*/
public SequenceI getSequence(String sourceDb, List<SequenceI> peptides)
{
- SequenceI dna = new Sequence(sourceDb + "|" + accession,
- sequence.getSequence());
+ SequenceI dna = makeSequence(sourceDb);
dna.setDescription(description);
DBRefEntry retrievedref = new DBRefEntry(sourceDb,
getSequenceVersion(), accession);
dna.addDBRef(retrievedref);
+ dna.setSourceDBRef(retrievedref);
// add map to indicate the sequence is a valid coordinate frame for the
// dbref
retrievedref.setMap(new Mapping(null, new int[] { 1, dna.getLength() },
}
/**
+ * @param sourceDb
+ * @return
+ */
+ SequenceI makeSequence(String sourceDb)
+ {
+ SequenceI dna = new Sequence(sourceDb + "|" + accession,
+ sequence.getSequence());
+ return dna;
+ }
+
+ /**
* Extracts coding region and product from a CDS feature and properly decorate
* it with annotations.
*
Mapping dnaToProteinMapping = null;
if (translation != null && proteinName != null && proteinId != null)
{
+ int translationLength = translation.length();
+
/*
* look for product in peptides list, if not found, add it
*/
product = matcher.findIdMatch(proteinId);
if (product == null)
{
- product = new Sequence(proteinId, translation, 1, translation.length());
+ product = new Sequence(proteinId, translation, 1, translationLength);
product.setDescription(((proteinName.length() == 0) ? "Protein Product from "
+ sourceDb
: proteinName));
// sequence
if (exons == null || exons.length == 0)
{
+ /*
+ * workaround until we handle dna location for CDS sequence
+ * e.g. location="X53828.1:60..1058" correctly
+ */
System.err
.println("Implementation Notice: EMBLCDS records not properly supported yet - Making up the CDNA region of this sequence... may be incorrect ("
+ sourceDb + ":" + getAccession() + ")");
- if (translation.length() * 3 == (1 - codonStart + dna.getSequence().length))
+ if (translationLength * 3 == (1 - codonStart + dna.getSequence().length))
{
System.err
.println("Not allowing for additional stop codon at end of cDNA fragment... !");
- // this might occur for CDS sequences where no features are
- // marked.
+ // this might occur for CDS sequences where no features are marked
exons = new int[] { dna.getStart() + (codonStart - 1),
dna.getEnd() };
dnaToProteinMapping = new Mapping(product, exons, new int[] { 1,
- translation.length() },
- 3, 1);
+ translationLength }, 3, 1);
}
- if ((translation.length() + 1) * 3 == (1 - codonStart + dna.getSequence().length))
+ if ((translationLength + 1) * 3 == (1 - codonStart + dna
+ .getSequence().length))
{
System.err
.println("Allowing for additional stop codon at end of cDNA fragment... will probably cause an error in VAMSAs!");
exons = new int[] { dna.getStart() + (codonStart - 1),
dna.getEnd() - 3 };
dnaToProteinMapping = new Mapping(product, exons, new int[] { 1,
- translation.length() },
- 3, 1);
+ translationLength }, 3, 1);
}
}
else
else
{
// final product length truncation check
- int[] cdsRanges = adjustForProteinLength(translation.length(), exons);
- dnaToProteinMapping = new Mapping(product, cdsRanges, new int[] { 1,
- translation.length() }, 3, 1);
+ int[] cdsRanges = adjustForProteinLength(translationLength, exons);
+ dnaToProteinMapping = new Mapping(product, cdsRanges, new int[] {
+ 1, translationLength }, 3, 1);
if (product != null)
{
/*
+ * make xref with mapping from protein to EMBL dna
+ */
+ DBRefEntry proteinToEmblRef = new DBRefEntry(DBRefSource.EMBL,
+ getSequenceVersion(), proteinId, new Mapping(
+ dnaToProteinMapping.getMap().getInverse()));
+ product.addDBRef(proteinToEmblRef);
+
+ /*
* make xref from protein to EMBLCDS; we assume here that the
* CDS sequence version is same as dna sequence (?!)
*/
MapList proteinToCdsMapList = new MapList(new int[] { 1,
- translation.length() }, new int[] { 1 + (codonStart - 1),
- (codonStart - 1) + 3 * translation.length() }, 1, 3);
+ translationLength }, new int[] { 1 + (codonStart - 1),
+ (codonStart - 1) + 3 * translationLength }, 1, 3);
DBRefEntry proteinToEmblCdsRef = new DBRefEntry(
DBRefSource.EMBLCDS, getSequenceVersion(), proteinId,
new Mapping(proteinToCdsMapList));
product.addDBRef(proteinToEmblCdsRef);
/*
- * make xref from protein to EMBLCDSPROTEIN
+ * make 'direct' xref from protein to EMBLCDSPROTEIN
*/
proteinToEmblProteinRef = new DBRefEntry(proteinToEmblCdsRef);
proteinToEmblProteinRef.setSource(DBRefSource.EMBLCDSProduct);
+ proteinToEmblProteinRef.setMap(null);
product.addDBRef(proteinToEmblProteinRef);
}
}
*/
for (int xint = 0; exons != null && xint < exons.length; xint += 2)
{
- SequenceFeature sf = makeCdsFeature(exons, xint, proteinName, proteinId, vals,
- codonStart);
+ SequenceFeature sf = makeCdsFeature(exons, xint, proteinName,
+ proteinId, vals, codonStart);
sf.setType(feature.getName()); // "CDS"
sf.setEnaLocation(feature.getLocation());
sf.setFeatureGroup(sourceDb);
*/
String source = DBRefUtils.getCanonicalName(ref.getSource());
ref.setSource(source);
- DBRefEntry proteinToDnaRef = new DBRefEntry(ref.getSource(), ref.getVersion(), ref
+ DBRefEntry proteinDbRef = new DBRefEntry(ref.getSource(), ref.getVersion(), ref
.getAccessionId());
if (source.equals(DBRefSource.UNIPROT))
{
peptides.add(proteinSeq);
}
dnaToProteinMapping.setTo(proteinSeq);
- proteinSeq.addDBRef(proteinToDnaRef);
+ dnaToProteinMapping.setMappedFromId(proteinId);
+ proteinSeq.addDBRef(proteinDbRef);
+ proteinSeq.setSourceDBRef(proteinDbRef);
ref.setMap(dnaToProteinMapping);
}
hasUniprotDbref = true;
/*
* copy feature dbref to our protein product
*/
- DBRefEntry pref = proteinToDnaRef;
+ DBRefEntry pref = proteinDbRef;
pref.setMap(null); // reference is direct
product.addDBRef(pref);
// Add converse mapping reference
DBRefSource.EMBLCDSProduct, getSequenceVersion(), proteinId);
}
product.addDBRef(proteinToEmblProteinRef);
+ product.setSourceDBRef(proteinToEmblProteinRef);
if (dnaToProteinMapping != null
&& dnaToProteinMapping.getTo() != null)
DBRefEntry dnaToEmblProteinRef = new DBRefEntry(
DBRefSource.EMBLCDSProduct, getSequenceVersion(), proteinId);
dnaToEmblProteinRef.setMap(dnaToProteinMapping);
+ dnaToProteinMapping.setMappedFromId(proteinId);
dna.addDBRef(dnaToEmblProteinRef);
}
}
package jalview.datamodel.xdb.embl;
import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertSame;
import jalview.analysis.SequenceIdMatcher;
import jalview.datamodel.DBRefEntry;
-import jalview.datamodel.Sequence;
+import jalview.datamodel.DBRefSource;
import jalview.datamodel.SequenceI;
+import jalview.util.MapList;
import java.util.ArrayList;
import java.util.Arrays;
EmblEntry testee = new EmblEntry();
/*
- * Make a (CDS) Feature with 4 locations
+ * Make a (CDS) Feature with 5 locations
*/
EmblFeature cds = new EmblFeature();
cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
public void testParseCodingFeature()
{
// not the whole sequence but enough for this test...
- SequenceI dna = new Sequence("J03321", "GGATCCGTAAGTTAGACGAAATT");
List<SequenceI> peptides = new ArrayList<SequenceI>();
SequenceIdMatcher matcher = new SequenceIdMatcher(peptides);
EmblFile ef = EmblTestHelper.getEmblFile();
+ assertEquals(1, ef.getEntries().size());
+ EmblEntry testee = ef.getEntries().get(0);
+ String sourceDb = "EMBL";
+ SequenceI dna = testee.makeSequence(sourceDb);
/*
* parse three CDS features, with two/one/no Uniprot cross-refs
*/
- EmblEntry testee = new EmblEntry();
for (EmblFeature feature : ef.getEntries().get(0).getFeatures())
{
if ("CDS".equals(feature.getName()))
{
- testee.parseCodingFeature(feature, "EMBL", dna, peptides, matcher);
+ testee.parseCodingFeature(feature, sourceDb, dna, peptides, matcher);
}
}
* peptides should now have five entries:
* EMBL product and two Uniprot accessions for the first CDS / translation
* EMBL product and one Uniprot accession for the second CDS / "
- * EMBL product and synthesized EMBLCDSPROTEINaccession for the third
+ * EMBL product only for the third
*/
assertEquals(6, peptides.size());
assertEquals("CAA30420.1", peptides.get(0).getName());
assertEquals("MSS", peptides.get(5).getSequenceAsString());
/*
- * verify dna sequence has dbrefs with mappings to the peptide 'products'
+ * verify dna sequence has dbrefs with CDS mappings to the peptide 'products'
*/
+ MapList cds1Map = new MapList(new int[] { 57, 46 }, new int[] { 1, 4 },
+ 3, 1);
+ MapList cds2Map = new MapList(new int[] { 4, 15 }, new int[] { 1, 4 },
+ 3, 1);
+ MapList cds3Map = new MapList(new int[] { 4, 6, 10, 15 }, new int[] {
+ 1, 3 }, 3, 1);
DBRefEntry[] dbrefs = dna.getDBRefs();
assertEquals(4, dbrefs.length);
DBRefEntry dbRefEntry = dbrefs[0];
assertEquals("UNIPROT", dbRefEntry.getSource());
assertEquals("B0BCM4", dbRefEntry.getAccessionId());
assertSame(peptides.get(1), dbRefEntry.getMap().getTo());
- List<int[]> fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
- assertEquals(1, fromRanges.size());
- assertEquals(57, fromRanges.get(0)[0]);
- assertEquals(46, fromRanges.get(0)[1]);
- List<int[]> toRanges = dbRefEntry.getMap().getMap().getToRanges();
- assertEquals(1, toRanges.size());
- assertEquals(1, toRanges.get(0)[0]);
- assertEquals(4, toRanges.get(0)[1]);
+ assertEquals(cds1Map, dbRefEntry.getMap().getMap());
dbRefEntry = dbrefs[1];
assertEquals("UNIPROT", dbRefEntry.getSource());
assertEquals("P0CE20", dbRefEntry.getAccessionId());
assertSame(peptides.get(2), dbRefEntry.getMap().getTo());
- fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
- assertEquals(1, fromRanges.size());
- assertEquals(57, fromRanges.get(0)[0]);
- assertEquals(46, fromRanges.get(0)[1]);
- toRanges = dbRefEntry.getMap().getMap().getToRanges();
- assertEquals(1, toRanges.size());
- assertEquals(1, toRanges.get(0)[0]);
- assertEquals(4, toRanges.get(0)[1]);
+ assertEquals(cds1Map, dbRefEntry.getMap().getMap());
dbRefEntry = dbrefs[2];
assertEquals("UNIPROT", dbRefEntry.getSource());
assertEquals("B0BCM3", dbRefEntry.getAccessionId());
assertSame(peptides.get(4), dbRefEntry.getMap().getTo());
- fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
- assertEquals(1, fromRanges.size());
- assertEquals(4, fromRanges.get(0)[0]);
- assertEquals(15, fromRanges.get(0)[1]);
- toRanges = dbRefEntry.getMap().getMap().getToRanges();
- assertEquals(1, toRanges.size());
- assertEquals(1, toRanges.get(0)[0]);
- assertEquals(4, toRanges.get(0)[1]);
+ assertEquals(cds2Map, dbRefEntry.getMap().getMap());
dbRefEntry = dbrefs[3];
assertEquals("EMBLCDSPROTEIN", dbRefEntry.getSource());
assertEquals("CAA12345.6", dbRefEntry.getAccessionId());
assertSame(peptides.get(5), dbRefEntry.getMap().getTo());
- fromRanges = dbRefEntry.getMap().getMap().getFromRanges();
- assertEquals(2, fromRanges.size());
- assertEquals(4, fromRanges.get(0)[0]);
- assertEquals(6, fromRanges.get(0)[1]);
- assertEquals(10, fromRanges.get(1)[0]);
- assertEquals(15, fromRanges.get(1)[1]);
- toRanges = dbRefEntry.getMap().getMap().getToRanges();
- assertEquals(1, toRanges.size());
- assertEquals(1, toRanges.get(0)[0]);
- assertEquals(3, toRanges.get(0)[1]);
+ assertEquals(cds3Map, dbRefEntry.getMap().getMap());
+
+ /*
+ * verify peptides have dbrefs
+ * - to EMBL sequence (with inverse 1:3 cds mapping)
+ * - to EMBLCDS (with 1:3 mapping)
+ * - direct (no mapping) to other protein accessions
+ */
+ MapList proteinToCdsMap1 = new MapList(new int[] { 1, 4 }, new int[] {
+ 1, 12 }, 1, 3);
+ MapList proteinToCdsMap2 = new MapList(new int[] { 1, 3 }, new int[] {
+ 1, 9 }, 1, 3);
+
+ // dbrefs for first CDS EMBL product CAA30420.1
+ dbrefs = peptides.get(0).getDBRefs();
+ assertEquals(5, dbrefs.length);
+ assertEquals(DBRefSource.EMBL, dbrefs[0].getSource());
+ assertEquals("CAA30420.1", dbrefs[0].getAccessionId());
+ assertEquals(cds1Map.getInverse(), dbrefs[0].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDS, dbrefs[1].getSource());
+ assertEquals("CAA30420.1", dbrefs[1].getAccessionId());
+ assertEquals(proteinToCdsMap1, dbrefs[1].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDSProduct, dbrefs[2].getSource());
+ assertEquals("CAA30420.1", dbrefs[2].getAccessionId());
+ assertNull(dbrefs[2].getMap());
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "2.1", "B0BCM4"),
+ dbrefs[3]);
+ assertNull(dbrefs[3].getMap());
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "0", "P0CE20"),
+ dbrefs[4]);
+ assertNull(dbrefs[4].getMap());
+
+ // dbrefs for first CDS first Uniprot xref
+ dbrefs = peptides.get(1).getDBRefs();
+ assertEquals(2, dbrefs.length);
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "2.1", "B0BCM4"),
+ dbrefs[0]);
+ assertNull(dbrefs[0].getMap());
+ assertEquals(DBRefSource.EMBL, dbrefs[1].getSource());
+ assertEquals("X07547", dbrefs[1].getAccessionId());
+ assertEquals(cds1Map.getInverse(), dbrefs[1].getMap().getMap());
+
+ // dbrefs for first CDS second Uniprot xref
+ dbrefs = peptides.get(2).getDBRefs();
+ assertEquals(2, dbrefs.length);
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "0", "P0CE20"),
+ dbrefs[0]);
+ assertNull(dbrefs[0].getMap());
+ assertEquals(DBRefSource.EMBL, dbrefs[1].getSource());
+ assertEquals("X07547", dbrefs[1].getAccessionId());
+ assertEquals(cds1Map.getInverse(), dbrefs[1].getMap().getMap());
+
+ // dbrefs for second CDS EMBL product CAA30421.1
+ dbrefs = peptides.get(3).getDBRefs();
+ assertEquals(4, dbrefs.length);
+ assertEquals(DBRefSource.EMBL, dbrefs[0].getSource());
+ assertEquals("CAA30421.1", dbrefs[0].getAccessionId());
+ assertEquals(cds2Map.getInverse(), dbrefs[0].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDS, dbrefs[1].getSource());
+ assertEquals("CAA30421.1", dbrefs[1].getAccessionId());
+ assertEquals(proteinToCdsMap1, dbrefs[1].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDSProduct, dbrefs[2].getSource());
+ assertEquals("CAA30421.1", dbrefs[2].getAccessionId());
+ assertNull(dbrefs[2].getMap());
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "0", "B0BCM3"),
+ dbrefs[3]);
+ assertNull(dbrefs[3].getMap());
+
+ // dbrefs for second CDS second Uniprot xref
+ dbrefs = peptides.get(4).getDBRefs();
+ assertEquals(2, dbrefs.length);
+ assertEquals(new DBRefEntry(DBRefSource.UNIPROT, "0", "B0BCM3"),
+ dbrefs[0]);
+ assertNull(dbrefs[0].getMap());
+ assertEquals(DBRefSource.EMBL, dbrefs[1].getSource());
+ assertEquals("X07547", dbrefs[1].getAccessionId());
+ assertEquals(cds2Map.getInverse(), dbrefs[1].getMap().getMap());
+
+ // dbrefs for third CDS inferred EMBL product CAA12345.6
+ dbrefs = peptides.get(5).getDBRefs();
+ assertEquals(3, dbrefs.length);
+ assertEquals(DBRefSource.EMBL, dbrefs[0].getSource());
+ assertEquals("CAA12345.6", dbrefs[0].getAccessionId());
+ assertEquals(cds3Map.getInverse(), dbrefs[0].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDS, dbrefs[1].getSource());
+ assertEquals("CAA12345.6", dbrefs[1].getAccessionId());
+ assertEquals(proteinToCdsMap2, dbrefs[1].getMap().getMap());
+ assertEquals(DBRefSource.EMBLCDSProduct, dbrefs[2].getSource());
+ assertEquals("CAA12345.6", dbrefs[2].getAccessionId());
+ assertNull(dbrefs[2].getMap());
}
@Test(groups = "Functional")
// what if exons are too short for protein?
truncated = EmblEntry.adjustForProteinLength(7, exons);
assertSame(exons, truncated);
- // assertEquals("[11, 15, 21, 27]", Arrays.toString(truncated));
}
}
git://source.jalview.org / jalview.git / commitdiff