+<HTML> <HEAD>
+
+<TITLE>Sequin help documentation</TITLE>
+
+<!-- if you use the following meta tags, uncomment them.
+ <meta name="author" content="sequindoc">
+ <META NAME="keywords" CONTENT="national center for biotechnology information, ncbi, national library of medicine, nlm, national institutes of health, nih, database, archive, bookshelf, pubmed, pubmed central, bioinformatics, biomedicine, sequence submission, sequin, bankit, submitting sequences">
+ <META NAME="description" CONTENT="Sequin is a stand-alone software tool developed by the National Center for Biotechnology Information (NCBI) for submitting and updating entries to the GenBank, EMBL, or DDBJ sequence databases. "> -->
+ <link rel="stylesheet" href="ncbi_sequin.css">
+
+</HEAD>
+
+<body bgcolor="#FFFFFF" text="#000000" link="#0033CC" vlink="#0033CC">
+<!-- change the link and vlink colors from the original orange (link="#CC6600" vlink="#CC6600") -->
+
+<!-- the header -->
+<table border="0" width="600" cellspacing="0" cellpadding="0">
+ <tr>
+ <td width="140"><a href="http://www.ncbi.nlm.nih.gov"> <img src="http://www.ncbi.nlm.nih.gov/corehtml/left.GIF" width="130" height="45" border="0"></a></td>
+ <td width="360" class="head1" valign="BOTTOM"> <span class="H1">Sequin Help Documentation</span></td>
+<!-- <td width="100" valign="BOTTOM">Your Logo</td> -->
+ </tr>
+</table>
+
+<!-- the quicklinks bar -->
+<table CLASS="TEXT" border="0" width="600" cellspacing="0" cellpadding="3" bgcolor="#000000">
+ <tr CLASS="TEXT" align="CENTER">
+ <td width="100"><a href="index.html" class="BAR">Sequin</a></td>
+ <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Entrez/" class="BAR">Entrez</a></td>
+ <td width="100"><a href="http://www.ncbi.nlm.nih.gov/BLAST/" class="BAR">BLAST</a></td>
+ <td width="100"><a href="http://www.ncbi.nlm.nih.gov/omim/" class="BAR">OMIM</a></td>
+ <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html" class="BAR">Taxonomy</a></td>
+ <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Structure/" class="BAR">Structure</a></td>
+ </tr>
+</table>
+
+<!-- the contents -->
+<P> 
+
+<H2>Table of Contents</H2>
+
+<HR>
+
+>Introduction
+
+#Sequin is a program designed to aid in the submission of sequences to
+the GenBank, EMBL, and DDBJ sequence databases. It was written at the
+National Center for Biotechnology Information, part of the National
+Library of Medicine at the National Institutes of Health. This section
+of the help document provides a basic overview of how to submit
+sequences using the Sequin forms. Subsequent sections provide detailed
+instructions for entering information on each form.
+
+*The Help Documentation
+
+#The Sequin help documentation is available in both on-line and World
+Wide Web (http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html) formats.
+The text of the on-line version scrolls as you progress through the
+Sequin forms. Specific words or phrases can be identified with the
+"find" command at the top of the window. The on-line document can also
+be saved as a text file, or printed directly to a printer. Click on the
+window that contains the help documentation. Under the Sequin File
+menu, choose Export Help... to save the documentation as a text file.
+To print the documentation without saving it first, click on the help
+window, and choose Print from the Sequin File menu.
+
+*Organization of Forms
+
+#Information is entered into Sequin on a number of different forms. Each
+form is made up of pages, which are indicated by folder tabs at the top
+of the form. You can move to the desired page by clicking on the
+appropriate folder tab. You can also move between pages of a form by
+clicking on the "Next page" or "Prev page" buttons at the bottom of the
+screen. You can move to the previous form or the next form by clicking
+on the "Prev form" or "Next form" buttons on the first or last pages of
+a form, respectively.
+
+#There are numerous ways to enter information onto a page of a form,
+#including text fields, radio buttons, check boxes, scrolling boxes,
+#pop-up menus and spreadsheets.
+
+#You may also use tables to import annotation of source information.
+#The formatting of these tables will be discussed below.
+
+*Overview of Sequin
+
+#If you are using Sequin for the first time, you will be prompted to
+fill out four forms: the Welcome to Sequin form, the Submitting
+Authors Form, the Sequence Format form, and the Organism and Sequences
+Form. After you have filled out these forms, a window will appear that
+contains the Sequin record viewer. This viewer allows you to access
+many other forms in which you can edit fields filled out in the three
+initial forms, as well as add additional information. Detailed
+instructions on how to fill out the forms and use the record viewer are
+presented below.
+
+>Welcome to Sequin Form
+
+#First, indicate with one of the three radio buttons whether you are
+submitting the sequence to the GenBank, EMBL, or DDBJ database. If you
+are working on a sequence submission for the first time, click on
+"Start New Submission". If you are modifying an existing submission
+record, click on "Read Existing Record". If you would like to quit from
+Sequin, click on "Quit Program".
+
+#You can also "Read Existing Record" to read in a FASTA-formatted
+#sequence file
+for analysis purposes. The sequence will be displayed in Sequin and
+can be analyzed with tools such as CDD Search, but it should not be
+submitted because it does not have the appropriate annotations.
+
+#If you are running Sequin in its network-aware mode, you will see
+another button labeled "Download from Entrez". This option allows you
+to update an existing database record using Sequin. The record will be
+downloaded from GenBank into Sequin using NCBI's Entrez retrieval
+system. The contents of the record will appear in Sequin, and you can
+edit them by updating the sequence or the annotations, as necessary. If
+you do not see the button labeled "Download from Entrez" on the Welcome
+to Sequin form, you are not running Sequin in its network-aware mode.
+To make Sequin network-aware, see the
+<A HREF="#NetConfigure">
+instructions
+</A>
+later in the help documentation.
+
+#You can update only those records that you have submitted, not those
+submitted by others. To update an existing record, first select which
+of the databases you will be sending the update to. This should be the
+database to which the original record was submitted. If you do not
+know which database to use, send the record to GenBank and the NCBI
+staff will forward it to the appropriate database. Next, click on the
+button "Download from Entrez". Enter the nucleotide Accession number or
+GI of the sequence on the first form. Then enter "yes" if you are
+planning to submit the record as an update to one of the databases.
+Fill out the Submitting Authors form.
+
+<A HREF="#EditSubmitterInfo">
+Instructions
+</A>
+
+for this form are found in the Sequin help documentation under "Edit
+Submitter Info" under the Sequin File menu. The record will then open
+in the record viewer. Explanations of how to add annotations or update
+sequences are presented in the documentation entitled
+
+<A HREF="#EditingtheRecord">
+"Editing the record"
+</A>
+and
+<A HREF="#SequenceEditor">
+"Sequence Editor"
+</A>
+
+ respectively. You will not see the Submitting Authors Form, the
+Sequence Format Form, or the Organism and Sequences Form. Note that
+updates, as well as new records, must be emailed to the appropriate
+database. Sequin does not support direct submission of records over the
+Internet.
+
+#Additional configuration options are available under the Misc menu.
+You can toggle between the stand-alone and network-aware modes of
+Sequin. The default mode of Sequin, which is sufficient for most
+sequence submissions, is stand-alone. In its network-aware mode, Sequin
+can exchange data with NCBI and, for example, retrieve sequences
+from Entrez and perform Taxonomy searches. The network-aware mode of
+Sequin is described in detail in the
+<A HREF="#NetConfigure">
+Net Configure
+</A>
+section below. You can also start the NCBI DeskTop, which is for
+advanced Sequin users only.
+
+>Submitting Authors Form
+
+#Information from this form will be used as a citation for the sequence
+entry itself. It can contain the same information found in citations
+associated with the formal publication of the sequence.
+
+#On the bottom of each form are two buttons. Click "Prev form" (first
+page in a form) or "Prev page" (subsequent pages in a form) to go to the
+previous form or page. Click "Next Form" (last page on a form) or "Next
+Page" (earlier pages on a form) to move to the next form or page.
+
+#Form pages can also be saved individually by using the "Export" function
+under the File menu. If you are processing multiple submissions, you
+can use the "Import" function under the File menu to paste previously
+entered information directly on the page.
+
+#The Contact, Authors, and Affiliation pages can be saved as a block so
+that you can use this information for your next submission. For your
+first Sequin submission, fill in the requested information on the
+Submitting Authors form and proceed with the preparation of the
+submission. Choose Export Submitter Info under the File menu to export
+this to a file. You can then import this information in subsequent
+submissions using the Import Submitter Info in the File menu. You will
+need to fill in the manuscript title for each submission however.
+
+*Submission Page
+
+**When May We Release Your Sequence Record?
+
+#Please select one of the two radio buttons. If you select
+#"Immediately After Processing", the
+entry will be released to the public after the database staff has added
+it to the database. If you select "Release Date", fields will appear in
+which you can indicate the date on which the sequences should be
+released to the public. The submission will then be held back until
+formal publication of the sequence or GenBank Accession number, or
+until the release date, whichever comes first.
+
+**Tentative Title for Manuscript
+
+#Please enter a title that appropriately describes the sequence entry.
+ Later in the submission process, you will have the
+opportunity to change this information and add details for published
+or in press references.
+
+*Contact Page
+
+#Please enter the name, telephone and fax numbers, and email address of
+the person who is submitting the sequence. This is the person who will
+be contacted regarding the sequence submission. The phone, fax, and
+email address will not be visible in the database record, but are
+essential for contact by the database staff.
+
+*Authors Page
+
+#Please enter the names of the people who should receive scientific
+credit for the generation of sequences in this entry. The person on
+the Contact page is automatically listed as the first author. This
+information can be changed if necessary. The author names should be
+entered in the order first name, middle initial, surname. You can add
+as many authors to this page as you wish. After you type in the name
+of the third author, the box becomes a spreadsheet, and you can scroll
+down to the next line by using the space bar. The consortium box
+should only be used for consortium names, not institute or department
+names.
+
+*Affiliation Page
+
+#Please enter information about the principal institution where the
+sequencing was performed. This is not necessarily the same as the
+workplace of the person described on the Contact page. This information
+will show up in the reference section of the record, with the title
+Direct Submission.
+
+>Sequence Format Form
+
+#Use this form to indicate the type, format and category of sequence
+#you are submitting.
+
+#Sequin can process single nucleotide sequences, gapped sequences and
+sets of related sequences. If the sequences are related in terms of
+coming from the same publication, or the same organism, they may be
+candidates for a Batch submission. Biologically related sequences may
+be classified as environmental samples, population, phylogenetic,
+mutation, or segmented sets as appropriate. Segmented sets consist of
+a collection of non-overlapping sequences covering a specific genetic
+region. In all cases, although the sequences are handled as a single
+submission, each sequence in a set will receive its own database
+Accession number and can be annotated independently.
+
+#Sequin can display the alignments of sequences that are submitted as
+part of an aligned phylogenetic, population, mutation set, or
+environmental samples. Such sequences can be submitted in FASTA,
+Contiguous (FASTA+GAP, NEXUS, MACAW), or Interleaved (PHYLIP, NEXUS)
+formats. If the sequences are in FASTA format, Sequin can generate an
+alignment. If the sequences have already been aligned in FASTA+GAP,
+PHYLIP, MACAW, or NEXUS, Sequin will not change the alignment. If one
+of the sequences in your alignment is already present in the
+GenBank/EMBL/DDBJ database, you must mark that sequence so that it does
+not receive a new Accession number. Instead of supplying that sequence
+with a new Sequence Identifier, give it the identifier accU12345, where
+U12345 is the Accession number of the sequence.
+
+#Single sequences, gapped sequences, segmented sequences, and batch
+submissions must be submitted in FASTA format.
+
+*Submission Type
+
+#Use the radio buttons to indicate which of the following types of
+submissions you are creating:
+
+#-Single sequence: a single mRNA or genomic DNA sequence. If you are
+submitting multiple sequences from the same publication, consider a
+Batch Submission. If you decide to submit multiple Sequin files, each
+with one or more sequences, please send each file in a separate email
+message.
+
+#-Segmented sequence: a collection of non-overlapping, non-contiguous
+sequences that cover a specified genetic region. A standard example is
+a set of genomic DNA sequences that encode exons from a gene along with
+fragments of their flanking introns. If the segmented set is part of
+an alignment, however, select the appropriate Population, Phylogenetic,
+or Mutation study button.
+
+#-Gapped sequence: a single, non-contiguous mRNA or genomic DNA sequence.
+A gapped sequence contains specified gaps of know or unknown length
+where the exact nucleotide sequence has not been determined. The FASTA
+format for gapped sequences is slightly different and is explained
+below.
+
+#-Population study: a set of sequences that were derived by sequencing
+the same gene from different isolates of the same organism.
+
+#-Phylogenetic study: a set of sequences that were derived by sequencing
+the same gene from different organisms.
+
+#-Mutation study: a set of sequences that were derived by sequencing
+multiple mutations of a single gene.
+
+#-Environmental samples: a set of sequences that were derived by
+sequencing the same gene from a population of unclassified or unknown
+organisms.
+
+#-Batch submission: a set of related sequences that are not part of a
+population, mutation, or phylogenetic study. The sequences should be
+related in some way, such as coming from the same publication or
+organism. You should plan that all sequences will be released to the
+public on the same date.
+
+*Sequence Data Format
+
+#If you are submitting a single, gapped, or segmented sequence, or a
+batch submission, your sequence must be in FASTA format, described
+below. If you are submitting a set of sequences as part of a
+population, phylogenetic, or mutation study, you have a choice of
+sequence formats. You may submit the set as individual sequences in
+FASTA format. Alternatively, you can submit the sequences as part of
+an alignment. Sequin currently accepts the alignment formats
+FASTA+GAP, PHYLIP, MACAW, NEXUS Interleaved, and NEXUS Contiguous.
+
+*Submission Category
+
+#Use the radio buttons to indicate whether your sequence corresponds to
+an original submission or a third-party annotation submission. If you
+have directly sequenced the nucleotide sequence in your laboratory,
+your submission would be considered an original submission.
+
+#If you have downloaded the sequence from GenBank and added to it your
+own annotations, your entry may be eligible for submission to the
+Third-Party Annotation Database
+
+<A HREF="http://www.ncbi.nlm.nih.gov/Genbank/tpa.html">
+(TPA)
+</A>
+.
+
+#In order to be released into the TPA database, the sequence must appear
+in a peer-reviewed publication in a biological journal. If you select
+this option, a pop-up box will appear upon the completion of the
+Sequence Format form. You must provide some description of the
+biological experiments used as evidence for the annotation of your TPA
+submission in this box.
+
+#You will be asked later in the submission process to provide the GenBank
+Accession number(s) of the primary sequence(s) from which your TPA
+submission was derived.
+
+>Organism and Sequences Form
+
+#This form is made up of four pages. If your sequences are imported as
+properly formatted FASTA files, there will be minimum input necessary
+in these pages.
+
+>FASTA Format for Nucleotide Sequences
+
+#In FASTA format the line before the nucleotide sequence, called the
+FASTA definition line, must begin with a carat (">"), followed by a
+unique SeqID (sequence identifier). The SeqID must be unique for each
+nucleotide sequence and should not contain any spaces. Use of brackets
+("[]") in the SeqID is also prohibited. The identifier will be
+replaced with an Accession number by the database staff when your
+submission is processed.
+
+#Information about the source organism from which the sequence was
+obtained follows the SeqID and must be in the format [modifier=text].
+Do not put spaces around the "=". At minimum, the scientific name of
+the organism should be included. Optional modifiers can be added to
+provide additional information. A complete list of available source
+<A HREF="http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html">
+modifiers
+</A>
+ and their format is available.
+
+#The final optional component of the FASTA definition line is the
+sequence title, which will be used as the DEFINITION field in the final
+flatfile. The title should contain a brief description of the
+sequence. There is a preferred format for nucleotide and protein
+titles and Sequin can generate them automatically using the Generate
+Definition Line function under the Annotate menu in the record viewer.
+
+#Note in all cases, the FASTA definition line must not contain any hard
+returns. All information must be on a single line of text. If you
+have trouble importing your FASTA sequences, please double check that
+no returns were added to the FASTA definition line by your editing
+software.
+
+#Examples of properly formatted FASTA definition lines for nucleotide
+sequences are:
+
+<KBD><PRE>>Seq1 [organism=Mus musculus] [strain=C57BL/6] Mus musculus neuropilin 1 (Nrp1) mRNA, complete cds.
+</KBD></PRE>
+<KBD><PRE>>ABCD [organism=Plasmodium falciparum] [isolate=ABCD] Plasmodium falciparum isolate ABCD merozoite surface protein 2 (msp2) gene, partial cds.
+</KBD></PRE>
+<KBD><PRE>>DNA.new [organism=Homo sapiens] [chromosome=17] [map=17q21] [moltype=mRNA] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.
+</KBD></PRE>
+#The line after the FASTA definition line begins the nucleotide
+sequence. Unlike the FASTA definition line, the nucleotide sequence
+itself can contain returns. It is recommended that each line of
+sequence be no longer than 80 characters. Please only use IUPAC
+symbols within the nucleotide sequence. For sequences that are not
+contained within an alignment, do not use "?" or "-" characters. These
+will be stripped from the sequence. Use the IUPAC approved symbol "N"
+for ambiguous characters instead.
+
+#A single file containing multiple FASTA sequences can be imported into
+Sequin. Make sure that the FASTA definition line for each sequence is
+formatted as above.
+
+#If the FASTA definition line is not properly formatted a pop-up box
+will appear upon importing the nucleotide FASTA. The top box in this
+pop-up will list any errors in the FASTA definition lines, including
+missing SeqIDs, duplicate SeqIDs for different sequences, or improperly
+formatted modifiers. You can add or edit this information in the
+spreadsheet provided. The toggle at the bottom of the pop-up allows
+you to select whether all sequences or only those with errors are
+listed in the spreadsheet above. After making changes, click on Refresh
+Error List to ensure that all errors have been corrected. You must
+correct any errors involving the SeqID in order to proceed with your
+submission.
+
+*FASTA Format for Segmented Sequence
+
+#Each segment of a segmented sequence must have its own SeqID, but the
+organism name and other modifiers are only indicated in the FASTA
+definition line of the first segment. Square brackets are used to
+delimit the members of the segmented set. For example,
+
+![
+!>A-0V-1-Apart1 [organism=Gallus gallus] [clone=C]
+!TCACTCTTTGGCAAC
+!>A-0V-1-Apart2
+!GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!]
+
+*FASTA Format for Gapped Sequence
+
+#The FASTA definition line for a gapped sequence follows the same format
+as above. To indicate a gap within the sequence, enter a hard return
+within the sequence at the point of the gap, then insert an extra line
+starting with a carat (">") and a question mark ("?"). If the gap size
+is unknown, enter "unk100" after the question mark. If the gap size is
+known, enter the length of the gap after the question mark. For
+example,
+
+!>Dobi [organism=Canis familiaris] [breed=Doberman pinscher]
+!AAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTA
+!GGAAAAAGGGCTGTTG
+!>?unk100
+!TGGATGACAGAAACCTTGTTGGTCCAAAATGCAAACCCAGATKGTAAGACCATTTTAAAAGCATTGGGTC
+!TTAGAAATAGGGCAACACAGAACAAAAAT
+!>?234
+!AAAAATAAAAGCATTAGTAGAAATTTGTACAGAACTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCT
+!GAAAACCCATACAATACTCCGGG
+
+will generate a sequence containing two gaps. The first gap is of
+unknown length, the second is 234 nucleotides long.
+
+*FASTA+GAP Format for Aligned Nucleotide Sequences
+
+#A number of programs output sets of aligned sequences in FASTA format.
+Frequently, to align these sequences, gaps must be inserted. Specify
+relevant gap and ambiguous characters in the appropriate box on the
+
+<A HREF="#NucleotidePage">
+Nucleotide Page
+</A>
+
+form. Each sequence, including gaps, must be the same length. The
+gaps will only show up in the alignment, not in the individual sequence
+in the database.
+
+#Sequences in FASTA+GAP format resemble FASTA sequences. The previous
+section on
+
+<A HREF="#FASTAFormatforNucleotideSequences">
+FASTA Format for Nucleotide Sequences
+</A>
+
+has instructions for formatting FASTA sequences. If one of the
+sequences in your alignment is already present in the GenBank/EMBL/DDBJ
+database, you must mark that sequence so that it does not receive a new
+Accession number. To do this, use a SeqID in the format accU12345,
+where U12345 is the Accession number of the pre-existing sequence. All
+sequences in FASTA+GAP format should be in the same file.
+
+#The following is an example of FASTA+GAP format:
+
+!>A-0V-1-A [organism=Gallus gallus] [clone=C]
+!TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!>A-0V-2-A [organism=Drosophila melanogaster] [strain=D]
+!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!>A-0V-3-A [organism=Caenorhabditis elegans] [strain=E]
+!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!>A-0V-4-A [organism=Rattus norvegicus] [strain=F]
+!TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!>A-0V-7-A [organism=Aspergillus nidulans] [strain=G]
+!TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+
+*PHYLIP Format for Aligned Nucleotide Sequences
+
+#A number of programs output sets of aligned sequences in PHYLIP format.
+
+#The following is an example of PHYLIP format.
+
+! 5 100
+!A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
+!A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!
+!
+! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+
+#In this example, the first line indicates that there are 5 sequences,
+each with 100 nt of sequence. The following five lines contain the
+Sequence IDs, followed by the sequences. Specifically, the sequence
+identifier for the first sequence is A-0V-1-A. Note that subsequent
+blocks of sequence do not contain the Sequence ID. If one of the
+sequences in your alignment is already present in the GenBank/EMBL/DDBJ
+database, you must mark that sequence so that it does not receive a new
+Accession number. To do this, use a SeqID in the format accU12345,
+where U12345 is the Accession number of the pre-existing sequence.
+
+#Specify relevant gap and ambiguous characters in the appropriate box on the
+<A HREF="#NucleotidePage">
+Nucleotide Page
+</A>
+form.
+
+#You can modify the PHYLIP format so that Sequin can
+determine the correct organism and any other modifiers for each
+sequence. An example of such modifications are below in the section on
+<A HREF="#SourceModifiersforPHYLIPandNEXUS">
+Source Modifiers for PHYLIP and NEXUS
+</A>
+.
+#Alternatively, you can leave your sequence alignment in
+standard PHYLIP format and enter the organism, strain, chromosome, etc.
+information on the following
+
+<A HREF="#SourceModifiersForm">
+Source Modifers form
+</A>
+.
+
+*NEXUS Format for Aligned Nucleotide Sequences
+
+#A number of programs output sets of aligned sequences in one of two
+NEXUS formats, NEXUS Interleaved and NEXUS Contiguous.
+
+#NEXUS files can contain ? for "missing" at the 5' and 3' ends of
+sequences, as long as this parameter is properly defined within the
+header of the NEXUS file.
+
+#The following is an example of NEXUS Interleaved format.
+
+!#NEXUS
+!
+!begin data;
+! dimensions ntax=5 nchar=100;
+! format datatype=dna missing=? gap=- interleave;
+! matrix
+!
+!A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
+!A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA T????ATAGA GGGGCAACTA
+!A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
+!
+!
+!A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+!A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+!A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+!A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+!A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
+
+#In this example, the first few lines provide information about the data
+in the sequence alignment. The following five lines contain the
+Sequence IDs, followed by the sequences. Specifically, the sequence
+identifier for the first sequence is A-0V-1-A. Note that subsequent
+blocks of sequence also contain the Sequence ID. If one of the
+sequences in your alignment is already present in the GenBank/EMBL/DDBJ
+database, you must mark that sequence so that it does not receive a new
+Accession number. To do this, use a SeqID in the format accU12345,
+where U12345 is the Accession number of the pre-existing sequence.
+Also, Sequin will replace the "?" characters in the sequences with "N"s
+since they are defined as "missing" data in the header. You should
+specify relevant gap and ambiguous characters in the appropriate box on
+the
+
+<A HREF="#NucleotidePage">
+
+Nucleotide Page
+
+</A>
+
+form.
+#The following is an example of NEXUS Contiguous format.
+
+!#NEXUS
+!BEGIN DATA;
+!DIMENSIONS NTAX=5 NCHAR=100;
+!FORMAT MISSING=? GAP=- DATATYPE=DNA ;
+!MATRIX
+!
+!A-0V-1-A
+!TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!A-0V-2-A
+!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!A-0V-3-A
+!TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!A-0V-4-A
+!TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!
+!A-0V-7-A
+!TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+
+#In this example, the first few lines provide information about the data
+in the sequence alignment. The following five lines contain the
+Sequence IDs, followed by the sequences. Specifically, the sequence
+identifier for the first sequence is A-0V-1-A. Note that subsequent
+blocks of sequence also contain the Sequence ID. If one of the
+sequences in your alignment is already present in the GenBank/EMBL/D
+DBJ database, you must mark that sequence so that it does not receive a
+new Accession number. To do this, use a SeqID in the format accU12345,
+where U12345 is the Accession number of the pre-existing sequence.
+
+#You can modify either NEXUS format so that Sequin can
+determine the correct organism and any other modifiers for each
+sequence. An example of such modifications are below in the section on
+<A HREF="#SourceModifiersforPHYLIPandNEXUS">
+Source Modifiers for PHYLIP and NEXUS
+</A>
+.
+Alternatively, you can leave your sequence alignment in
+standard NEXUS format and enter the organism, strain, chromosome, etc.
+information on the following
+
+<A HREF="#SourceModifiersForm">
+Source Modifers form
+</A>
+.
+
+**Source Modifiers for PHYLIP and NEXUS
+
+#You can modify the PHYLIP or NEXUS formats so that Sequin can determine
+the correct organism and any other modifiers for each sequence by
+adding lines at the end of the file. The first line applies to the
+first sequence, the second line to the second sequence, and so on. You
+must have one line for each sequence. These inserted lines contain
+modifiers formatted like in the FASTA definition line, but do not begin
+with a SeqID. Instead, the SeqID is present at the beginning of the
+sequence lines as shown above.
+
+#Each of the initial lines starts with the character ">". The
+scientific organism name follows in brackets. Optional modifiers also
+follow in brackets. For further information on the data that can go in
+the lines preceding the sequences, see the instructions entitled "FASTA
+Format for Nucleotide Sequences",
+
+<A HREF="#FASTAFormatforNucleotideSequences">
+above.
+</A>
+
+#The following lines indicating the organisms and strain of each sequence
+would follow immediately after the sequence in the PHYLIP and NEXUS
+examples, above.
+
+!>[organism=Gallus gallus] [clone=C]
+!>[organism=Drosophila melanogaster] [strain=D]
+!>[organism=Caenorhabditis elegans] [strain=E]
+!>[organism=Rattus norvegicus] [strain=F]
+!>[organism=Aspergillus nidulans] [strain=G]
+
+#The number of lines of source information must exactly match the number
+of sequences provided.
+
+#Alternatively, you can leave your sequence alignment in
+standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc.
+information on the following
+
+<A HREF="#OrganismPage">
+Organism Page
+</A>
+.
+
+*Importing Aligned Sets of Segmented Sequences
+
+#Sequin can also read segmented sets that are part of an alignment if
+the sequences are in FASTA or FASTA+GAP format. Each segment should
+have its own Sequence ID, but organism name and source modifiers should
+only be indicated for the first segment from each sequence. Square
+brackets are used to delimit the members of a set. For example,
+
+![
+!>A-0V-1-Apart1 [organism=Gallus gallus] [strain=C]
+!TCACTCTTTGGCAAC
+!>A-0V-1-Apart2
+!GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!]
+![
+!>A-0V-2-Apart1 [organism=Drosophila melanogaster] [strain=D]
+!TCACTCTTTGGCAAC
+!>A-0V-2-Apart2
+!GAAGCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
+!TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
+!]
+
+>Nucleotide Page
+
+#The options on this page will vary depending on the
+<A HREF="#SubmissionType">
+Submission Type
+</A>
+ and
+<A HREF="#SequenceDataFormat">
+Sequence Data Format
+</A>
+selected earlier. Segmented sets and gapped sequences mut be imported
+as properly formatted FASTA files. Details about importing alignment
+files are
+<A HREF="#NucleotidePageforAlignedDataFormats">
+below
+</A>
+.
+
+*Nucleotide Page for FASTA Data Format
+
+**Create Alignment
+
+#If you have selected a Population study, Phylogenetic study, Mutation
+study, or Environmental samples set as a
+<A HREF="#SubmissionType">
+Submission Type
+</A>
+a check box will appear at the top of the Nucleotide Page. If you
+check 'Create Alignment', Sequin will attempt to generate an alignment
+of the seqeunces within your submission.
+
+**Import Nucleotide FASTA
+
+#Use this button to import your properly formatted
+<A HREF="#FASTAFormatforNucleotideSequences">
+FASTA file
+</A>
+. You will see a window containing information about the imported
+sequence(s). Please check the number of sequences, Sequence IDs
+(SeqIDs) and length of each sequence to make sure they are correct. If
+you have included source information within the FASTA definition line,
+this will also be listed.
+
+**Add/Modify Sequences
+
+#This option allows you to add or modify sequences without using a
+previously formatted FASTA file, but is not available if you have
+selected a Segmented sequence or Gapped sequence as a
+<A HREF="#SubmissionType">
+Submission Type
+</A>
+. On the Specify Sequences box you can either import a nucleotide FASTA
+or add a new sequence. If you choose Add New Sequence, a new box will
+pop-up where you can either import an existing sequence file or
+directly paste or type the nucleotide sequence.
+
+#If you add a sequence where the FASTA definition line is not properly
+formatted a pop-up box will appear. The top box in this pop-up will
+list any errors in the FASTA definition lines, including missing
+SeqIDs, duplicate SeqIDs for different sequences, or improperly
+formatted modifiers. You can add or edit this information in the
+spreadsheet provided. The toggle at the bottom of the pop-up allows
+you to select whether all sequences or only those with errors are
+listed in the spreadsheet above. After making changes, click on
+Refresh Error List to ensure that all errors have been corrected. You
+must correct any errors involving the SeqID in order to proceed with
+your submission. Click on Accept to save your sequences and return to
+the Specify Sequences box.
+
+#In the Specify Sequences box, you can choose to add another sequence or
+select a sequence from the list and choose to edit or delete it. You
+can also delete all sequences at this point. You will need to click on
+Done to save your sequences and return to the Nucleotide Page.
+
+**Clear Sequences
+
+#This option will remove all imported nucleotide sequences.
+
+**Specify Molecule
+
+#A database sequence can represent one of several different molecule
+types. The default molecule is genomic DNA. If the sequence was not
+derived from genomic DNA, you can edit that information here. If you
+are submitting multiple sequences you can apply one molecule type to
+all sequences or apply the molecule type to each sequence individually.
+ Enter in the Molecule pop-up menu the type of molecule that was
+sequenced.
+
+#-Genomic DNA: Sequence derived directly from the DNA of an organism.
+Note: The DNA sequence of an rRNA gene has this molecule type, as does
+that from a naturally-occurring plasmid.
+
+#-Genomic RNA: Sequence derived directly from the genomic RNA of certain
+organisms, such as viruses.
+
+#-Precursor RNA: An RNA transcript before it is processed into mRNA,
+rRNA, tRNA, or other cellular RNA species.
+
+#-mRNA[cDNA]: A cDNA sequence derived from mRNA.
+
+#-Ribosomal RNA: A sequence derived from the RNA in ribosomes. This
+should only be selected if the RNA itself was isolated and sequenced.
+If the gene for the ribosomal RNA was sequence, select Genomic DNA.
+
+#-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for
+example, the sequence of a cDNA derived from tRNA.
+
+#-Small nuclear RNA: A sequence derived from small nuclear RNA, for
+example, the sequence of a cDNA derived from snRNA.
+
+#-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA,
+for example, the sequence of a cDNA derived from small cytoplasmic RNA.
+
+#-Other-Genetic: A synthetically derived sequence including cloning
+vectors and tagged fusion constructs.
+
+#-cRNA: A sequence derived from complementary RNA transcribed from DNA,
+mainly used for viral submissions.
+
+#-Small nucleolar RNA: A sequence derived from small nucleolar RNA, for
+example, the sequence of a cDNA derived from snoRNA.
+
+**Specify Topology
+
+#Most sequences have a Linear topology and this is the default. You
+should change this setting to Circular only if the sequence is complete
+and it has a circular topology. For example, a complete plasmid or a
+complete mitochondrial genome would have a Circular topology, but a
+single gene from a plasmid or mitochondrion would have a Linear
+topology. If you are submitting multiple sequences you can apply one
+topology to all sequences or set the topology for each sequence
+individually.
+
+*Nucleotide Page for Aligned Data Formats
+
+**Sequence Characters
+
+#If you are submitting a set of aligned sequences, you can specify sequence
+characters used in your alignment here. Sequin requires that you
+define any non-IUPAC nucleotide characters in your alignment file. The
+five types of variable characters are listed under Sequence Characters.
+
+#Every sequence within an alignment file must contain the same number of
+characters (nucleotides + gaps). Gap characters are used to represent the
+spaces between contiguous nucleotides in an alignment. Gaps that appear at
+the beginning or end of a sequence are treated differently than gaps that
+appear between nucleotides and each must be defined. GenBank prefers to
+use a hyphen (-) to represent gaps. If you use a different character to
+represent a gap, you will need to add this character to the list in the
+Beginning Gap, Middle Gap, or End Gap boxes.
+
+#Ambiguous characters represent nucleotides that are known to exist, but
+whose identity has not been experimentally validated. GenBank prefers to
+use 'n' to represent any ambiguous nucleotides. If you are using a
+different character to represent an ambiguous base, you will need to add
+this character to the list in the Ambiguous/Unknown box. Sequin will
+convert these characters to 'n's when your file is imported.
+
+#Match characters denote nucleotides that are identical in every member of
+an alignment. GenBank prefers the use of a colon (:) to represent match
+characters. If you are using a different character to represent a match
+character, you will need to add this character to the list in the Match box.
+
+**Import Nucleotide Alignment
+
+#Once you have imported the alignment using the Import Nucleotide
+Alignment button, you can edit the molecule information using the
+<A HREF="#SpecifyMolecule">
+Specify Molecule
+</A>
+ and
+<A HREF="#SpecifyTopology">
+Specify Topology
+</A>
+buttons explained above. Note that you can not access the
+<A HREF="#Add/ModifySequences">
+Add/Modify Sequences
+</A>
+ dialog for submissions of aligned sequences.
+
+>Organism Page
+
+#Information about the organism from which the sequence was derived
+should be entered or edited on this page. If there are any potential
+problems with the organism information previously provided in either
+the
+<A HREF="#FASTAFormatforNucleotideSequences">
+FASTA definition line
+</A>
+ or entered in the
+<A HREF="#Add/ModifySequences">
+Add/Modify Sequences
+</A>
+ dialog, a window listing these problems will appear at the top of the
+form. Please review these problems and edit using the
+
+<A HREF="#AddSourceModifiers">
+</A>
+Add Source Modifiers button as necessary. At minimum, you must supply
+the scientific name of the organism from which the sequence was
+obtained in order to proceed with your submission.
+
+#The second window is a summary of the organism information provided so
+far. Double clicking on a line of text within this window will launch a
+modifier-specific editing window. In each of these windows, you can
+edit the available information for the specific modifier. In most
+cases, you have the choice to edit the modifier for each sequence
+separately, or to enter text and select Apply above value to all
+sequences. These changes will be reflected in the windows of the
+Organism page immediately upon closing the modifier-specific editor.
+
+*Add Organisms, Locations, and Genetic Codes
+
+#If you have not added organism information using either the
+<A HREF="#FASTAFormatforNucleotideSequences">
+FASTA definition line
+</A>
+ or the
+<A HREF="#Add/ModifySequences">
+Add/Modify Sequences
+</A>
+dialog, you can use the Add Organisms, Locations, and Genetic Codes to
+do so at this point. This button will launch the Multiple Organism
+Editor pop-up where you may add or edit existing information concerning
+the
+<A HREF="#Organism">
+Organism
+</A>
+ name,
+<A HREF="#Location">
+Location
+</A>
+ and
+<A HREF="#GeneticCode">
+Genetic Code
+</A>
+. The SeqID of each sequence is listed at the left of the spreadsheet
+format. You can change the information in the spreadsheet individually
+or globally for all sequences.
+
+**Organism
+
+#The scrollable list at the top of the pop-up contains the scientific
+names of many organisms. To reach a name on the list, type the first
+few letters of the scientific name into the box above the list or the
+appropriate box in the spreadsheet. The list will scroll to the names
+beginning with those letters, and you can select the organism within
+the list itself. You can then use the arrow button to copy this name
+into the appropriate box in the spreadsheet.
+
+#To apply the same scientific name to all sequences in the submission,
+click on the Organism button in the spreadsheet column header. A
+separate pop-up box will appear with the same organism list. You can
+select a name from this list and choose Accept to apply this name to
+all sequences.
+
+#If you have any questions about the scientific name of an organism, see
+the NCBI
+<A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
+Taxonomy Browser
+</A>
+http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
+
+#If the name of the organism is not on the list, type it in directly. If
+you do not know the scientific name, please be as specific as you can
+and include a unique identifier, such as a clone, isolate, strain or
+voucher number, or cultivar name, e.g.; Nostoc ATCC29106, uncultured
+spirochete Im403, Lauraceae sp. Vásquez 25230 (MO), Rosa hybrid
+cultivar 'Kazanlik'. Also, if applicable, indicate if the name is
+unpublished as of the time of submission. Additional information such
+as strain, isolate, or serotype can be entered later in the submission
+process.
+
+**Location
+
+#The default Location for all seqeunces is "Genomic". If the sequence
+is not genomic, select the alternative location (ie, organelle) from
+the pull-down list. You can change the location of all sequences
+globally by clicking on the Location button in the spreadsheet header.
+The following is a brief description of the choices in this list:
+
+#-Genomic: chromosome. This category includes
+mitochondrial and chloroplast proteins that are encoded by the nuclear
+genome.
+
+#-Chloroplast: a chlorophyllous plastid.
+
+#-Chromoplast: a non-chlorophyllous, pigmented plastid, found in
+fruits and flowers.
+
+#-Kinetoplast: a specialized type of mitochondrion found exclusively
+in Kinetoplastida (e.g., Leishmania). NOTE: kinetoplast should
+be applied ONLY to members of the Kinetoplastida (trypanosomes and
+bodonids).
+
+#-Mitochondrion: a semi-autonomous, self-reproducing organelle that
+occurs in the cytoplasm of most eukaryotic cells.
+
+#-Plastid: any of a class of double membrane-bound, light-harvesting
+organelles (or derived from same). NOTE: plastid should be used
+ONLY when a more precise term, e.g., chloroplast, is not
+applicable.
+
+#-Macronuclear: a specialized type of nucleus found exclusively in the
+ciliated protists (e.g., Tetrahymena). NOTE: macronucleus
+should be applied ONLY to members of the Ciliophora.
+
+#-Extrachromosomal: other extrachromosomal elements not listed here,
+such as a B chromosome or an F factor.
+
+#-Plasmid: extrachromosomal genetic element found in bacterial species.
+Note this does not include the cloning vector used to propagate
+the sequence of interest.
+
+#-Cyanelle: a specialized type of plastid found exclusively in
+glaucocystophytes (e.g., Cyanophora). NOTE: cyanelle should be
+applied ONLY to members of the Glaucocystophyceae.
+
+#-Proviral: a virus that is integrated into a host cell chromosome.
+
+#-Virion: a completed virus particle.
+
+#-Nucleomorph: a reduced nuclear remnant found in Chlorarachniophyceae
+(e.g., Chlorarachnion) and Cryptophyta (e.g, Cryptomonas). NOTE:
+nucleomorph should be applied ONLY to members of the
+Chlorarachniophyceae or Cryptophyta.
+
+#-Apicoplast: a reduced plastid characteristic of apicomplexans
+(e.g., Plasmodium). NOTE: apicoplast should be applied ONLY to
+members of the Apicomplexa.
+
+#-Leucoplast: a plastid lacking pigments of any type.
+
+#-Proplastid: an immature plastid.
+
+#-Endogenous_virus: a virus that has integrated permanently into the
+host genome, and which is inherited vertically through the
+germ-line of the host.
+
+#-Hydrogenosome: an organelle that produces hydrogen and ATP and is
+found mainly in ciliates, fungi and trichomonads. Hydrogenosomes may
+be reduced mitochondria
+
+**Genetic Code
+
+#If you selected a scientific organism name from the scrollable list
+described above, this field will be filled out automatically. However,
+if the organism is not on the list, this field will default to the
+"Standard" genetic code. If this is incorrect, you can select the
+correct genetic code from the pull-down list. To globally change the
+genetic code for all sequences which are not automatically filled out,
+click on the Genetic Code button in the spreadsheet header.
+
+#For more information regarding the genetic codes available, see the NCBI
+<A HREF="http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c">
+Taxonomy page
+</A>.
+http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c
+
+*Import Source Modifiers
+
+#Using this button allows you to import a tab-delimited table of source
+modifiers. The first column in the table must contain the Sequince
+Identifiers (SeqIDs) used earlier in the submission and each subsequent
+column must contain a different source modifier. The first row in the
+table must contain the labels for each column. The label for the
+Sequence Identifiers column should be in the format "Seq_ID". A list
+of available
+<A HREF="http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html">
+modifiers
+</A>
+in the format to be used in the column headers can be found at
+http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html .
+
+*Add Source Modifiers
+
+#Using this button will launch the Specify Source Modifiers pop-up box
+where you can add or edit any source modifier. You can also import a
+source modifier table or export the existing source modifiers in table
+format from this page.
+
+#The Select Modifier dialog allows you to select a modifier from the
+pull-down list and edit the value of this modifier for each sequence or
+globally add a value to all sequences.
+
+#The two windows in this pop-up provide information about the current
+source modifiers for the sequences in your submission. The top window
+provides a summary of these modifiers and the lower window lists the
+values of each modifier for each sequence. If any sequences have
+missing organism names or have source information that is identical to
+another sequence, the SeqIDs will be shown in red in this window.
+Double-clicking on a modifier value in this window will launch a pop-up
+where you can edit this value. Double-clicking on the modifier name
+used in the header will launch a modifier-specific pop-up where you can
+globally edit the modifier value for all sequences or change the value
+for individual sequences.
+
+*Clear All Source Modifiers
+
+#This button will clear all modifiers previously entered in either the
+FASTA definition lines or the submission dialogs. This includes the
+organism name which is required for submission.
+
+>Protein Page
+
+#This page allows you to provide the protein sequence translated from
+the nucleotide sequence that you just entered. If the nucleotide
+sequence is alternatively spliced or contains multiple open reading
+frames, enter all of the protein sequences on this page. Each protein
+sequence will appear in the database record as a coding sequence (CDS)
+feature. Sequin will automatically determine which nucleotide
+sequences code for the protein and indicate the nucleotide sequence
+interval on the database record. Sequin also provides tools that allow
+you to view a graphical representation of all the open reading frames
+in your nucleotide sequence and to convert these reading frames into
+CDS features. These tools are described later in the help
+documentation under the
+
+<A HREF="#ORFFinder">
+ORF Finder.
+</A>
+
+*Conceptual Translation Confirmed by Peptide Sequencing
+
+#Most protein entries are computer-generated conceptual translations of
+a nucleic acid sequence. If you have confirmed this translation by
+direct sequencing either of the entire protein or of peptides derived
+from the protein, please check this box.
+
+*Incomplete at NH3 end/Incomplete at COOH end
+
+#If the sequence is lacking amino acids at the amino- or
+carboxy-terminal end of the protein, please check the appropriate box.
+
+*Create Initial mRNA with CDS Intervals
+
+#If you check this box, Sequin will make an mRNA feature with the same
+initial intervals (i.e., range of sequence) as the CDS feature. After
+the record has been assembled, you should edit the mRNA feature location
+to add the 5' UTR and 3' UTR intervals. This may be done either in the
+mRNA editor or in the sequence editor.
+
+*Import Protein FASTA
+
+#You can import a single or multiple protein sequences contained within
+a previously generated protein FASTA file.
+
+**FASTA Format for Protein Sequences
+
+#The basic FASTA format is the same as that used for
+<A HREF="#FASTAFormatforNucleotideSequences">
+nucleotide sequences
+</A>
+, with a FASTA definition line followed by the sequence itself.
+
+#In order to match the protein sequence to the correct nucleotide
+sequence, you must use the same Sequence Identifier (SeqID) that you
+used to identify the nucleotide sequence. Thus in cases of
+alternatively spliced genes, a single protein FASTA file can contain
+two unique sequences that have the same SeqID. Both coding regions
+will be added to the same nucleotide sequence.
+
+#The available modifiers for use in a protein FASTA definition line are
+different than those for a nucleotide FASTA definition line and are
+limited to information about the protein or gene itself and are
+contained within the examples below. The format remains [modifer=text].
+
+#Note in all cases, the FASTA definition line must not contain any hard
+returns. All information must be on a single line of text.
+
+#Examples of properly formatted protein FASTA definition lines are:
+
+<KBD><PRE>>Seq1 [protein=neuropilin 1] [gene=Nrp1]</KBD></PRE>
+
+<KBD><PRE>>ABCD [protein=merozoite surface protein 2] [gene=msp2] [protein_desc=MSP2]</KBD></PRE>
+
+<KBD><PRE>>DNA.new [protein=breast and ovarian cancer susceptibility protein] [gene=BRCA1] [note=breast cancer 1, early onset]</KBD></PRE>
+
+#The protein name should be included in the entry; all other fields are
+optional.
+
+#The line after the FASTA definition line begins the amino acid
+sequence. It is recommended that each line of sequence be no longer
+than 80 characters. Please only use IUPAC symbols within the amino
+acid sequence. Non-IUPAC amino acid symbols will be stripped from the
+sequence.
+
+#After you import your sequence, a window will appear with information
+about the sequence. The first line will describe the number of protein
+sequences imported and the total length in amino acids of
+all sequences. Each sequence is numbered, and its length,
+unique identifier (SeqID), Gene symbol, Protein name, and title
+(Definition line) as supplied in the FASTA definition line are listed.
+
+>Annotation Page
+
+#Note: This page will not be available if you have selected a segmented
+or gapped sequence as the
+<A HREF="#SubmissionType">
+Submission Type
+</A>
+.
+
+#On this page, you can add a
+<A HREF="#gene">
+gene
+</A>
+,
+<A HREF="#rRNA">
+ribosomal RNA
+</A>
+ or
+<A HREF="#CDS">
+CDS
+</A>
+ feature across the entire span of each sequence you are submitting.
+You can not specify locations within each sequence using this page.
+More options are available under the
+
+<A HREF="#AnnotateMenu">
+Annotate Menu
+</A>
+in the record viewer.
+
+#If the feature should be partial at one or both ends, check the
+appropriate box and then fill in the text boxes for the relevant
+feature.
+
+#You may add a title to all sequences if this was not included in the
+FASTA definition line. This will be used as the DEFINITION field in
+the final flatfile. The title should contain a brief description of
+the sequence. There is a preferred format for nucleotide and protein
+titles and Sequin can generate them automatically using the Generate
+Definition Line function under the Annotate menu in the record viewer.
+
+>Assembly Tracking
+
+#You will only see this form if you had previously indicated that the
+entry is a Third-Party Annotation submission. You must provide the
+GenBank Accession number(s) of the primary sequence used to assemble
+your TPA sequence. We can not accept primary sequences corresponding
+to Reference Sequences or those from proprietary databases. More
+information about this can be found on the
+
+<A HREF="http://www.ncbi.nlm.nih.gov/Genbank/tpa.html">
+TPA
+</A>
+home page.
+
+#If a proper GenBank Accession is entered in the first column of the
+Assembly Tracking form, the GenBank staff can map the coordinates for
+you. You do not need to fill out the 'from' and 'to' columns. Note
+that multiple accessions may be entered to provide full coverage of the
+assembled sequence.
+
+#You may also generate an Assembly Tracking form in the record viewer
+under the Annotate menu. Select Descriptors and TPA Assembly from the
+pull-down menu in order to generate the Assembly Tracking form.
+
+>Editing the Record
+
+*Overview
+
+#After you finish the Organism and Sequences Form, Sequin will process
+your entry based on the information you have entered. The window you
+see now is called the record viewer. This is also the window you will
+see if you are submitting an update to an existing record. The
+instructions after this point are the same whether you are submitting a
+new record or an update.
+
+#In the default window of the record viewer, you will see your entry
+approximately as it would appear in the database. Most of the
+information that you entered earlier in the submission process is
+present in the viewer; other information, such as the contact, is still
+present in the record but will not be visible in the database entry. If
+you have provided a conceptual translation of the nucleotide sequence,
+the translation will be listed as a CDS Feature. Sequin automatically
+determines which nucleotides encode for the protein, and lists them,
+even if the nucleotide sequence contains introns and exons.
+
+#You can save the entry to a file by selecting Save or Save As under the
+File menu. This is not the same as saving the entry for submission to
+the database. It is a good idea to save the file at this point so that
+if you make any unwanted changes during the editing process you can
+revert to the original copy. If you wish to edit the entry later, click
+on "Read Existing Record" on the Welcome to Sequin form and choose
+the file.
+
+#It is likely that the entry could be processed now for submission to
+the database. However, you may wish to add information to
+the entry. This information may be in the form of Descriptors or
+Features. Descriptors are annotations that apply to an
+entire sequence, or an entire set of sequences, and Features are
+annotations that apply to a specific sequence interval. For example,
+you may want to change the Reference Descriptor to add a published
+manuscript, or to annotate the sequence by adding features such as a
+signal peptide or polyA signal.
+
+#Information in the record viewer can be edited in different ways. One
+way to modify information is to double click within the block of
+information you wish to edit. Many blocks, such as "Definition",
+"Source", "Reference", or "Features" can be edited.
+
+#To add information, create a new descriptor
+or feature by selecting the appropriate form from the Misc or Features
+menus. These options are described later in this help document.
+
+#Finally, you may need to edit the sequence itself.
+<A HREF="#SequenceEditor">
+Instructions
+</A>
+for working with the sequence are presented in the documentation for the
+Sequence Editor.
+
+*Submitting the Finished Record to the Database
+
+#Once you are satisfied that you have added all the appropriate
+information, you must process your entry for submission to the database.
+ Select "Validate" under the Search menu. This function detects
+discrepancies between the format of your submission and that required by
+the database selected for entry.
+
+#If Sequin detects problems with the format of your record, you will see a
+screen listing the validation errors as well as suggestions for how to fix the
+discrepancies. Single clicking on an error message scrolls the record viewer
+to the feature that is causing the error. Double clicking on the error message
+launches a new form on which you can enter information to correct the problem.
+If you are annotating a set of multiple sequences, shift-click to scroll to the
+target sequence and feature. You can also dismiss the suggestion and proceed
+on your own. When you think you have corrected all the problems, click on
+"Revalidate".
+
+#Message: Select Verbose, Normal, Terse, or Table. Verbose gives a more
+detailed explanation of the problem.
+
+#Filter: Select the error messages you wish to see. You can select
+ALL, SEQ_INST (errors regarding the sequence itself, its type, or
+length), SEQ_DESCR (descriptor errors), SEQ_FEAT (feature errors), or
+errors specific to your record.
+
+#Severity: Select the types of error messages you wish to see. You
+will see the type of message selected, as well as any messages warning
+of more serious problems.
+
+#There are four types of error messages, Info, Warning, Error, and
+Reject. Info is the least severe, and Reject is the most severe. You
+may submit the record even if it does contain errors. However, we
+encourage you to fix as many problems as possible. Note that some
+messages may be merely suggestions, not discrepancies. A possible
+Warning message is that a splice site does not match the consensus.
+This may be a legitimate result, but you may wish to recheck the
+sequence. A possible Error message is that the conceptual translation
+of the sequence that you supplied does not encode an open reading
+frame. In this case, you should check that you translated the sequence
+in the correct reading frame. A possible Reject message is that you
+neglected to include the name of the organism from which the sequence
+was derived. The name of the organism is absolutely required for a
+database entry.
+
+#If Sequin does not detect any problems with the format of your record,
+you will see a message that "Validation test succeeded".
+
+#To prepare the submission, click the "Done" button on the record
+viewer, or select "Prepare Submission" under the File menu. You will be
+prompted to save the file. Email this file to the database at the
+address shown. You MUST email the file; Sequin does not submit the
+file automatically over the network. The email addresses for the
+databases are:
+
+!-GenBank: gb-sub@ncbi.nlm.nih.gov
+!-EMBL: datasubs@ebi.ac.uk
+!-DDBJ: ddbjsub@ddbj.nig.ac.jp
+
+#After your entry is complete, close the record viewer. You will be
+returned to the Welcome to Sequin form and can begin another entry.
+
+>The Record Viewer
+
+*Target Sequence
+
+#This pop-up menu shows a list of SeqIDs of all nucleotide and protein
+sequences associated with the Sequin entry. Use the menu to select the
+sequences displayed in the record viewer, as well as the sequences you
+want to "target", that is, the sequences to which you want to apply a
+descriptor (see
+<A HREF="#Descriptors">
+Descriptors
+</A>
+ in the Sequin help documentation). You may select either an individual
+sequence by name or a set of sequences, such as All Sequences, or
+SEG_dna if you have a segmented nucleotide set. You may change the
+selection at any time.
+
+*Display Format
+
+#You may change the display format of the record viewer to any of the
+formats described below. Editing a field in one display format will
+change that field in all formats. Subsequent pop-up menus will appear
+depending on which format is selected.
+
+**GenBank
+
+#This display format allows you to see the submission as it would appear
+as a GenBank or DDBJ entry. It is the default format.
+
+#The Mode pop-up default setting is Sequin. Release mode shows certain
+qualifiers and db_xrefs in RefSeq entries which are non-collaborative.
+Entrez mode is used fro web display and can show new elements that have
+not yet finished their four month quarentine period. Dump mode requires
+that the accession slot be populated. In most cases, there is no need
+to change from the default Sequin mode.
+
+#The Style pop-up allows different views of segmented records. The
+default is Normal. Segment style is the traditional representation of
+segmented sequences, while Contig style displays a CONTIG line with a
+join of accessions instead of raw sequence. Master style shows
+features mapped to the segmented sequence coordinates instead of the
+coordinates of the individual parts.
+
+**Graphic
+
+#This display format shows the entry in a graphical view. The top bar
+represents the nucleotide sequence. Lower arrows or bars represent
+different features on the sequence. Double click on an arrow or bar to
+launch the appropriate editing window. Any sequence highlighted in the
+Sequence Editor will be boxed on the graphical view of the sequence.
+To see a graphical representation of a segmented set (see
+
+<A HREF="#Submissiontype">
+Submission type
+</A>,
+above), the Target Sequence must be set to
+SEG_dna.
+
+#The Style pop-up menu allows you to see the display in different styles
+and colors.
+
+#The Scale pop-up menu allows you to see the display in different sizes.
+The smaller the number, the larger the display.
+
+**Sequence
+
+#This display format shows the nucleotide sequence in the record along
+with any annotated features (such as CDS or mRNA). You can only view a
+single sequence at a time with this option. You can use the Features
+pop-up menu to change the display of the features. With the numbering
+pop-up menu, select where you want the sequence numbers to be
+indicated, at the side of the sindow, at the top of each sequence line,
+or not at all.
+
+**Alignment
+
+#This display format shows sets of aligned sequences, such as those
+imported as part of a population, phylogenetic, mutation, or
+environmental samples set. When toggled to All Sequences in the Target
+Sequence pop-up, the alignment of all entries will be displayed. To
+more closely analyze similarities, you can select a single entry in the
+Target Sequence pop-up. The complete sequence of the entry selected
+will be displayed. Any nucleotides in the other sequences that differ
+from that selected will be displayed, while identical nucleotides will
+be displayed as a period. You can also display features annotated on
+the selected target sequence or all sequences using the Feature display
+toggle. To launch the alignment editor, select
+<A HREF="#AlignmentAssistant">
+Alignment Assistant
+</A>
+from the record viewer Edit menu.
+
+**EMBL
+
+#This display format allows you to see the submission as it would appear
+as an EMBL entry.
+
+**Table
+
+#This display format shows the annotation in a five-column, tab-delimited
+<A HREF="table.html">table</A>
+ format. This format can be imported to add annotation to a record that
+has none.
+
+**FASTA
+
+#This display shows the sequence and Definition line only, without any
+annotations, in a format called the FASTA format. This is a format used
+by many molecular biology analysis programs. You cannot edit in this
+display mode.
+
+**Quality
+
+#This display format shows quality score data ifit has been included in
+the submission.
+
+**ASN.1
+
+#This display shows the entry in Abstract Syntax Notation 1, a data
+description language used by the NCBI. You cannot edit in this display
+mode.
+
+**XML
+
+#This display format shows the entry in XML language, sometimes used by
+various databases. You cannot edit in this display mode.
+
+**INSDSeq
+
+#This display format shows the entry in the XML format used by the INSD.
+ You cannot edit in this display mode.
+
+**Desktop
+
+#The NCBI DeskTop displays the internal
+structure of the record being viewed in Sequin. The
+<A HREF="#NCBIDeskTop">
+DeskTop
+</A>
+is explained under the Misc menu.
+
+*Done
+
+#This button allows you to validate the entry when you are finished with
+the submission. See
+<A HREF="#SubmittingtheFinishedRecordtotheDatabase">
+Submitting the Finished Record to the Database
+</A>
+ in the Sequin help documentation.
+
+*Controls for Downloaded Entries
+
+#If you have downloaded a sequence from Entrez, you will see an
+additional button labeled PubMed. This button will launch a web
+browser containing the target sequence as it appears in Entrez. From
+here, you can access any Entrez-supported Links, including related
+sequences and associated references in PubMed.
+
+>Descriptors
+
+*Overview
+
+#Descriptors are annotations that apply to an entire sequence, or an
+entire set of sequences, in a given entry. They do not have a specific
+location on a sequence, as they apply to the entire sequence. They can
+be contrasted to
+<A HREF="#Features">
+Features,
+</A>
+which apply to a specific interval of the sequence.
+
+#You may edit descriptors in one of two ways.
+
+#(1) In the record viewer, double click within the text of the
+descriptor to bring up a form on which information can be added.
+
+#(2) Choose the option Descriptors from the Annotate menu.
+
+*Annotate Menu
+
+#This menu allows you either to create new descriptors or to modify
+existing ones. Select the descriptor that you wish to modify.
+
+#When you first select a descriptor, you will see a window called
+"Descriptor Target Control". Using the target control pop-up menu,
+select the sequences you wish this descriptor to cover. The name(s)
+listed correspond to the SeqID(s) given to the nucleotide or amino acid
+sequences when when they were imported into Sequin. The default
+selection for this menu is set in the Target Sequence pop-up menu on
+the record viewer. You may choose to have the descriptor cover just
+one sequence, or a set of sequences in your entry. If you are creating
+a new descriptor, select "Create New". If you wish to modify a
+previous descriptor, select "Edit Old".
+
+#The following is a list of some of the descriptors that can be added.
+Two additional descriptors, those for
+<A HREF="#Publications">
+Publications
+</A>
+and
+<A HREF="#BiologicalSourceDescriptororFeature">
+Biological Source,
+</A>
+are described in other sections.
+
+**TPA Assembly
+
+#If you indicated that your sequence is a TPA submission, a
+<A HREF="#AssemblyTracking">
+TPA Assembly
+</A>
+ was created from the information regarding primary accession numbers.
+This Assembly information can be edited here. Note that it is not
+necessary to enter nucleotide location in the "from" and "to" columns.
+
+**Update Date
+
+#This is for database staff use only. Please do not modify the date.
+
+**Create Date
+
+#This is for database staff use only. Please do not modify the date.
+
+**Region
+
+#This descriptor provides general information about the genetic context
+of the sequence. For example, if your nucleotide sequence is cloned
+from the region surrounding the Huntington's Disease gene, you could
+enter that information here. Providing information for this descriptor
+is optional.
+
+**Name
+
+#Alternative place for a descriptive name for the sequence. This
+information will not appear in the flatfile view, but will be
+maintained in the ASN1.
+
+**Comment
+
+#This descriptor is used to list any additional information that you
+wish to provide about the sequence. Use of this descriptor is optional.
+ Most information can be better annotated using the appropriate
+features and qualifiers rather than a generic comment descriptor.
+
+**Title
+
+#This descriptor contains the information that will go on the Definition
+line of the database entry. If you supplied a title for your
+nucleotide sequence when you imported it into Sequin, that information
+is here. If you wish to change the Definition line, or if you did not
+supply a title when you submitted the sequence, edit this Descriptor.
+For more information on creating proper Definition lines, please see
+the Sequin help documentation for the
+
+<A HREF="#NucleotideDefinitionLine(Title)">
+Nucleotide Definition Line (Title)
+</A>.
+
+**Molecule Description
+
+#This descriptor indicates the characteristics of the molecule from
+which the sequence was derived. The information that you have already
+entered can be edited here. In most cases, the molecule and class are
+the only choices which should be edited from the default values.
+
+***Molecule
+
+#A GenBank sequence can represent one of several different molecule
+types. Enter in the Molecule pop-up menu the type of molecule that was
+sequenced. A brief description of the choices in this pop-up menu were
+listed previously.
+
+***Completedness
+
+Choose the appropriate option from the pop-up menu.
+
+#-Complete: Use this designation when a complete molecule, such as a
+complete mitochondrial genome, is being submitted.
+
+#-Partial: Use this designation when an incomplete unit, such as the
+partial coding sequence of a gene, is being submitted.
+
+#-No left: Use this designation when an incomplete unit, such as the
+partial coding sequence of a gene, or a partial protein sequence, is
+being submitted. The sequence has no left if it is incomplete on the
+5', or amino-terminal, end.
+
+#-No right: Use this designation when an incomplete unit, such as the
+partial coding sequence of a gene, or a partial protein sequence, is
+being submitted. The sequence has no right if it is incomplete on the
+3', or carboxy-terminal, end.
+
+#-No ends: Use this designation when an incomplete unit, such as the
+partial coding sequence of a gene, or a partial protein sequence, is
+being submitted, The sequence has no ends if it is incomplete at both
+the 5' and 3', or amino- and carboxy- terminal, ends.
+
+#-Other: Use this designation when none of the above descriptions apply.
+
+***Technique
+
+#From the pop-up menu, select the technique that was used to generate the
+sequence.
+
+#-Standard: standard sequencing technique.
+
+#-EST:
+<A HREF="http://www.ncbi.nlm.nih.gov/dbEST/index.html">
+Expressed Sequence Tag
+</A>
+: single-pass, low-quality mRNA sequences
+derived from cDNAs. These sequences will appear in the EST division.
+
+#-STS:
+<A HREF="http://www.ncbi.nlm.nih.gov/dbSTS/index.html">
+ Sequence Tagged Site
+</A>
+: short sequences that are operationally
+unique in a genome and that define a specific position on the physical
+map. These sequences will appear in the STS division.
+
+#-Survey:
+<A HREF="http://www.ncbi.nlm.nih.gov/dbGSS/index.html">
+single-pass genomic sequence
+</A>
+. These sequences will appear in
+the Genome Survey Sequence (GSS) division.
+
+#-Genetic Map: Genetic map information, for example, in the Genomes division.
+
+#-Physical Map: Physical map information, for example in the Genomes division.
+
+#-Derived: A sequence assembled into a contig from shorter sequences.
+
+#-Concept-trans: A protein translation generated with the appropriate
+genetic code.
+
+#-Seq-pept: Protein sequence was generated by direct sequencing of a
+peptide.
+
+#-Both: Protein sequence was generated by conceptual translation and
+confirmed by peptide sequencing.
+
+#-Seq-pept-Overlap: Protein sequence was generated by sequencing
+multiple peptides, and the order of peptides was determined by overlap
+in their sequences.
+
+#-Seq-pept-Homol: Protein sequence was generated by sequencing
+multiple peptides, and the order of peptides was determined by homology
+with another protein.
+
+#-Concept-Trans-A: Conceptual translation of the nucleotide sequence
+provided by the author of the entry.
+
+#-HTGS 0:
+<A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
+High Throughput Genome Sequence
+</A>
+, Phase 0. These sequences
+are produced by high-throughput sequencing projects and will be in the
+HTG division.
+
+#-HTGS 1:
+<A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
+High Throughput Genome Sequence
+</A>
+, Phase 1. These sequences
+are produced by high-throughput sequencing projects and will be in the
+HTG division.
+
+#-HTGS 2:
+<A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
+High Throughput Genome Sequence
+</A>
+, Phase 2. These sequences
+are produced by high-throughput sequencing projects and will be in the
+HTG division.
+
+#-HTGS 3:
+<A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
+High Throughput Genome Sequence
+</A>
+, Phase 3. These sequences
+are produced by high-throughput sequencing projects and will be in the
+HTG division.
+
+#-FLI_cDNA: Full Length Insert cDNA. Sequence corresponds to entire cDNA but
+not necessarily entire transcript. These sequences are produced by large
+sequencing projects.
+
+#-HTC: High Throughput cDNA. These sequences are produced by large sequencing
+projects.
+
+#-WGS:
+<A HREF="http://www.ncbi.nlm.nih.gov/Genbank/wgs.html">
+Whole Genome Shotgun
+</A>
+. These sequences are produced by large sequencing projets and follow a
+separate submission process.
+
+#-Barcode: Nucleotide sequence is part of Barcodes of Life project. This
+selection should only be used by members of the Consortium for the
+Barcodes of Life.
+
+#-Other: Do not use this designation.
+
+***Class
+
+#From the pop-up menu, select the type of molecule that was sequenced.
+
+#-DNA: DNA
+
+#-RNA: RNA
+
+#-Protein: Protein
+
+#-Nucleotide: Do not select this item
+
+#-Other: Do not select this item
+
+***Topology
+
+#From the pop-up menu, select the topology of the sequenced molecule.
+
+#-Linear: Linear molecule (most sequences).
+
+#-Circular: Circular molecule (such as a complete plasmid or mitochondrion).
+
+#-Tandem: Do not select this item.
+
+#-Other: Do not select this item.
+
+***Strand
+
+#From the pop-up menu, select whether the sequence was derived from an
+organism with a single- or double-stranded genome. This is used primarily for
+viral submissions.
+
+#-Single: The organism contains only a single-stranded genome, for
+example, ssRNA viruses.
+
+#-Double: The organism contains only a double-stranded genome, for
+example, dsDNA viruses.
+
+#-Mixed: Do not select this item.
+
+#-Mixed Rev: Do not select this item.
+
+#-Other: Do not select this item.
+
+**Biological Source
+
+#The Biological Source descriptor is described in more detail
+<A HREF="#BiologicalSourceDescriptororFeature">
+below.
+</A>
+
+>Features
+
+*Overview
+
+#Features are annotations which apply to one or more intervals on a
+sequence. They can be contrasted to
+<A HREF="#Descriptors">
+Descriptors,
+</A>
+that apply to an entire sequence or an entire set of sequences.
+Features will be added to the Target Sequence selected in the record
+viewer pop-up menu.
+
+#You may add or modify features in one of three ways.
+
+#(1) In the record viewer, double click on the text of an existing
+feature to bring up a form on which information can be added or edited.
+
+#(2) Choose the feature from the Annotate menu to add a new feature.
+
+#(3) Choose the feature from the Sequence Editor Features menu to add a
+new feature.
+
+#The features listed in the Annotate menu and the Sequence Editor
+Features menu are identical, and the instructions for adding them are
+the same, with one exception. If you annotate them in the Annotate
+menu, you must provide the nucleotide sequence location of the feature.
+ However, if you add features from the Sequence Editor, you can
+highlight the sequence that the feature covers, and the location of the
+sequence will be automatically entered in the feature location box.
+
+*Annotate Menu
+
+#This menu allows you to add or modify features on the sequence selected
+in the Target Sequence pop-up menu of the record viewer. Features are
+grouped into six categories. Select the feature that you would like to
+mark on your sequence. A new form will appear.
+
+#Feature forms share a common design. The first page is specific to the
+particular feature, e.g., Coding Region or Gene. The second page lists
+Properties of the Feature. The third page describes the Location of the
+feature. Details about the common second and third pages are provided
+below.
+
+**Properties Page
+
+***General Subpage
+
+#Enter general comments about the feature here.
+
+#Select any of the flags if necessary. If this sequence contains only a
+partial representation of the feature you are describing, check the
+"Partial" box. Check the "Exception" box if the feature annotates a
+post-transcriptional modification of the nucleotide sequence, such as
+ribosomal slippage or RNA editing. This is generally used only on CDS
+features. The evidence dialogs will only be editable if information
+has been entered in the Evidence subpage.
+
+#If a gene feature overlaps the feature you are editing, the gene symbol
+will appear in the pull-down menu. If you want to add the name of a
+new gene, select new, and enter its name and optional description. By
+default, mapping between the feature and the gene is done by overlap,
+that is, the gene associated with the feature is the gene whose
+location overlaps with the location of the feature. Under some
+circumstances, for example, if the sequences of two genes overlap, you
+may wish the feature to apply to a different gene. In this case,
+select cross-reference, and select the name of the new gene in the
+pop-up menu. If you do not want the feature to map to any existing
+gene, select suppress. You may also edit information on the Gene
+feature form by clicking on Edit Gene Feature.
+
+***Comment Subpage
+
+#Add any comments about the feature here, especially if you checked the
+"Exception" box on the General Subpage.
+
+***Citations Subpage
+
+#This page is used to list any citations that specifically apply to the
+feature you are annotating. The citation must have already been entered
+into the record (see
+<A HREF="#Publications">
+Publications
+</A>)
+ in the Sequin help documentation. Click on Edit Citations, and
+place a check mark in box next to the publication you want to cite.
+However, we discourage the use of citations on features.
+
+***Cross-Refs Subpage
+
+#This is a read-only page used to cross-reference this entry to entries
+in external databases (databases other than GenBank, EMBL/EBI, and
+DDBJ), such as dbEST or FLYBASE. For more information on this topic,
+see the International Nucleotide Sequence Database Collaboration
+
+<A HREF="http://www.ncbi.nlm.nih.gov/collab/db_xref.html">
+page
+</A>.
+http://www.ncbi.nlm.nih.gov/collab/db_xref.html
+
+***Evidence Subpage
+
+#This page is primarily used by large sequencing centers to explain
+annotation prediction methods and its use is optional. More details
+about these qualifiers can be found in the
+<A HREF="http://www.ncbi.nlm.nih.gov/GenBank/evidence.html">
+genome submission guidelines
+</A>.
+The two choices of evidence are Experiment or Inference.
+
+#Wet-bench, experimental evidence can be entered as free text in the
+Experiment section. Please be as brief as possible.
+
+#The Inference section allows for information to be added in cases where
+the feature is annotated based solely on sequence similarity or
+prediction software. In order to fill in text, you must select one of
+the options from the Category pull-down menu. Different pull-down and
+text boxes will appear depending on the selection you choose from the
+Category menu. If you select one of the 'similar to' categories, you
+must include the name of the database and the corresponding accession
+number of the sequence used as the basis for the annotation. If you
+choose one of the prediction categories, you must include the name and
+version of the prediction program used as the basis for the annotation.
+
+#For example, if your annotation of a coding region was based on
+similarity to the sequence and annotation in GenBank Accession number
+AY411252, you would select "similar to DNA sequence" from the pull-down
+menu and then select "INSD" in the Database pull-down. You would then
+type "AY411252.1" in the Accession text box. If the annotation is
+based on the Genscan prediction algorithm, you would select "ab initio
+prediction" from the pull-down menu, select "Genscan" in the Program
+pull-down and enter 2.0 in the Program Version text box. If the
+database or program used is not listed in the appropriate pull-down
+list, select Other from the list. A new text box will appear where you
+can enter the name of the database or program used. You still must
+include the appropriate accession number or version in the subsequent
+text box.
+
+***Identifiers Subpage
+
+#This is a read-only page used by the database staff for tracking
+features within the record.
+
+**Location Page
+
+#This page allows you to select the location of the feature you are
+citing. Each feature must have a sequence interval associated with it.
+In most cases, Sequin will limit the option to the nucleic acid or
+protein sequence as appropriate.
+
+#Check the 5' Partial or 3' Partial box if the feature in your nucleic
+acid sequence is missing residues at the 5' or 3' ends, respectively.
+Check the NH2 Partial or COOH Partial if the feature in your amino acid
+sequence is missing residues at the amino- or carboxy-terminal ends,
+respectively. If you checked "Partial" on the Properties page, you
+must check either the 5' and/or 3' partial boxes.
+
+#Enter the sequence range of the feature. The numbers should correspond
+to the nucleotide sequence interval if the SeqID is set to a nucleotide
+sequence, and to an amino acid sequence interval if the SeqID is set to
+a protein sequence. If the feature spans multiple, non-continuous
+intervals on the sequence, indicate the beginning and end points of each
+interval. If each interval is separate, and should not be joined with
+the others to describe the feature, check the Intersperse intervals with
+gaps box (for example, when annotating multiple primer binding sites).
+If the feature is composed of several intervals that should all be
+joined together, do not check the box (for example, when annotating mRNA
+on a genomic DNA sequence).
+
+#For nucleic acid Features only: From the pop-up menu, select the
+strand on which the feature is found.
+
+#-Plus: Plus strand, or coding strand.
+
+#-Minus: Minus strand, or non-coding strand.
+
+#-Both: Both strands.
+
+#-Reverse: Do not select this item.
+
+#-Other: Do not select this item.
+
+#Use the pop-up menu to select the SeqID of the sequence you are
+describing by the location.
+
+#If you are working on a set of sequences which contain an alignment,
+you will see a toggle at the bottom of the Location Page where you can
+select to add or view the location of the feature using the Sequence
+Coordinates of the target sequence or the Alignment Coordinates. In
+either case, the feature will only be added to the target sequence. If
+you want to add features to all members of the set using the alignment
+coordinates, you must use the
+
+<A HREF="http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html#Workingwithsetsofalignedsequences">
+Alignment Assistant
+</A>
+.
+#A brief description of the available features follows. A detailed
+explanation of how to use the coding region (CDS) feature is included.
+The DDBJ/EMBL/GenBank feature table definition
+<A HREF="http://www.ncbi.nlm.nih.gov/collab/FT/index.html">
+page
+</A>
+http://www.ncbi.nlm.nih.gov/collab/FT/index.html
+ provides detailed information about other features.
+
+*attenuator
+
+#1) region of DNA at which regulation of termination of transcription
+occurs, which controls the expression of some bacterial operons; 2)
+sequence segment located between the promoter and the first structural
+gene that causes partial termination of transcription.
+
+*C_region
+
+#Constant region of immunoglobulin light and heavy chains, and T-cell
+receptor alpha, beta, and gamma chains. Includes one or more exons,
+depending on the particular chain.
+
+*CAAT_signal
+
+#CAAT box; part of a conserved sequence located about 75 bp upstream of
+the start point of eukaryotic transcription units that may be involved
+in RNA polymerase binding; consensus=GG(C or T)CAATCT.
+
+*CDS
+
+#coding sequence; sequence of nucleotides that corresponds with the
+sequence of amino acids in a protein (location includes stop codon).
+Feature includes amino acid conceptual translation.
+
+**Coding Region Page
+
+#Most users add a coding region to their sequence when they fill out the
+Organism and Sequences form. However, you may need to edit the coding
+region, or add additional ones. Choose CDS under the Coding Regions
+and Transcripts submenu of the Features menu, or to edit an existing
+CDS, double click on the record viewer. If you appended the partial
+sequence of a coding region to the Organism and Sequences form, you will
+probably need to edit the Coding Region feature to avoid validation
+error messages about the location of the coding region.
+
+***General (Product) Subpage
+
+#Choose the genetic code that should be used to translate the
+nucleotide sequence. For more information, and for the translation
+tables themselves, see the NCBI Taxonomy
+<A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c">
+page
+</A>.
+If the genetic code is already populated from the taxonomy database, do
+not change this selection.
+
+#Choose the reading frame in which to translate the sequence. Do not
+fill in the Protein Product or SeqID selections.
+
+#Supply additional information about the protein by clicking on Edit
+Protein Information to launch the Protein feature forms. The protein
+name must have already been filled out on the Protein subpage.
+
+#Checking retranslate on accept will translate the nucleotide sequence
+according to the interval(s) indicated on the Locations page when you
+click on Accept to exit the editor. This new translation will replace
+any earlier translations you have supplied. This should not be a
+problem if the interval was indicated appropriately.
+
+#If the coding sequence that you supply is a partial sequence and you
+have checked a Partial box on the Location subpage, it is a good idea to
+check the Synchronize Partials box. In this case, Sequin will ensure
+that all other appropriate features (such as protein) are also marked as
+partial.
+
+#When editing existing CDS features, choose the sequence you want to
+view by selecting its name uder the Product pop-up menu. You may also
+import a new protein sequence by selecting Import Protein FASTA under
+the file menu. The sequence should be formatted as described above on
+the Organism and Sequences form.
+
+#After you have imported a protein sequence, click on Predict Interval.
+This function will predict the interval on the nucleotide sequence to
+which the coding region applies. If you do not select this function,
+the interval will likely be wrong, and you will get an error message
+when you attempt to validate the record. If your sequence is a 5' or 3'
+partial, you must first indicate this manually on the Location Page.
+
+#You may also have Sequin generate the protein sequence from the
+nucleotide sequence by clicking on Translate Product. However, you must
+first indicate the location and partialness of the coding region on the
+Location page in order to obtain the correct translation.
+
+***Protein Subpage
+
+#Use this page to enter or edit a name or descriptionof the protein
+product. For a new sequence, enter information directly into the
+boxes. You can edit descriptions of an existing sequence by clicking
+on Edit Protein Feature which will bring up the Protein feature form.
+The Launch Product Viewer displays the flatfile view of ht eprotein
+record generated from the information in the CDS feature.
+
+***Exceptions Subpage
+
+#Exceptions describe places where there is a posttranslational
+modification. Enter the amino acid position at which the modification
+occurs, and select the amino acid that is actually represented in the
+protein from the pop-up list. Sequin will change the amino acid number
+to a nucleotide interval. Please provide some explanation for the
+exception in a comment.
+
+*conflict
+
+#Independent determinations of the "same" sequence differ at this site
+or region.
+
+*D-loop
+
+#Displacement loop; a region within mitochondrial DNA in which a short
+stretch of RNA is paired with one strand of DNA, displacing the
+original partner DNA strand in this region; also used to describe the
+displacement of a region of one strand of duplex DNA by a single
+stranded invader in the reaction catalyzed by RecA protein.
+
+*D_segment
+
+#Diversity segment of immunoglobulin heavy chain, and T-cell receptor
+beta chain.
+
+*enhancer
+
+#A cis-acting sequence that increases the utilization of (some)
+eukaryotic promoters and can function in either orientation and in any
+location (upstream or downstream) relative to the promoter.
+
+*exon
+
+#Region of genome that codes for portion of spliced mRNA; may contain
+5' UTR, all CDSs, and 3' UTR.
+
+*gap
+
+#Gap in the sequence, only applied to gaps of unknown length. The
+location span of the gap feature is 100 base pairs, indicated by 100 "n"s
+in the sequence. The qualifier /estimated_length=unknown is mandatory.
+
+*GC_signal
+
+#GC box; a conserved GC-rich region located upstream of the start point
+of eukaryotic transcription units that may occur in multiple copies or
+in either orientation; consensus=GGGCGG.
+
+*gene
+
+#Region of biological interest identified as a gene and for which a name
+has been assigned.
+
+*iDNA
+
+#Intervening DNA; DNA which is eliminated through any of several kinds
+of recombination.
+
+*intron
+
+#A segment of DNA that is transcribed, but removed from within the
+transcript, by splicing together the sequences (exons) on either side of
+it.
+
+*J_segment
+
+#Joining segment of immunoglobulin light and heavy chains, and T-cell
+receptor alpha, beta, and gamma chains.
+
+*LTR
+
+#Long terminal repeat, a sequence directly repeated at both ends of a
+defined sequence, of the sort typically found in retroviruses.
+
+*mat_peptide
+
+#Mature peptide or protein coding sequence; coding sequence for the
+mature or final peptide or protein product following post-translational
+modification. The location does not include the stop codon (unlike the
+corresponding CDS).
+
+*misc_binding
+
+#Site in nucleic acid that covalently or non-covalently binds another
+moiety that cannot be described by any other Binding key (primer_bind or
+protein_bind).
+
+*misc_difference
+
+#Feature sequence is different from that presented in the entry and
+cannot be described by any other Difference key (conflict, unsure,
+old_sequence, mutation, variation, allele, or modified_base).
+
+*misc_feature
+
+#Region of biological interest which cannot be described by any other
+feature key.
+
+*misc_recomb
+
+#Site of any generalized, site-specific, or replicative recombination
+event where there is a breakage and reunion of duplex DNA that cannot be
+described by other recombination keys (iDNA and virion) or qualifiers of
+source key (/insertion_seq, /transposon, /proviral).
+
+*misc_RNA
+
+#Any transcript or RNA product that cannot be defined by other RNA keys
+(prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR,
+exon, intron, polyA_site, rRNA, tRNA, scRNA, snoRNA, and snRNA).
+
+*misc_signal
+
+#Any region containing a signal controlling or altering gene function or
+expression that cannot be described by other Signal keys (promoter,
+CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS,
+polyA_signal, enhancer, attenuator, terminator, and rep_origin).
+
+*misc_structure
+
+#Any secondary or tertiary structure or conformation that cannot be
+described by other Structure keys (stem_loop and D-loop).
+
+*modified_base
+
+#The indicated nucleotide is a modified nucleotide and should be
+substituted for by the indicated molecule (given in the mod_base
+qualifier value).
+
+*mRNA
+
+#messenger RNA; includes 5' untranslated region (5' UTR), coding sequences
+(CDS, exon) and 3' untranslated region (3' UTR).
+
+*N_region
+
+#Extra nucleotides inserted between rearranged immunoglobulin segments.
+
+*old_sequence
+
+#The presented sequence revises a previous version of the sequence at
+this location.
+
+*operon
+
+#Region containing polycistronic transcript under the control of the same
+regulatory sequences.
+
+*oriT
+
+Origin of transfer; region of DNA where transfer is initiated during the
+process of conjugation or mobilization.
+
+*polyA_signal
+
+#Recognition region necessary for endonuclease cleavage of an RNA
+transcript that is followed by polyadenylation; consensus=AATAAA.
+
+*polyA_site
+
+#Site on an RNA transcript to which will be added adenine residues by
+post-transcriptional polyadenylation.
+
+*precursor_RNA
+
+#Any RNA species that is not yet the mature RNA product; may include 5'
+clipped region (5' clip), 5' untranslated region (5' UTR), coding
+sequences (CDS, exon), intervening sequences (intron), 3' untranslated
+region (3' UTR), and 3' clipped region (3' clip).
+
+*prim_transcript
+
+#Primary (initial, unprocessed) transcript; includes 5' clipped region
+(5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon),
+intervening sequences (intron), 3' untranslated region (3' UTR), and 3'
+clipped region (3' clip).
+
+*primer_bind
+
+#Non-covalent primer binding site for initiation of replication,
+transcription, or reverse transcription. Includes site(s) for synthetic
+e.g., PCR primer elements.
+
+*promoter
+
+#Region on a DNA molecule involved in RNA polymerase binding to initiate
+transcription.
+
+*protein_bind
+
+#Non-covalent protein binding site on nucleic acid.
+
+*RBS
+
+#Ribosome binding site.
+
+*repeat_region
+
+#Region of genome containing repeating units.
+
+*repeat_unit
+
+#Single repeat element.
+
+*rep_origin
+
+#Origin of replication; starting site for duplication of nucleic acid to
+give two identical copies.
+
+*rRNA
+
+#Mature ribosomal RNA ; the RNA component of the ribonucleoprotein
+particle (ribosome) that assembles amino acids into proteins.
+
+*S_region
+
+#Switch region of immunoglobulin heavy chains. Involved in the
+rearrangement of heavy chain DNA leading to the expression of a
+different immunoglobulin class from the same B-cell.
+
+*satellite
+
+#Many tandem repeats (identical or related) of a short basic repeating
+unit; many have a base composition or other property different from the
+genome average that allows them to be separated from the bulk (main
+band) genomic DNA.
+
+*scRNA
+
+#Small cytoplasmic RNA; any one of several small cytoplasmic RNA
+molecules present in the cytoplasm and (sometimes) nucleus of a
+eukaryote.
+
+*sig_peptide
+
+#Signal peptide coding sequence; coding sequence for an N-terminal
+domain of a secreted protein; this domain is involved in attaching
+nascent polypeptide to the membrane; leader sequence.
+
+*snRNA
+
+#Small nuclear RNA involved in pre-mRNA splicing and processing.
+
+*snoRNA
+
+#Small nucleolar RNA molecules generally involved in rRNA modification
+and processing.
+
+*source
+
+#Identifies the biological source of the specified span of the sequence.
+This key is mandatory. Every entry will have, as a minimum, a single
+source key spanning the entire sequence. More than one source key per
+sequence is permittable.
+
+*stem_loop
+
+#Hairpin; a double-helical region formed by base-pairing between
+adjacent (inverted) complementary sequences in a single strand of RNA or
+DNA.
+
+*STS
+
+#Sequence Tagged Site. Short, single-copy DNA sequence that
+characterizes a mapping landmark on the genome and can be detected by
+PCR. A region of the genome can be mapped by determining the order of a
+series of STSs.
+
+*TATA_signal
+
+#TATA box; Goldberg-Hogness box; a conserved AT-rich septamer found
+about 25 bp before the start point of each eukaryotic RNA polymerase II
+transcript unit that may be involved in positioning the enzyme for
+correct initiation; consensus=TATA(A or T)A(A or T).
+
+*terminator
+
+#Sequence of DNA located either at the end of the transcript or adjacent
+to a promoter region that causes RNA polymerase to terminate
+transcription; may also be site of binding of repressor protein.
+
+*transit_peptide
+
+#Transit peptide coding sequence; coding sequence for an N-terminal
+domain of a nuclear-encoded organellar protein; this domain is involved
+in post- translational import of the protein into the organelle.
+
+*tRNA
+
+#Mature transfer RNA, a small RNA molecule (75-85 bases long) that
+mediates the translation of a nucleic acid sequence into an amino acid
+sequence.
+
+*unsure
+
+#Author is unsure of exact sequence in this region.
+
+*V_region
+
+#Variable region of immunoglobulin light and heavy chains, and T-cell
+receptor alpha, beta, and gamma chains. Codes for the variable amino
+terminal portion. Can be made up from V_segments, D_segments,
+N_regions, and J_segments.
+
+*V_segment
+
+#Variable segment of immunoglobulin light and heavy chains, and T-cell
+receptor alpha, beta, and gamma chains. Codes for most of the variable
+region (V_region) and the last few amino acids of the leader peptide.
+
+*variation
+
+#A related strain contains stable mutations from the same gene (e.g.,
+RFLPs, polymorphisms, etc.) that differ from the presented sequence at
+this location (and possibly others).
+
+*3'clip
+
+#3'-most region of a precursor transcript that is clipped off during
+processing.
+
+*3'UTR
+
+#Region near or at the 3' end of a mature transcript (usually following
+the stop codon) that is not translated into a protein; trailer.
+
+*5'clip
+
+#5'-most region of a precursor transcript that is clipped off during
+processing.
+
+*5'UTR
+
+#Region near or at the 5' end of a mature transcript (usually preceding
+the initiation codon) that is not translated into a protein; leader.
+
+* -10_signal
+
+#Pribnow box; a conserved region about 10 bp upstream of the start point
+of bacterial transcription units that may be involved in binding RNA
+polymerase; consensus=TAtAaT.
+
+* -35_signal
+
+#A conserved hexamer about 35 bp upstream of the start point of
+bacterial transcription units; consensus = TTGACa or TGTTGACA.
+
+>Biological Source Descriptor or Feature
+
+#This annotation is very important, as an entry cannot be processed by
+the databases unless it includes some basic information about the
+organism from which the sequence was derived. This basic information was
+entered previously in the submission, in the Organism and Sequences
+Form. The more detailed Organism Information form allows you to alter
+or add to the data you entered earlier.
+
+*Overview: Descriptor or Feature?
+
+#Sequin allows two types of biological source information to be entered,
+Biological Source Descriptors and Biological Source Features. Biological
+Source Descriptors, like other descriptors, provide organism information
+about an entire sequence, or an entire set of sequences, in an entry.
+Biological Source Features, like other features, provide organism
+information about a specific interval on a given sequence.
+
+#In most cases, you will want to use a Biological Source Descriptor, because
+all the sequences in the entry will derive from the same source.
+However, if you have sequenced a transgenic molecule, for example, one
+that is part plant and part bacterial, you would use Biological Source
+Features to annotate which sequence was derived from plant and which from
+bacteria.
+
+#To add a Biological Source Descriptor, select Biological Source under
+the Descriptor section of the Annotate menu. To add a Biological
+Source Feature, select Biological Source under the Bibliographic and
+Comments section of the Annotate menu.
+
+#Annotating a Biological Source Descriptor or Feature is similar to
+annotating any descriptor or feature. For help in creating descriptors
+and features, see the appropriate section of the help documentation.
+The following are instructions for filling out Biological
+Source-specific forms.
+
+*Organism Page
+
+**Names Subpage
+
+#The scrollable list contains the scientific names of many organisms.
+To reach a name on the list, either type the first few letters of the
+scientific name, or use the thumb bar. Click on a name from the list to
+fill out the scientific name field. If there is a common name for the
+organism, that field will be filled out automatically. You may also
+directly type in the scientific name. If you have any questions about
+the scientific or common name of an organism, see the NCBI
+<A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
+taxonomy browser
+</A>
+http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
+
+**Location Subpage
+
+***Location of Sequence
+
+#From the selection list, please enter the location of the genome that
+contains your sequence. Most entries will have a "Genomic" location.
+A brief description of the choices in this pop-up menu were listed
+previously.
+
+***Origin of Sequence
+
+#This menu is for the use of database personnel. Please leave this
+field empty. The Biological focus box should be checked in rare cases
+where multiple source features are annotated.
+
+**Genetic Codes Subpage
+
+#Please use these fields to select the nuclear and mitochondrial genetic
+code that should be used to translate the nucleic acid sequence. The
+genetic code for a eukaryotic organism is "Standard". If you selected
+an organism name from the scrollable list described above, this field
+was filled out automatically. Do not change these fields if they have
+been filled out automatically.
+
+#For more information regarding the translation tables available, see
+the NCBI Taxonomy
+
+<A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c">
+page
+</A>.
+
+**Lineage Subpage
+
+#This information is normally entered by the database staff. They will
+use the
+<A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
+Taxonomy database
+http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
+</A>
+ maintained by the NCBI/GenBank.
+
+#If you disagree with the lineage supplied please notify the database
+staff.
+
+#If you are running Sequin in its
+<A HREF="#NetConfigure">
+network-aware
+</A>
+mode, you will see a button labeled "Lookup Taxonomy". Click on this
+button to perform an automatic look-up of the taxonomic lineage of the
+organism. Sequin will perform the look-up by accessing the Taxonomy
+database and will fill out the Taxonomic Lineage and
+Division fields.
+
+#If you have any comments about the taxonomic lineage determined by
+Sequin, please submit these comments with your entry. Under the Sequin
+File menu, select Edit Submitter Info. Enter your comments in the box
+entitled "Special Instructions to Database Staff", on the Submission
+page.
+
+*Modifiers Page
+
+#This page allows you to enter additional information about the source
+and/or organism. Entering information is optional.
+
+**Source Subpage
+
+#Choose a modifier from the pull-down menu on the left side of the page
+and type the appropriate name on the right side of the page. If you do
+not find appropriate modifiers in the scroll down list, you can enter
+additional source information as text in the field at the bottom of the
+page. You may select as many modifiers as you want.
+
+#The following is a description of the available modifiers:
+
+#-Cell-line: Cell line from which sequence derives.
+
+#-Cell-type: Type of cell from which sequence derives.
+
+#-Chromosome: Chromosome to which the gene maps.
+
+#-Clone: Name of clone from which sequence was obtained.
+
+#-Clone-lib: Name of library from which sequence was obtained.
+
+#-Collected-by: Name of person who collected sample. Do not use
+accented or non-ASCII characters.
+
+#-Collection-date: Date sample was collected. Must use format
+23-Mar-2005, Mar-2005, or 2005.
+
+#-Country: The country of origin of DNA samples used for epidemiological
+or population studies.
+
+#-Dev-stage: Developmental stage of organism.
+
+#-Endogenous-virus-name: Name of inactive virus that is integrated into
+the chromosome of its host cell and can therefore exhibit vertical
+transmission.
+
+#-Environmental-sample: Identifies sequence derived by direct molecular
+isolation from an unidentified organism. Do not include extra text when
+using this modifier.
+
+#-Frequency: Frequency of occurrence of a feature.
+
+#-Fwd-PCR-primer-name: Name or designation of forward primer used for
+amplification.
+
+#-Fwd-PCR-primer-seq: Sequence of forward primer used for amplification.
+
+#-Genotype: Genotype of the organism.
+
+#-Germline: If the sequence shown is DNA and a member of the
+immunoglobulin family, this qualifier is used to denote that the sequence
+is from unrearranged DNA. Do not include extra text when using this
+modifier.
+
+#-Haplotype: Haplotype of the organism.
+
+#-Identified-by: Name of person who identified sample. Do not use
+accented or non-ASCII characters.
+
+#-Isolation-source: Describes the local geographical source of the organism
+from which the sequence was derived
+
+#-Lab-host: Laboratory host used to propagate the organism from which
+the sequence was derived.
+
+#-Lat-Lon: Latitude and longitude of location where sample was
+collected. Preferred format is decimal degrees N/S E/W.
+
+#-Map: Map location of the gene.
+
+#-Plasmid-name: Name of plasmid from which the sequence was obtained.
+
+#-Plastid-name: Name of plastid from which the sequence was obtained.
+
+#-Pop-variant: Name of the population variant from which the sequence was
+obtained.
+
+#-Rearranged: If the sequence shown is DNA and a member of the
+immunoglobulin family, this qualifier is used to denote that the sequence
+is from rearranged DNA. Do not include extra text when using this
+modifier.
+
+#Rev-PCR-primer-name: Name or description of reverse primer used for
+amplification.
+
+#Rev-PCR-primer-seq: Sequence of reverse primer used for amplification.
+
+#-Segment: Name of viral genome fragmented into two or more nucleic acid
+molecules.
+
+#-Sex: Sex of the organism from which the sequence derives.
+
+#-Subclone: Name of subclone from which sequence was obtained.
+
+#-Tissue-lib: Tissue library from which the sequence was obtained.
+
+#-Tissue-type: Type of tissue from which sequence derives.
+
+#-Transgenic: Identified organism that was the recipient of transgenic
+DNA. Do not include extra text when using this modifier.
+
+**Organism Subpage
+
+#Choose a modifier from the pull-down menu on the left side of the page
+and type the appropriate name on the right side of the page. If you do
+not find appropriate modifiers in the scroll down list, you can enter
+additional organism information as text in the field at the bottom of
+the page. You may select as many modifiers as you want.
+
+#The following is a description of the available modifiers:
+
+#-Acronym: Standard synonym (usually of a virus) based on the initials
+of the formal name. An example is HIV-1.
+
+#-Anamorph: The scientific name applied to the asexual phase of a fungus.
+
+#-Authority: The author or authors of the organism name from which sequence
+was obtained.
+
+#-Biotype: See biovar.
+
+#-Biovar: Variety of a species (usually a fungus, bacteria, or virus)
+characterized by some specific biological property (often geographical,
+ecological, or physiological). Same as biotype.
+
+#-Breed: The named breed from which sequence was obtained (usually applied
+to domesticated mammals).
+
+#-Chemovar: Variety of a species (usually a fungus, bacteria, or virus)
+characterized by its biochemical properties.
+
+#-Common: Common name of the organism from which sequence was obtained.
+
+#-Cultivar: Cultivated variety of plant from which sequence was obtained.
+
+#-Ecotype: The named ecotype (population adapted to a local habitat) from
+which sequence was obtained (customarily applied to populations of
+Arabidopsis thaliana).
+
+#-Forma: The forma (lowest taxonomic unit governed by the nomenclatural
+codes) of organism from which sequence was obtained. This term is usually
+applied to plants and fungi.
+
+#-Forma-specialis: The physiologically distinct form from which sequence
+was obtained (usually restricted to certain parasitic fungi).
+
+#-Group: Do not select this item.
+
+#-Isolate: Identification or description of the specific individual
+from which this sequence was obtained. An example is Patient X14.
+
+#-Old name: Do not select this item.
+
+#-Pathovar: Variety of a species (usually a fungus, bacteria or virus)
+characterized by the biological target of the pathogen. Examples
+include Pseudomonas syringae pathovar tomato and Pseudomonas syringae
+pathovar tabaci.
+
+#-Serogroup: See serotype.
+
+#-Serotype: Variety of a species (usually a fungus, bacteria, or virus)
+characterized by its antigenic properties. Same as serogroup and
+serovar.
+
+#-Serovar: See serotype.
+
+#-Specific-host: When the sequence submission is from an organism that
+exists in a symbiotic, parasititc, or other special relationship with
+some second organism, use this modifier to identify the name of the
+host species.
+
+#-Specimen-voucher: An identifier of the individual or collection of the
+source organism and the place where it is currently stored, usually an
+institution.
+
+#-Strain: Strain of organism from which sequence was obtained.
+
+#-Subgroup: Do not select this item.
+
+#-Sub-species: Subspecies of organism from which sequence was obtained.
+
+#-Substrain: Sub-strain of organism from which sequence was obtained.
+
+#-Subtype: Subtype of organism from which sequence was obtained.
+
+#-Synonym: The synonym (alternate scientific name) of the organism name
+from which sequence was obtained.
+
+#-Teleomorph: The scientific name applied to the sexual phase of a fungus.
+
+#-Type: Type of organism from which sequence was obtained.
+
+#-Variety: Variety of organism from which sequence was obtained.
+
+**GenBank Subpage
+
+#Please do not use this form. This field is reserved for information from
+NCBI's taxonomy database.
+
+*Miscellaneous Page
+
+**Synonyms Subpage
+
+#If there are alternative names for the organism from which the sequence
+was derived, enter them here. Please be aware that this is the
+appropriate field only for alternative names for the organism, not for
+alternative gene or protein names.
+
+**Cross-Refs Subpage
+
+#This page is for use by database staff only.
+
+>Publications
+
+*Overview: Descriptor or Feature?
+
+#Sequin allows two types of publications to be entered, Publication
+Descriptors and Publication Features. Publication Descriptors are
+bibliographic references that, like other descriptors, cover an entire
+sequence, or an entire set of sequences, in an entry. Publication
+Features are bibliographic references that, like other features, cover
+a specific interval on a given sequence.
+
+#Publications are entered into the Reference field of the database
+entry. References are citations of unpublished, in press, or published
+works that are relevant to the submitted sequence. Publications
+should provide information regarding the principle cloning and
+determination of the sequence within the record.
+
+#In general, there is one publication describing a sequence, and a
+Publication Descriptor should be used. To enter a Publication
+Descriptor, select Publications under the Annotate menu and click on
+Publication Descriptor.
+
+#However, if one publication describes the cloning of the 5' end of a
+gene, and another publication describes the cloning of the 3' end of
+the gene, Publication features may be used. To make a publication
+feature, choose Publication Feature in the Publications section of the
+Annotate menu. Enter the information about the publication, and then
+enter the nucleotide interval to which the publication refers on the
+Location page.
+
+*Citation on Entry Form
+
+**Status
+
+#Using the radio buttons, select one of the three options:
+
+#-Unpublished: Select this option if a manuscript has been written but
+not yet submitted or has been submitted for publication but has not yet
+been accepted.
+
+#-In Press: The article has been accepted for publication but is not yet
+in print.
+
+#-Published: The article has been published.
+
+**Class
+
+#Using the radio buttons, select the type of publication in which the
+sequence will appear.
+
+#-Journal
+
+#-Book Chapter
+
+#-Book
+
+#-Thesis/Monograph
+
+#-Proceedings Chapter: Abstract from a meeting
+
+#-Proceedings: A meeting
+
+#-Patent
+
+#-Online Publication: Used for journals which publish strictly online and
+do not issue print copies.
+
+#-Submission
+
+**Scope
+
+#Using the radio buttons, select one of the options.
+
+#-Refers to the entire sequence: Most publications should be classified
+as such.
+
+#-Refers to part of the sequence: For use only when a publication
+discusses only part of the presented sequence. You must enter the
+locations in the location tab in later forms. This selection is only
+valid when adding a Publication feature, not descriptor.
+
+#-Cites a feature on the sequence: This selection should only be made in
+limited cases. Its use must coincide with the use of the /citation
+qualifier on the given feature.
+
+#After you have filled out the Citation on Entry form, click on
+"Proceed" to see the next form.
+
+*Citation Information Form (General)
+
+**Authors Page
+
+***Names Subpage
+
+#Please enter the names of the authors. Note that the first name of the
+author is listed first. You can add as many authors to this page as
+necessary. After you type in the name of the third author, the box
+becomes a spreadsheet, and you can scroll down to the next line by
+using the thumb bar. The suffix toggle allows the addition of common
+suffixes to the author name. The consortium field should be used when
+a consortium is responsible for the sequencing or publication of the
+data. The consortium should not be the department or institute
+affiliation of the authors. Individual authors may be listed along
+with a consortium name.
+
+***Affiliation Subpage
+
+#Please enter information about the institution where the sequencing was
+performed.
+
+#Other pages in the Citation Information Form will be different,
+depending on the Class of publication selected in the Citation on Entry
+Form. Instructions for filling out the Citation Information Form for
+Journals is included here.
+
+*Citation Information Form (If Selected Class Was Journal)
+
+**Title Page
+
+#Enter title for manuscript in the box.
+
+**Journal Page
+
+#Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year
+fields by typing information into the boxes. Select the month with the
+pop-up menu. If necessary, choose an option from the Erratum pop-up
+menu and explain the erratum.
+
+#If you are running Sequin in its
+<A HREF="#NetConfigure">
+network-aware
+</A>
+mode, the program will look up the Title, Author, and Journal
+information in the MEDLINE database if you supply it with some minimal
+information. For example, if you know the MUID (MEDLINE Unique
+Identifier) of the publication, enter it in the appropriate box and
+select "Lookup By MUID." Sequin will automatically retrieve the rest
+of the information. One way to find the MUID of the publication is to
+look up the publication with the NCBI's
+
+<A HREF="http://www.ncbi.nlm.nih.gov/Entrez">
+Entrez
+</A>
+service. Alternatively, if you do not know the MUID, enter the Journal,
+Volume, Pages, and Year. Then select "Lookup Article". Sequin will
+retrieve the missing Title and Author information.
+
+#The PubStatus toggle is used by database staff. If you have used the
+"Lookup by MUID" or "Lookup by PMID" functions, this field may be
+populated. Please do not edit the information.
+
+**Remark Page
+
+#This page is reserved for use by the database staff.
+
+>File Menu
+
+*About Sequin
+
+#Details about the current version of Sequin.
+
+*Help
+
+#Launches the help documentation.
+
+*Open
+
+#Open an existing entry. This option will open a record that has been
+previously saved in Sequin. Furthermore, for analysis purposes, it can also
+open
+a FASTA-formatted sequence file. The sequence will be displayed in Sequin and
+can be analyzed with tools such as CDD Search, but it should not be submitted,
+because it does not have the appropriate annotations.
+
+*Close
+
+#Close this entry.
+
+*Export
+
+#Exports the currently displayed format to a file. Do not use export
+ASN1 for submission of sequences to the database.
+
+*Duplicate View
+
+#Duplicates the entry. You can then view the entry simultaneously in
+different Display Formats.
+
+*Save
+
+#Saves the entry. Note: This merely saves the entry so you can go back
+and edit it. It does not prepare the entry for submission to the
+database, that is, it does not validate the entry.
+
+*Save As
+
+#See Save.
+
+*Save as Binary Seq-entry
+
+#Saves the file in a compressed format and should be used only when the
+file is to be imported into other analysis programs. Do not use this
+option to save files for submission directly to GenBank.
+
+*Restore
+
+#Replaces the displayed record with a previously saved version. This
+feature is useful if you have made unwanted changes since you last saved
+the record.
+
+*Prepare Submission
+
+#Prepares the entry for submission to the database. See
+<A HREF="#SubmittingtheFinishedRecordtotheDatabase">
+Submitting the Finished Record to the Database
+</A>
+ in the Sequin help documentation.
+
+*Print
+
+#Prints the window that is currently selected. The selected window can
+be one of the Sequin forms or pages, or the help documentation.
+
+*Quit
+
+#Exit from Sequin.
+
+>Edit Menu
+
+*Copy
+
+#Copy the selected item.
+
+*Clear
+
+#Clear the selected item.
+
+*Edit Sequence
+
+#To edit a single sequence, select the sequence identifier in the Target
+Sequence pop-up menu, and click on Edit sequence. The sequence editor
+will be launched for that sequence. The
+<A HREF="#SequenceEditor">
+sequence editor
+</A>
+is discussed in more detail below.
+
+*Alignment Assistant
+
+#This option will launch the Alignment Assistant which is discussed in
+more detail
+
+<A HREF="#Workingwithsetsofalignedsequences">
+below
+</A>
+.
+
+*Edit Submitter Info
+
+#Opens up the Submission Instructions form, which allows you to enter
+additional information about the person submitting the record. Much of
+this information was entered on the first form in Sequin, the Submitting
+Authors form.
+
+#You can also save the information from the Submitting Authors form
+here, so that you can use it in subsequent Sequin submissions. Click
+on "Edit Submitter Info" and, under the file menu in the resulting
+Submission Instructions form, click on Export Submitter Info to save
+the information to a file. For subsequent Sequin submissions, if you
+have already saved the submittor information, click on Import Submitter
+Info under the File menu on the Submission page of the Submitting
+Authors form.
+
+**Submission Page
+
+#Indicate the type of submission. If it is a new submission, select
+New. If you are updating an existing submission in order to resubmit it
+to the databases, select Update. Check either the "Yes" or "No" radio
+button to indicate if the record should be released before publication.
+If you select "Yes", the entry will be released to the public after the
+database staff has added it to the database. If you select "No", fields
+will appear in which you can indicate the date on which the sequences
+should be released to the public. The submission will then be held back
+until formal publication of the sequence or
+GenBank Accession number, or until the Release Date, whichever comes
+first. If you have any special instructions, enter them in the box at
+the bottom of the page.
+
+**Contact Page
+
+#Update the name, affiliation, or contact numbers of the person
+submitting the record. Please supply a fax number to facilitate
+communication with database staff.
+
+**Citation Page
+
+#Update the names and affiliation of the people who should receive
+scientific credit for the generation of sequences in this entry. The
+address should list the principal institution in which the sequencing
+and/or analysis was carried out. If you are submitting the record as
+an update to the databases, explain the reason for the update on the
+Description subpage.
+
+*Update Sequence
+
+#This selection allows you to replace a sequence with another sequence,
+merge two sequences that overlap at their ends, 'patch' a corrected
+fragment of a sequence to the current sequence, or copy features from
+one sequence to another.
+
+#Use Single Sequence to import a sequence in FASTA or ASN.1 format (for
+example, a sequence record that has already been saved in Sequin). If
+you are running Sequin in
+
+<A HREF="#NetConfigure">
+Network Aware mode,
+</A>
+you can use Download Accession to import a record from Entrez. The
+Multiple Sequences option allows you to update multiple sequences using
+either FASTA or ASN.1 formats. In either format, each sequence
+identifier must be identical in the new and old sequences.
+
+#After you import the updated sequence, a new window will open that
+displays two graphical views and the text of the alignment of the new
+and old sequence. The first graphic displays the relative length of the
+two sequences and the length of the overlapping region between
+sequences. The second graphic represents any inserts, deletions, or
+point changes within the aligned region between the new and old
+sequences. Clicking on a region in this graphic will scroll to the
+corresponding nucleotide sequence in the alignment text below.
+
+#The Sequence Update box to the left shows the action that will be
+performed upon updating the sequence, i.e., no change, replace, extend
+5', extend 3', or patch. The patch function allows you to replace an
+internal fragment of the sequence without affecting flanking regions.
+You can also override the alignment between the new and old sequence
+using the Ignore alignment checkbox to force a sequence change of
+replace, Extend 5' or Extend 3'. This option allows you to append new
+sequence to with no overlap.
+
+#If the current sequence has annotation, you can use the Existing
+Features box to determine whether the annotation should remain or be
+removed upon updating the sequence. The Do not remove option is the
+default. However, you may chose to remove annotated features only in
+the aligned area, outside the aligned area, or to remove all currently
+annotated features.
+
+#When updating via Download Accession or an ASN.1 file, the Import
+Features box allows you to specify whether features from the new file
+should be imported to the existing record. The dialog offers
+different options for cases where the features on the new file are
+identical to those on the existing record.
+
+#If you are using the Multiple Sequences option, you may choose to
+review the sequences and update them one by one using the Update this
+Sequence box at the bottom of the window. You may skip a sequence
+update or choose to update all sequences at once without reviewing them
+in the Update Sequence dialog.
+
+#In any case, please carefully review the sequence and annotation in the
+record viewer after using the Update Sequence function.
+
+*Extend Sequence
+
+#This selection functions similar to the
+
+<A HREF="#UpdateSequence">
+Update Sequence
+</A>
+
+function. However, you can only extend the existing sequence in either
+the 5' or 3' direction in cases with no overlap between the existing
+and new sequences.
+
+*Feature Propagate
+
+#This selection allows you to propagate any annotated feature from one
+sequence in an aligned set to other sequences within the set. For
+example, if one nucleotide sequence in the alignment contains a CDS
+feature, you can annotate a similar CDS on the other nucleotide
+sequences in the set.
+
+#The default source of features to be propagated is the first member
+of the set. If you would like to use a different entry as the source of
+the features, scope to that entry in the Target Sequence menu before
+selecting Feature Propagate from the Edit menu.
+
+#The Feature Propagate window allows you to select which sequences
+should receive the new annotation and which features will be
+propagated. You can also select whether the features will be extended
+or split at gaps in the alignment. The split at gaps selection will
+produce two features, one on either side of the gap within the
+alignment. If you are propagating a CDS feature, you may specify that
+the translation end or extend through internal stop codons. You may
+also extend the translation after the stop codon on the source entry by
+chosing to translate the CDS after partial 3' boundary. If the CDS
+that you are propagating to other records is partial on either end, you
+should select the 'Cleanup CDS partials after propagation' check box.
+This will retain the partial nature of the CDS features on all records.
+ The fuse adjacent propagated intervals function will create one
+feature from two of the same type that contain abutting nucleotide
+intervals due to the nature of the alignment used for propagation.
+
+*Add Sequence
+
+#This selection allows you to add a new sequence to an existing
+population, mutation, phylogenetic, or environmental sample set.
+You may import the new entry in FASTA format or ASN.1 format (for
+example, a sequence record that has been saved in Sequin).
+
+*Parse File to Source
+
+#This selection allows you to add unique information for one source
+qualifier for each of the records in a batch or set. The input file
+must be in the format of a tab-delimited, two column table. The first
+column should list the SeqID exactly as it was listed in the original
+FASTA file. The second column should list the text value for the
+desired source qualifier for each record. Once the file has been
+imported, a pop-up box will appear with the source qualifiers listed in
+the pull down menus. The qualifiers are separated into three menus:
+one for taxonomic information, one for the Organism modifiers and one
+for the Source modifiers. For example, in order to add the clone
+designations 57 and 49 to the sequences labeled seq1 and seq2, the table
+
+seq1 57
+seq2 49
+
+should be used and clone should be selected from the Source modifiers
+pull-down menu.
+
+>Search Menu
+
+*Find ASN.1
+
+#Under this command, you can find and replace strings of letters in
+those fields of your submission that contain manually entered data.
+The fields that can be altered are Locus, Definition, Accession,
+Keywords, Source, Reference, and Features. To use this option, select
+Find and fill the Find and Replace lines with the appropriate text.
+Note that you cannot edit the sequence in this way.
+
+*Find FlatFile
+
+#Under this command, you can find strings of letters in all fields of
+your submission. You can use the Find First and Find Next buttons to
+identify the specified text sequentially through the flatfile.
+
+*Find by Gene
+
+#This option allows you to move quickly in the record viewer to a gene
+feature containing the specified gene symbol.
+
+*Find by Protein
+
+#This option allows you to move quickly in the record viewer to a CDS
+feature containing the specified product name.
+
+*Find by Position
+
+#This option allows you to move quickly in the record viewer to any
+feature annotated at the specified nucleotide location.
+
+*Validate
+
+#This option detects discrepancies between the format of your submission
+and that required by the database selected for entry. If discrepancies
+are present, it suggests ways in which to correct them. See the topic on
+
+<A HREF="#SubmittingtheFinishedRecordtotheDatabase">
+Submitting the Finished Record to the Database
+</A>
+ in the Sequin help documentation.
+
+*CDD Search
+
+#Performs a CDD BLAST search of the selected sequence against the
+NCBI's
+<A HREF="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml">
+Conserved Domain Database
+</A>
+. To do a CDD BLAST search, Sequin must be in its network aware mode.
+
+#CDD currently contains domains derived from two popular collections,
+Smart and Pfam, plus contributions from colleagues at NCBI. The source
+databases also provide descriptions and links to citations. Since
+conserved domains correspond to compact structural units, CDs contain
+links to 3D-structure via Cn3D whenever possible.
+
+#The results of the CDD search will be displayed in the record
+viewer. These results are for your use only and should be removed
+from the record before submission.
+
+*Vector Screen
+
+#This option allows you to run a BLAST search of your nucleotide
+#sequence(s) against NCBI's
+<A HREF="http://www.ncbi.nlm.nih.gov/VecScreen/UniVec.html">
+UniVec
+</A>
+database. We highly recommend that you run this analysis and remove
+any vector contamination before submission. The UniVec database
+contains only one copy of every unique sequence segment from a large
+number of vectors. It also contains sequences for adapters, linkers
+and primers commonly used.
+
+#To run Vector screen on a submission containing multiple sequences,
+scope to ALL SEQUENCES in the Target Sequence pull-down before running
+the analysis. If there are many sequences, a status bar will appear
+indicating the progress of the search. If no contamination is found, a
+pop-up box will appear to notify you. If contamination is found, a
+miscellaneous feature will be annotated on the flatfile with the
+location of the contamination. Details will include the relative
+strength of the BLAST hit. You must trim the nucleotide sequence to
+remove this feature before submission.
+
+*ORF Finder
+
+#The ORF Finder shows a graphical representation of all the open reading
+frames (ORFs) in the nucleotide sequence. This tool allows you to
+select ORFs and have them appear as coding sequence (CDS) features on
+the sequence record.
+
+#The ORFs, indicated by colored boxes, are defined as the longest
+sequence containing a start codon and a stop codon. If the
+entire nucleotide sequence is an open reading frame but does not
+contain an initial start or a terminal stop codon, it will be indicated
+as an ORF as well. All six reading frames are shown; the top three
+boxes represent the plus strands, and the bottom three boxes the minus
+strands. The nucleotide sequence intervals of the ORFs are displayed in
+descending length order on the right side of the window. Intervals on
+the complementary (minus) strand are indicated by a 'c'. ORFs can be
+selected by clicking either directly on them or on the sequence
+interval. The ORF length button selects the length of ORFs that are
+displayed. For example, the default of 10 shows all ORFs that are
+greater than 10 nucleotides in length. Clicking on the box labelled ORF
+changes the display; potential start codons are indicated in white, and
+stop codons in red. ORFs can be selected in this display also. The
+definition of start and stop codons is dependent on the genetic code
+that was selected. Be sure to choose the appropriate genetic code for
+translating the sequence before opening the ORF finder.
+
+*Select Target
+
+#This option changes the sequence that is selected in the Target
+Sequence pop-up. Type the SeqID of the sequence in the box, and the
+record viewer will be updated to display that sequence.
+
+>Misc Menu
+
+*Style Manager
+
+#The Style manager allows you to choose between different formats in
+which to view the Graphical Display Format. The graphical display is
+selected by choosing the Graphic display format on the record viewer.
+Using the Style Manager, you can also copy the style or modify it to
+suit your needs.
+
+*Net Configure
+
+#As a default, Sequin is available as a stand-alone program. However,
+the program can also be configured to exchange information with the NCBI
+(GenBank) over the Internet. The network-aware mode of Sequin is
+identical to the stand-alone mode, but it contains some additional
+useful options.
+
+#Sequin will only function in its network-aware mode if the computer on
+which it resides has a direct Internet connection. Electronic mail
+access to the Internet is insufficient. In general, if you can install
+and use a WWW browser on your system, you should be able to install and
+use network-aware Sequin. Check with your system administrator or
+Internet provider if you are uncertain as to whether you have direct
+Internet connectivity.
+
+#There are two ways to change Sequin into its network-aware mode. If
+you are still on the initial Welcome to Sequin form, select Net
+Configure under the Misc menu. If you have already worked on a Sequin
+submission and are looking at the record in the record viewer, select
+the Net Configure option from the Misc menu.
+
+#Most users will be able to use the default (Normal) settings on the
+Network Configuration page; select Accept to complete the configuration
+process.
+
+#If a "Normal" Connection does not work, you may need to select the
+Firewall Connection. Contact your system administrator to determine
+what to enter into the Proxy and Port fields. If you do not have
+access to the domain name server (DNS), uncheck this box.
+
+#The Timeout pop-up selects the length of time that your local copy of
+Sequin will wait for a reply from the NCBI server. You may need to set
+this number higher (i.e., 60 seconds or 5 minutes) if you are outside
+of the United States or have a bad internet connection.
+
+#If you have problems setting up the network configuration, contact
+
+<a href="mailto:info@ncbi.nlm.nih.gov">
+info@ncbi.nlm.nih.gov.
+</a>
+
+#If you would like to change Sequin back to its stand-alone mode, select
+Net Configure again from the Misc menu. Click on Connection: None.
+
+#The network-aware mode of Sequin allows you to perform a number of
+additional, important functions. These functions all appear as
+additional menu items. A brief description of these functions follows.
+Further descriptions are available as indicated elsewhere in the help
+documentation.
+
+**Updating Existing GenBank Records
+
+#Using Sequin in its network-aware mode, you can download an existing
+GenBank record from Entrez using the GenBank accession number or GI
+identification number (NID). You can then use Sequin to make any
+necessary changes to the record, and resubmit it to GenBank as a
+sequence update.
+
+<A HREF="#WelcometoSequinForm">
+Instructions
+</A>
+for submitting sequence updates are presented under the Welcome to
+Sequin Form. You can download any record from Entrez and look at it in
+Sequin. However, you can only formally update those records which you
+have submitted since submitters retain editorial control of their
+records.
+
+**Performing a PubMed Look-Up
+
+#In its network-aware mode, Sequin can import the relevant sections of a
+PubMed record directly into a sequence submission record. Rather than
+typing in the entire citation, you can enter minimal information, such
+as the PubMed Unique Identifier (PMID), or Journal name, volume, year,
+and pages. The
+
+<A HREF="#JournalPage">
+PubMed lookup
+</A>
+is explained in the section of the documentation entitled Publications.
+
+**Performing a Taxonomy Look-up
+#In its network-aware mode, Sequin can look
+up the taxonomic lineage of an organism from the NCBI's Taxonomy
+database. This look-up is normally performed by the NCBI database staff
+after the record has been submitted to GenBank. If you look up the
+taxonomy before submitting the sequence, you can make a note in the
+record of any disagreements. The
+<A HREF="#LineageSubpage">
+taxonomy lookup
+</A>
+is explained in the section of the documentation covering
+Biological Source: Organism page: Lineage subpage.
+
+**Accessing the NCBI DeskTop
+#The NCBI DeskTop displays the internal
+structure of the record being viewed in Sequin. The
+<A HREF="#NCBIDeskTop">
+DeskTop
+</A>
+is explained under the Misc menu.
+
+*NCBI DeskTop
+
+#This option is only available if you are running Sequin in its
+<A HREF="#NetConfigure">
+network-aware
+</A>
+mode.
+
+#The NCBI DeskTop provides a view of the internal structure of the
+Sequin record, the ASN.1. Its display resembles a Venn diagram and
+represents all the structures represented in the ASN.1 data model.
+
+#In addition, a number of undocumented software tools from the NCBI can
+be accessed from the DeskTop. These tools are components of the NCBI
+portable software Toolkit. You can also customize these functions using
+the Toolkit with your own software tools. The Toolkit and its
+documentation are available from the NCBI by anonymous
+<A HREF="ftp://ftp.ncbi.nih.gov/toolbox/README">
+FTP.
+</A>
+
+#The DeskTop should only be used by very seasoned users. At this time,
+we are not providing any documentation for these specialized functions.
+
+>Annotate Menu
+
+#This menu allows you to enter features and descriptors on the sequence.
+
+#The first six options, Genes and Named Regions, Coding Regions and
+Transcripts, Structural RNAs, Bibliographic and Comments, Sites and
+Bonds, and Remaining Features refer to types of Features that can be
+added to the sequence. Features are described in more detail in the
+above section entitled
+<A HREF="#Features">
+Features.
+</A>
+
+#If you are submitting a set of similar sequences, you can add the same
+feature across the entire span of each by using the Batch Feature Apply
+option. The feature must span the entire nucleotide sequence of each
+member; you can not annotate specific nucleotide locations using this
+option (for this, see
+
+<A HREF="#FeaturePropagate">Feature Propagate</A>).
+
+For each feature, you will be prompted to designate whether the feature
+is 5' or 3' partial and whether is is on the plus or minus strand. You
+may also add a comment or other qualifier to the feature. The Add
+Qualifier option allows you to add a qualifier to an existing feature.
+You must specify the feature and qualifier in the Add Qualifier pop-up
+box. Source qualifiers can be added to all entries using the Add
+Source Qualifier option. Qualifiers specific to the CDS and gene can
+be added using Add CDS-Gene-Prot-mRNA and RNA qualifiers using Add RNA
+Qual. In each case, a pop-up box appears with qualifier options
+appropriate for that feature.
+
+#The Batch Feature Edit function allows you to edit existing qualifiers.
+ For each menu choice, a pop-up box allows you to select the feature
+containing the qualifier and the specific qualifier to be edited. You
+can use the Find/Replace text boxes to edit the information contained
+within the qualifier.
+
+#The Publications option allows you to add a Publication Feature or
+Publication Descriptor to the record. Publications are described in
+more detail in the above section entitled
+
+<A HREF="#Publications">
+Publications.
+</A>
+
+#The Descriptors option allows you to add Descriptors to the
+record. Descriptors are described in more detail in the section
+entitled
+<A HREF="#Descriptors">
+Descriptors,
+</A>
+above.
+
+#The Generate Definition Line option will generate a title for your
+sequence based on the information provided in the record. This option
+will work for single sequences as well as sets of sequences, and can
+handle complex annotations with multiple features. The title will
+follow GenBank conventions, but may be modified by the database staff
+if it is not appropriate. The title you enter here will replace any
+title you entered elsewhere in the submission, for example, any title
+that was attached to the nucleotide sequence. For a description of
+definition lines, see
+
+<A HREF="#NucleotideDefinitionLine(Title)">
+Nucleotide Definition Line (Title)
+</A>
+, above.
+
+>Options Menu
+
+*Font
+
+#Use this item to change the display font. From the pop-up menus,
+choose the style and size of type. For additional changes, mark the
+Bold, Italic, or Underline check boxes. The default font is 10-point
+Courier.
+
+>Sequence Editor
+
+#This editor allows you to modify the nucleotide or amino acid sequences
+and corresponding annotation in your entry. Although the Sequence Editor
+does allow you to undo changes you make to the sequence, we strongly
+suggest that you save a copy of the entry before launching the Sequence
+Editor so that you can revert to it if necessary.
+
+*Starting the Sequence Editor
+
+#The sequence that appears in the editor is dependent on the sequence(s)
+selected in the Target Sequence pull-down list. There are two ways to
+launch the sequence editor for nucleotide sequences. First, you can
+double click within sequence in any display format of the record viewer.
+A window containing the DNA sequence will appear. Second, in the record
+viewer, select the sequence that you would like to edit in the Target
+Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You
+can launch the editor for protein sequences by selecting the protein
+sequence in the Target Sequence pop-up menu and double clicking within
+the protein sequence. A window containing the protein sequence will
+appear.
+
+*Moving around the Sequence Editor
+
+#The cursor can be moved with the mouse or the arrow keys. The display
+window will change to show the position of the cursor. The sequence
+location of the first residue on each line is indicated on the left side
+of the window. The cursor location, or the range of sequences selected
+by the mouse, is shown in the upper left corner of the window. If you
+want to move the cursor to a specific location, type the number in the
+box on the top left of the sequence editor window, and hit the Go to
+button. If you want to look at a specific sequence, but not move the
+cursor to it, type the number in the upper right box of the window and
+hit the Look at button.
+
+*Editing Sequence and Existing Annotation
+
+#Select a piece of sequence by highlighting it with the mouse. To
+select the entire sequence, click on a sequence location number on the
+left side of the window. Any sequence that is highlighted in the
+Sequence Editor will show up as a box on the sequence when it is viewed
+in the Graphic Display Format.
+
+#One way to insert and delete residues is with the mouse. Move the
+cursor to the appropriate location and type. Text will be inserted to
+the left of the cursor. Delete sequence with the backspace or delete
+key. Text will be deleted to the left of the cursor. To delete a block
+of sequence, highlight it with the mouse and use the delete or backspace
+key.
+
+#Another way to insert and delete residues is with options under the Edit
+menu of the Sequence Editor. Use Cut to remove, or Copy to copy,
+highlighted residues. Copied residues can then be pasted elsewhere
+within the sequence by using the Paste option.
+
+#Features annotated via the record viewer will be displayed in a
+graphical format within the sequence editor. CDS features will be be
+displayed as a blue line across the appropriate nucleotide location. All
+other features will be displayed as a black line. To the left of the
+line, the name of the feature is displayed. In the case of CDS or mRNA
+features, the product name is shown. For gene features, the gene locus
+is shown.
+
+#Double-clicking on the feature will launch the feature editor just as in
+the record viewer. However, you can also change the nucleotide location
+of any feature within the graphical view. To move the entire feature,
+select the feature and drag it to the appropriate location while holding
+down the mouse button. To alter the 5' or 3' end of a feature, click on
+the feature's end and drag to the new location while holding down the
+mouse button.
+
+#Before moving the nucleotide locations of a CDS feature, it may be
+useful to view the codons in the current translation. You can do this by
+clicking on the feature line and releasing the mouse button. A grid will
+be displayed that shows the triplet location for the current annotation.
+Once you have changed the nucleotide location of a CDS feature in the
+graphical view, you can see the new translation by using the Translate
+CDS button at the bottom of the window.
+
+#To save changes you have made to the sequence, press the Accept button
+at the bottom of the Sequence Editor display window. If you do not want
+to save the changes, press the Cancel button at the bottom of the
+Sequence Editor display window. Selecting either Accept or Cancel will
+quit the Sequence Editor and return you to the record viewer. Any
+changes you make will not become a permanent part of the Sequin record
+until you Save the record in the record viewer.
+
+#New features can be added using the Features menu.
+
+*Sequence Editor Window Buttons
+
+**Go to
+
+#Moves the cursor to the indicated location.
+
+**Look at
+
+#Moves the window to the indicated location without moving the cursor.
+
+**Merge Feature Mode/Split Feature Mode
+
+#In merge mode, any new sequence that is entered into a region spanned
+by an existing feature becomes part of that feature. For example, if
+you enter new sequence in the middle of a CDS, that sequence will be
+translated as part of the CDS. In split mode, the new sequence
+interrupts the feature. For example, if you enter new sequence in the
+middle of a CDS, the CDS will be interrupted by that sequence (see the
+location of the CDS in the record viewer).
+
+**Numbering
+
+#Allows the sequence location numbering to be hidden, displayed on the
+side, or displayed on the top of the sequence.
+
+**Grid
+
+#Allows the display to show a grid separating each feature and sequence
+for easier viewing.
+
+**Show/Hide Features
+
+#This box toggles between hiding and showing the features on a sequence.
+
+**Accept
+
+#Closes the Sequence Editor after saving all of the changes made to
+sequences and features.
+
+**Cancel
+
+#Closes the Sequence Editor without saving any changes made to sequences or
+features.
+
+**Translate CDS
+
+#Allows translation of coding region features after the location has been
+changed within the graphical view.
+
+*Sequence Editor File Menu
+
+**Export
+
+#Allows the export of a range of sequence as a FASTA file or text file.
+Using the text option will also export overlapping features if they are
+displayed. If the features are first hidden, only the sequence will be
+exported. All protein translations displayed at the time of export, will
+be exported as well.
+
+**Accept
+
+#Closes the Sequence Editor after saving all of the changes made to
+sequence and features.
+
+**Cancel
+
+#Closes the Sequence Editor without saving any changes made to sequences
+of features.
+
+*Sequence Editor Edit Menu
+
+**Undo
+
+#Undoes all actions performed in the Sequence Editor since the last save.
+
+**Redo
+
+#Restores changes removed with Undo option
+
+**Cut
+
+#Removes the highlighted sequence. This sequence can be pasted elsewhere.
+
+**Paste
+
+#Pastes a cut or copied sequence to the right of the cursor.
+
+**Copy
+
+#Copies the highlighted sequence. This sequence can be pasted elsewhere.
+
+**Find
+
+#Allows you to find DNA or amino acid sequence patterns in your sequence.
+ The search is case insensitive. To find an exact match to a DNA
+sequence pattern, type the pattern in the box. The number of items found
+will be displayed and you can toggle through each instance with the Find
+Next button. To find the reverse complement of the pattern, click on
+the reverse complement box at the bottom of the pop-up box.
+
+#To find an exact match to an amino acid seqeunce pattern, type that
+sequence in the box, and click on "translate sequence". Sequin will look
+for all occurrences of that pattern in all six open reading frames. The
+DNA sequence encoding that protein sequence in any of the six reading
+frames will be hightlighted.
+
+**Translate CDS
+
+#Allows translation of coding region features after the location has been
+changed within the graphical view.
+
+**Complement
+
+#Shows the complement of the submitted strand underneath the original.
+
+**Reading Frames
+
+#Shows the indicated phase translation of the selected coding sequence.
+You can select any or all of the six reading frames, all reading frames
+or all positive or negative frames.
+
+**Protein Mismatches
+
+#Indicates amino acid which does not match conceptual translation
+following a nucleotide sequence change. The original amino acid sequence
+will be displayed until the Translate CDS function is used. Differences
+will be indicated by a red box around the amino acid abbreviation.
+
+**On-the-fly Protein Translations
+
+#Creates a second amino acid sequence in the display which retranslates
+as the nucleotide sequence is changed to allow side-by-side comparison to
+the original amino acid sequence.
+
+*Sequence Editor Features Menu
+
+#The menu contains a long list of all features that can be annotated on a
+sequence. These features are the same as those that are accessible
+through the main Sequin Annotate menu.
+
+#You can annotate features either in the Annotate menu or in the Sequence
+Editor. If you annotate them in the Annotate menu, you must type in the
+nucleotide sequence location of the feature. However, if you add
+features from the Sequence Editor, you can highlight the sequence that
+the feature covers, and the location of the sequence will be
+automatically entered in the feature location box. Additional
+explanations of how to annotate features are provided in the section on
+<A HREF="#Features">
+Features.
+</A>
+
+>Working with Sets of Aligned Sequences
+
+#Sequin allows you to work with aligned sets of closely related
+nucleotide sequences that are part of a population, phylogenetic, or
+mutation study. If the sequences are imported in a pre-aligned format,
+such as PHYLIP, Sequin uses this alignment. If the sequences are
+imported individually in FASTA format, Sequin can generate its own
+alignment.
+
+#You can view the aligned sequences in the Sequence Alignment Editor. In
+the record viewer, select All Sequences in the Target Sequences menu,
+and select the Alignment Display Format.
+
+#The Alignment Assistant is launched by selecting Alignment Assistant
+from the Edit menu in the record viewer. It can be used to apply
+features to the whole set of sequences using the alignment coordinates.
+Rather than calculating the nucleotide coordinates for every feature on
+every nucleotide sequence, you may select the feature's location using
+its alignment coordinates and apply it to every member of the set
+simultaneously. Sequin will calculate the nucleotide locations as they
+apply to each member of the set.
+
+*Alignment Assistant Window Buttons
+
+**Go to
+
+#The Go to alignment position and Go to sequence position buttons both
+scroll the aligment assistant so that the requested position is
+visible. If the requested position is already visible, nothing will
+happen. Unlike the Sequence editor window, the 'go to' button does not
+control the cursor position.
+
+**Numbering
+
+#Allows the sequence location numbering to be hidden, displayed on the
+side, or displayed on the top of the sequence.
+
+**Grid
+
+#Allows the display to show a grid separating each feature and sequence for easier viewing.
+
+**Features Toggle
+
+#It is possible to view annotated features in the aligment assistant.
+The features are displayed as a bar underneath the coordinates for that
+feature. The identity of the feature is displayed in the left-hand
+column. The default selection is to have the features Hidden. You may
+display the features associated only with the Target Sequence or
+features annotated on All Sequences in the alignment.
+
+*Alignment Assistant File Menu
+
+**Export
+
+#Allows you to export the alignment to a file in three different
+formats. The contiguous and interleaved options export the alignment
+accordingly in FASTA+GAP format. The text representation option saves
+the alignment as it appears in the Alignment Assistant. Note that with
+this option features are included if they are displayed at the time of
+export.
+
+**Close
+
+#Closes the Alignment Assistant window and saves any changes made.
+
+*Alignment Assistant Edit Menu
+
+**Remove Sequences from Alignment
+
+#Allows you to remove selected sequence(s) from the alignment. Select
+the sequence by clicking on it. You can select multiple sequences by
+holding down the control key. The sequence will then be highlighted in
+grey. Note that this option will remove the sequence from the
+alignment, but it is still present in your submission.
+
+**Validate Alignment
+
+#Checks for problems with the alignment. If errors are reported, please
+review and attempt to fix your alignment before submission.
+
+**Propagate Features
+
+#This function is the same as that available under the Edit Menu in the
+record viewer. A full description is available
+
+<A HREF="#FeaturePropagate">
+above
+</A>
+.
+
+*Alignment Assistant View Menu
+
+**Target
+
+#Allows you to select a sequence within the alignment as the target
+sequence. This can also be done by double-clicking on the sequence
+within the alignment. The SeqID of the target sequence will be
+displayed in red. Features can be displayed on the target sequence
+only and it is the sequence used for comparison in the
+
+<A HREF="#ShowSubstitutions">
+Show Substitutions
+</A>
+view.
+
+**Show Substitutions
+
+#Changes the alignment view so that identities are replaced with a "."
+and only substitutions are shown. The substitutions and identities are
+relative to the selected target sequence.
+
+*Alignment Assistant Features Menu
+
+#Allows the annotation of features to a single sequence or all sequences
+within the alignment. All features available in this menu are
+discussed through the main Sequin Annotate menu.
+
+#Select the feature location by clicking the start location on one of
+the sequences, keeping the mouse button depressed, drag the cursor to
+the end of the feature location. The selected area will now be
+underlined and red and the alignment coordinates of this area will be
+displayed in the upper left of the Alignment Assistant window.
+
+**Apply to Target Sequence
+
+#Allows you to choose a feature to be applied only to the target
+sequence. The locations may be entered manually or can be determined
+based on highlighting the sequence as described above.
+
+**Apply to Alignnent
+
+#Allows you to add the selected feature to all sequences within your
+alignment based on the alignment coordinates you have selected. Note
+that in the feature pop-up boxes in this menu, the Location will always
+be entered as the location relative to the alignment coordinates.
+
+<HR>
+
+<CENTER>
+<P> 
+<P CLASS=medium1><B>Questions or Comments?</B>
+<BR>Write to the <A HREF="mailto:info@ncbi.nlm.nih.gov">NCBI Service
+Desk</A></P>
+<P CLASS=medium1>Revised December 2, 2005
+
+</CENTER>
+
+<!-- end of content -->
+
+</body>
+</html>
+