by the -u option. Otherwise the file name defaults to
+RNA_ux_up.out. The output is concatenated if a file with the same name exists.
+.br
+
+RNA sequences are read from stdin as strings of characters. White space and
+newline within a sequence cause an error! Newline is used to separate
+sequences. The program will continue to read new sequences until a line
+consisting of the single character @ or an end of file condition is
+encountered.
+.TP
+\fB\-h\fR, \fB\-\-help\fR
+Print help and exit
+.TP
+\fB\-\-detailed\-help\fR
+Print help, including all details and hidden
+options, and exit
+.TP
+\fB\-\-full\-help\fR
+Print help, including hidden options, and exit
+.TP
+\fB\-V\fR, \fB\-\-version\fR
+Print version and exit
+.SS "General Options:"
+.IP
+Below are command line options which alter the general behavior of this
+program
+.TP
+\fB\-C\fR, \fB\-\-constraint\fR
+Calculate structures subject to constraints.
+(default=off)
+.IP
+The program reads first the sequence(s), then a string containing constraints
+on the structure encoded with the symbols:
+.IP
+\&. (no constraint for this base)
+.IP
+x (the base is unpaired)
+< (base i is paired with a base j>i) (solely used for calculation of
+.IP
+unpaired regions)
+.IP
+\f(CW> (base i is paired with a base j<i) (solely used for calculation of\fR
+.IP
+unpaired regions)
+.IP
+( ) (base i pairs base j)
+| (the corresponding base has to be paired intermolecularily (works only in
+.IP
+interaction mode)
+.TP
+\fB\-o\fR, \fB\-\-no_output_file\fR
+Do not produce an output file
+.IP
+(default=off)
+.TP
+\fB\-\-no_header\fR
+Do not produce a header with the command line
+parameters used in the outputfile
+.IP
+(default=off)
+.TP
+\fB\-\-noconv\fR
+Do not automatically substitude nucleotide "T"
+with "U"
+.IP
+(default=off)
+.SS "Calculations of opening energies:"
+.TP
+\fB\-u\fR, \fB\-\-ulength\fR=\fIlength\fR
+specifies the length of the unstructured region
+in the output.
+.IP
+(default=`4')
+.IP
+The probability of being unpaired is plotted on the right border of the
+unpaired region. You can specify up to 20 different length values: use "\-"
+to specify a range of continuous values (e.g. \fB\-u\fR 4\-8) or specify a list of
+comma separated values (e.g. \fB\-u\fR 4,8,15).
+.TP
+\fB\-c\fR, \fB\-\-contributions\fR=\fISHIME\fR
+Specify the contributions listed in the output
+(default=`S')
+.IP
+By default only the full probability of being unpaired is plotted. The \fB\-c\fR
+option allows to get the different contributions (c) to the probability of
+being unpaired: The full probability of being unpaired ("S" is the sum of
+the probability of being unpaired in the exterior loop ("E"), within a
+hairpin loop ("H"), within an interior loop ("I") and within a multiloop
+("M"). Any combination of these letters may be given.
+.SS "Calculations of RNA-RNA interactions:"
+.TP
+\fB\-w\fR, \fB\-\-window\fR=\fIINT\fR
+Determine the maximal length of the region of
+interaction
+.IP
+(default=`25')
+.TP
+\fB\-b\fR, \fB\-\-include_both\fR
+Include the probability of unpaired regions in
+both (b) RNAs. By default
+only the probability of being unpaired in the
+longer RNA (target) is used.
+.IP
+(default=off)
+.TP
+\fB\-5\fR, \fB\-\-extend5\fR=\fIINT\fR
+Extend the region of interaction in the target to
+some residues on the 5' side
+.IP
+The underlying assumption is that it is favorable for an interaction if not
+only the direct region of contact is unpaired but also a few residues 5'
+.TP
+\fB\-3\fR, \fB\-\-extend3\fR=\fIINT\fR
+Extend the region of interaction in the target to
+some residues on the 3' side
+.IP
+The underlying assumption is that it is favorable for an interaction if not
+only the direct region of contact is unpaired but also a few residues 3'
+.TP
+\fB\-\-interaction_pairwise\fR
+Activate pairwise interaction mode
+(default=off)
+.IP
+The first sequence interacts with the 2nd, the third with the 4th etc. If
+activated, two interacting sequences may be given in a single line separated
+by "&" or each sequence may be given on an extra line.
+.TP
+\fB\-\-interaction_first\fR
+Activate interaction mode using first sequence
+only
+.IP
+(default=off)
+.IP
+The interaction of each sequence with the first one is calculated (e.g.
+interaction of one mRNA with many small RNAs). Each sequence has to be given
+on an extra line
+.SS "Model Details:"
+.TP
+\fB\-S\fR, \fB\-\-pfScale\fR=\fIDOUBLE\fR
+In the calculation of the pf use scale*mfe as an
+estimate for the ensemble free energy (used to
+avoid overflows). The default is 1.07, useful
+values are 1.0 to 1.2. Occasionally needed for
+long sequences.
+You can also recompile the program to use
+double precision (see the README file).
+.TP
+\fB\-T\fR, \fB\-\-temp\fR=\fIDOUBLE\fR
+Rescale energy parameters to a temperature of
+temp C. Default is 37C.
+.TP
+\fB\-4\fR, \fB\-\-noTetra\fR
+Do not include special tabulated stabilizing
+energies for tri\-, tetra\- and hexaloop
+hairpins. Mostly for testing.
+.IP
+(default=off)
+.TP
+\fB\-d\fR, \fB\-\-dangles\fR=\fIINT\fR
+How to treat "dangling end" energies for bases
+adjacent to helices in free ends and
+multi\-loops
+.IP
+(default=`2')
+.IP
+With \fB\-d2\fR dangling energies will be added for the bases adjacent to a helix on
+both sides in any case.
+.IP
+The option \fB\-d0\fR ignores dangling ends altogether (mostly for debugging).
+.TP
+\fB\-\-noLP\fR
+Produce structures without lonely pairs (helices
+of length 1).
+.IP
+(default=off)
+.IP
+For partition function folding this only disallows pairs that can only occur
+isolated. Other pairs may still occasionally occur as helices of length 1.
+.TP
+\fB\-\-noGU\fR
+Do not allow GU pairs
+.IP
+(default=off)
+.TP
+\fB\-\-noClosingGU\fR
+Do not allow GU pairs at the end of helices
+.IP
+(default=off)
+.TP
+\fB\-P\fR, \fB\-\-paramFile\fR=\fIparamfile\fR
+Read energy parameters from paramfile, instead of
+using the default parameter set.
+.IP
+A sample parameter file should accompany your distribution.
+See the RNAlib documentation for details on the file format.
+.TP
+\fB\-\-nsp\fR=\fISTRING\fR
+Allow other pairs in addition to the usual
+AU,GC,and GU pairs.
+.IP
+Its argument is a comma separated list of additionally allowed pairs. If the
+first character is a "\-" then AB will imply that AB and BA are allowed
+pairs.
+e.g. RNAfold \fB\-nsp\fR \fB\-GA\fR will allow GA and AG pairs. Nonstandard pairs are
+given 0 stacking energy.
+.TP
+\fB\-e\fR, \fB\-\-energyModel\fR=\fIINT\fR
+Rarely used option to fold sequences from the
+artificial ABCD... alphabet, where A pairs B,
+C\-D etc. Use the energy parameters for GC (\fB\-e\fR
+1) or AU (\fB\-e\fR 2) pairs.
+.SH EXAMPLES
+
+.B Output to stdout:
+
+In Interaction mode RNAup prints the most favorable interaction energy
+between the two sequences to stdout. The most favorable interaction energy
+(dG) depends on the position in the longer sequence (region [i,j]) and the
+position in the shorter sequence (region[k,l]): dG[i,j;k,l]. dG[i,j;k,l] is the
+largest contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the
+output file: therefore dG[i,j;k,l] <= dG[i,j].
+
+.nf
+.ft CW
+ '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
+ > franz
+ GGAGUAGGUUAUCCUCUGUU
+ > sissi
+ AGGACAACCU
+ dG = dGint + dGu_l
+ (((((.((((&)))).))))) 6,15 : 1,10 (-6.66 = -9.89 + 3.23)
+ AGGUUAUCCU&AGGACAACCU
+ RNAup output in file: franz_sissi_w25_u3_4_up.out
+.ft
+.fi
+
+where the result line contains following information
+
+.nf
+.ft CW
+ RNAduplex results [i,j] [k,l] dG = dGint + dGu_l
+ (((((.((((&)))).))))) 6,15 : 1,10 (-6.66=-9.89+3.23)
+.ft
+.fi
+
+
+.RD
+.B Output to file:
+
+Output to file contains a header including date, the command line of the
+call to RNAup, length and names of the input sequence(s) followed
+by the sequence(s). The first sequence is the target sequence.
+Printing of the header can be turned off using the -nh option.
+
+The line directly after the header gives the column names for the output:
+
+.nf
+.ft CW
+ position dGu_l for -u 3 dGu_l for -u 4 dG
+# pos u3S u3H u4S u4H dG
+.ft
+.fi
+
+where all information refers to the target sequence. The dGu_l column contains
+information about the -u value (u=3 or u=4) and the contribution to the free
+energy to open all structures "S" or only hairpin loops "H", see option -c.
+NA means that no results is possible (e.g. column u3S row 2: no region of
+length 3 ending at position 2 exists).
+
+.nf
+.ft CW
+# Thu Apr 10 09:15:11 2008
+# RNAup -u 3,4 -c SH -b
+# 20 franz
+# GGAGUAGGUUAUCCUCUGUU
+# 10 sissi
+# AGGACAACCU
+# pos u3S u3H u4S u4H dG
+ 1 NA NA NA NA -1.540
+ 2 NA NA NA NA -1.540
+ 3 1.371 NA NA NA -1.217
+ 4 1.754 5.777 1.761 NA -1.393
+ 5 1.664 3.140 1.811 5.800 -1.393
+.ft
+.fi
+
+
+If the -b option is selected position and dGu_s values for the shorter sequence
+are written after the information for the target sequence.
+.SH AUTHOR
+
+Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz
+.SH REFERENCES
+.I If you use this program in your work you might want to cite:
+
+R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker (2011),
+"ViennaRNA Package 2.0",
+Algorithms for Molecular Biology: 6:26
+
+I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994),
+"Fast Folding and Comparison of RNA Secondary Structures",
+Monatshefte f. Chemie: 125, pp 167-188
+
+
+U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker (2006),
+"Thermodynamics of RNA-RNA Binding",
+Bioinformatics: 22(10), pp 1177-1182
+
+.I The energy parameters are taken from:
+
+D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner (2004),
+"Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure",
+Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292
+
+D.H Turner, D.H. Mathews (2009),
+"NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure",
+Nucleic Acids Research: 38, pp 280-282
+.SH "REPORTING BUGS"
+If in doubt our program is right, nature is at fault.
+.br
+Comments should be sent to rna@tbi.univie.ac.at.
git://source.jalview.org / jabaws.git / blobdiff